CN111378661A - Gene for inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis - Google Patents
Gene for inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis Download PDFInfo
- Publication number
- CN111378661A CN111378661A CN202010166621.2A CN202010166621A CN111378661A CN 111378661 A CN111378661 A CN 111378661A CN 202010166621 A CN202010166621 A CN 202010166621A CN 111378661 A CN111378661 A CN 111378661A
- Authority
- CN
- China
- Prior art keywords
- cells
- breast cancer
- lncrna
- invasion
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Oncology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of genetic engineering, and discloses a gene for inhibiting proliferation, invasion and transfer of breast cancer cells and promoting apoptosis, wherein the gene is NR _ 026882. The invention detects the expression conditions of LncRNA-DKFZP434K028 in normal mammary epithelial cells MCF-10A and breast cancer cells by fluorescent quantitative PCR, compared with the normal mammary epithelial cells MCF-10A, the expression of LncRNA-DKFZP434K028 in the breast cancer cells is obviously up-regulated, the expression level in highly invasive cells MDA-MB-231 is the highest, and the expression level in less invasive cells MCF-7 is the lowest. The LncRNA-DKFZP434K028 knockout can inhibit the proliferation and invasion capacity of breast cancer cells MDA-MB-231 and promote the apoptosis of MDA-MB-231. The invention has important significance for diagnosing and treating the breast cancer.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a gene for inhibiting proliferation, invasion and transfer of breast cancer cells and promoting apoptosis.
Background
The female breast is composed of skin, fibrous tissue, breast glands and fat, and breast cancer is a malignant tumor that occurs in the mammary gland epithelial tissue. Breast cancer occurs in 99% of women and only 1% in men. Mammary gland is not an important organ for maintaining human body life activity, and the in-situ breast cancer is not fatal; however, the breast cancer cells lose the characteristics of normal cells, and the cells are loosely connected and easily fall off. Once cancer cells are shed, free cancer cells can be disseminated to the whole body along with blood or lymph fluid to form metastasis, which endangers life. At present, breast cancer becomes a common tumor threatening the physical and mental health of women. The incidence of breast cancer worldwide has been on the rise since the end of the 70 s of the 20 th century. In the United states, 1 woman will have breast cancer in their lifetime. China is not a high-incidence country of breast cancer, but is not optimistic, and the growth rate of the incidence of breast cancer in China is 1-2% higher than that of the high-incidence country in recent years. According to 2009 breast cancer onset data published by the national cancer center and health department disease prevention and control agency 2012, it is shown that: the incidence of breast cancer of women in the national tumor registration area is 1 st of malignant tumors of women, the incidence (thickness) of breast cancer of women is 42.55/10 ten thousand in total nationwide, 51.91/10 ten thousand in cities and 23.12/10 ten thousand in rural areas. Breast cancer has become a major public health problem in the current society. The global breast cancer mortality rate has shown a decreasing trend since the 90 s of the 20 th century; firstly, the breast cancer screening work is carried out, so that the proportion of early cases is increased; secondly, the development of comprehensive treatment of breast cancer improves the curative effect. Breast cancer has become one of the most effective solid tumors.
In summary, the problems of the prior art are as follows:
(1) in the prior art, theoretical basis cannot be provided for expression in breast cancer cells, expression in highly invasive cells MDA-MB-231 and expression in less invasive cells MCF-7.
(2) The prior art can not accurately inhibit the proliferation, invasion and metastasis of breast cancer. Clinically, the breast cancer treatment cannot achieve the effects of inhibiting proliferation, invasion and metastasis, and cannot improve the survival rate of patients. Our technology provides a theoretical basis for the treatment of clinical target genes.
(3) The LncRNA can regulate and control coding protein, research the influence of the LncRNA on breast cancer proliferation and invasion and metastasis, and is beneficial to disclosing molecular mechanisms of breast cancer invasion and metastasis, so that biomarkers for breast cancer diagnosis and prognosis judgment are screened, and meanwhile, effective molecular targeted drugs for resisting breast cancer proliferation invasion and metastasis can be designed.
The difficulty of solving the technical problems is as follows: an accurate target medicine which can effectively inhibit the invasion and metastasis of breast cancer cells is searched.
The significance of solving the technical problems is as follows:
(1) provides a potential targeted drug for screening and inhibiting breast cancer invasion and metastasis, and the drug can play a role in inhibiting breast cancer invasion and metastasis by inhibiting LncRNA regulated protein.
(2) Provides a medicine for treating breast cancer, and realizes the precise molecular therapy of the breast cancer.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a gene for inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis.
The invention is realized by the fact that the gene for inhibiting the proliferation, invasion and metastasis of the breast cancer cells and promoting the apoptosis is NR _026882 (LncRNA-DKFZP 434K 028).
Further, the long-chain non-coding RNA is RNA without the capacity of coding protein, and the length is more than 200 nt; LncRNA-DKFZP434K028 is located on chromosome chr11, and has a length of 936nt and a Gene ID of lnc-TMEM 258-3.
Another object of the present invention is to provide a method for detecting a gene that inhibits proliferation, invasion and metastasis of a breast cancer cell and promotes apoptosis, the method comprising the steps of:
first step, expression of LncRNA-DKFZP434K028 in cells: detecting the expression condition of LncRNA-DKFZP434K028 in normal mammary epithelial cells MCF-10A and breast cancer cells MDA-MB-231, MCF-7 and T47D by fluorescent quantitative PCR;
further, the long-chain non-coding RNA is RNA without the capacity of coding protein, and the length is more than 200 nt; LncRNA-DKFZP434K028 is located on chromosome chr11, and has a length of 936nt and a Gene ID of lnc-TMEM 258-3.
Another object of the present invention is to provide a method for detecting a gene that inhibits proliferation, invasion and metastasis of a breast cancer cell and promotes apoptosis, the method comprising the steps of:
first step, expression of LncRNA-DKFZP434K028 in cells: detecting the expression condition of LncRNA-DKFZP434K028 in normal mammary epithelial cells MCF-10A and breast cancer cells MDA-MB-231, MCF-7 and T47D by fluorescent quantitative PCR;
second, lentivirus infects cells: infecting breast cancer cells MDA-MB-231 by shRNA lentivirus, successfully knocking out LncRNA-DKFZP434K028 in the cells, screening out stable cell strains, calling the MDA-MB-231 cells infected with RNAi lentivirus as shDKFZP434K028, and calling the cells infected with control lentivirus MDA-MB-231 as shCtrl;
step three, detecting cell proliferation by using a CCK8 kit: the CCK8 kit detects the proliferation capacity of cells before and after infection, and the result shows that the LncRNA-DKFZP434K028 is knocked out to inhibit the proliferation capacity of MDA-MB-231 cells;
fourthly, detecting the invasion capacity of cells before and after infection by a cell scratch detection experiment, and knocking out the invasion capacity of the LncRNA-DKFZP434K028 for inhibiting MDA-MB-231 cells.
Fifthly, detecting the apoptosis condition of cells before and after infection by a flow cytometer, knocking out LncRNA-DKFZP434K028 to promote the apoptosis of MDA-MB-231 cells.
Further, the fluorescent quantitative PCR of the expression of LncRNA-DKFZP434K028 in the first-step cells includes:
step one, extracting total RNA in cells;
step two, synthesizing first strand cDNA by using M-MLV reverse transcriptase;
and step three, detecting the expression quantity of LncRNA-DKFZP434K028 in the cells by using a SYBR Green fluorescent quantitative PCR kit of Bio-Rad.
Further, the step one of extracting total RNA from the cells specifically comprises the following steps:
(1) sucking up culture solution of normal mammary epithelial cells MCF-10A or breast cancer cells MDA-MB-231, MCF-7 and T47D in a 6-hole plate, adding 1mL of TRIzol into each hole to cover the cells, blowing and beating for 3 times by using a suction tube or a sample injector, completely cracking the cells, and transferring the cells into a centrifuge tube;
(2) adding 0.2mL of chloroform into a centrifuge tube filled with the lysate, fully and uniformly shaking on a shaker for 20 seconds, and standing for 5 minutes at room temperature; centrifuging at 2000g and 4 ℃ for 10 minutes, sucking the upper aqueous phase containing the total RNA into a new centrifuge tube, and sucking 0.6mL of upper aqueous phase per mL of TRIzol;
(3) adding isopropanol with the same volume as the upper water phase, reversing for several times, mixing, and precipitating at room temperature for 5 minutes. Centrifuging at 12000g for 10 min at 4 ℃, and detecting RNA precipitation at the bottom of the tube; discarding the supernatant, adding 1mL of 75% ethanol into each mL of TRIzol, and reversing and uniformly mixing to clean RNA precipitate; centrifuging at 12000g and 4 ℃ for 2 minutes; inverting at room temperature and air drying for 5-10 min;
(4) adding DEPC treated water to dissolve the RNA precipitate; storing at-80 ℃.
Further, the step three is 2–△△CTCalculating the relative expression quantity of LncRNA-DKFZP434K 028; the primer sequence of LncRNA-DKFZP434K028 is as follows: forward primer: 5'-CCACATACTCCAGCACCCAA-3', revertprimer: 5'-TCTTCACGGACCTAGCACCTT-3' are provided. GAPDH was used as internal reference.
Further, the step of infecting the cells with the lentiviruses specifically comprises:
(1) cell resuscitation
1) Taking out the cell freezing tube from the liquid nitrogen tank;
2) quickly placing into 37 deg.C water bath, and thawing quickly by shaking;
3) after complete thawing, 1300rpm, centrifuging for 3 min;
4) wiping the freezing tube with 75% alcohol for disinfection, and transferring to a biological safety cabinet;
5) the supernatant of the frozen stock solution was aspirated off, and 1mL of the solution was addedFresh complete medium was resuspended, the cell suspension was inoculated into a 6-cm dish containing 3mL of complete medium, shaken well and placed at 37 ℃ with 5% CO2Culturing in an incubator;
6) replacing the culture solution once the next day and then continuing culturing;
(2) cell passage
1) Passaging cells grown to 90% confluence;
2) discarding the old culture solution, adding 2mL of sterilized D-Hank's solution, washing the cells, and then discarding the solution;
3) adding 0.5mL of pancreatin digestive juice, and digesting at 37 ℃ for about 1-2min until the cells are completely digested;
4) adding 1mL of complete culture medium, blowing and beating for a plurality of times, and washing off cells on the wall;
5) uniformly mixing the cells, dividing the cells into two new 6-cm dish, supplementing a complete culture medium to 4mL, and continuing to culture;
(3) lentiviral infection of target cells
1) Carrying out pancreatin digestion on target cells in a logarithmic growth phase to prepare a cell suspension;
2) the cell suspension was seeded in 96-well at 37 ℃ with 5% CO2Culturing in an incubator until the cell fusion degree reaches about 20-30%;
3) adding a proper amount of virus according to the MOI value of the cells;
4) observing the cell state after 12 hours, and replacing the culture medium;
5) observing the expression condition of the reporter gene GFP on the lentivirus 2-3 days after infection, continuously culturing the cells until the cell fusion degree reaches 70-90% when the fluorescence rate reaches 70-90%, and collecting the cells to continue subsequent experiments.
Further, LncRNA-DKFZP434K028 shRNA lentiviral vector was named GV 493. The target sequence is: CAAGTCACAGAGGGAGAGAAA, lentivirus infects cells.
Further, the third step specifically includes:
1) after the pancreatin of each experimental group cell in the logarithmic growth phase is digested, the complete culture medium is re-suspended into cell suspension, and counting is carried out;
2) determining the density of plated cells according to the growth speed of the cells; each group has 3 multiple wells, the culture system is 100 μ L/well, the number of cells added to each well is consistent in the plating process, and the cells are plated at 37 ℃ and 5% CO2The incubator is used for 24h, 48h and 72 h.
3) Add 10. mu.L of CCK8 solution to each well and incubate the plates in the incubator for 1 h.
4) Absorbance at 450nm was measured with a microplate reader.
Further, the fourth step specifically includes:
1) after the cells of each experimental group in the logarithmic growth phase are digested by trypsin, the complete culture medium is counted in a suspended mode;
2) the plating density is determined according to the cell size, and the cell reaches the confluence of more than 90% on the next day. 37 ℃ and 5% CO2Culturing in an incubator, wherein each group has 3 multiple holes, and the culture system is 2 mL/hole;
3) changing a low-concentration serum culture medium on the next day, aligning a 10-microliter gun head to the central part of the lower end of the 6-pore plate, slightly pushing the lower end of the light-pore plate upwards to form scratches;
4) gently rinsing with serum-free medium for 2-3 times, adding serum medium containing 0.5% FBS, and taking pictures for 0 h;
5)37℃、5％CO2culturing in an incubator, and selecting proper time according to the healing degree to take a picture by using a microscope;
6) taking pictures of the target 6-hole plate by a microscope at 24h and 48 h;
8) and (3) judging a control group according to the migration area aiming at the scratch experiment, and knocking down the difference of cell healing capacity of the group.
Further, the fifth step specifically includes:
1) the cells of each experimental group in the logarithmic growth phase were washed twice with cold PBS, trypsinized, centrifuged, and the cold PBS was counted in a resuspension at 1 × 106Cells were resuspended in 1 × binding buffer at a concentration of individual cells/mL.
2) mu.L of the solution (1 × 10)5Individual cells) were transferred into a 5ml culture tube.
3) Add 5. mu.L PE Annexin V and 5. mu.L 7-AAD in the dark.
4) Cells were vortexed gently and incubated at room temperature (25 ℃) in the dark for 15 minutes.
5) 400 μ L of 1 Xbinding buffer was added to each tube. Flow cytometry analysis was performed within 1 hour.
In summary, the advantages and positive effects of the invention are: the invention detects the expression conditions of LncRNA-DKFZP434K028 in normal mammary epithelial cells MCF-10A and breast cancer cells MDA-MB-231 and MCF-7 through fluorescent quantitative PCR, and the result shows that compared with the normal mammary epithelial cells MCF-10A, the expression of LncRNA-DKFZP434K028 in the breast cancer cells is obviously up-regulated, the expression level in highly invasive cells MDA-MB-231 is the highest, and the expression level in the less invasive cells MCF-7 is the lowest. The results of colony formation experiments show that the knockout of LncRNA-DKFZP434K028 can inhibit the proliferation capacity of MDA-MB-231 cells. The cell scratching experiment result shows that the LncRNA-DKFZP434K028 knockout can inhibit the invasion capacity of breast cancer cells MDA-MB-231. The apoptosis ability result detected by using a flow cytometer shows that the LncRNA-DKFZP434K028 is knocked out to promote the apoptosis of breast cancer cells MDA-MB-231. The invention has important significance for diagnosing and treating the breast cancer.
The LncRNA-DKFZP434K028 is proved to be a gene for inhibiting the proliferation, invasion and transfer of breast cancer cells and promoting apoptosis, thereby providing a certain experimental and theoretical basis for clinically designing effective molecular targeted drugs for resisting the invasion and transfer of the breast cancer.
Drawings
FIG. 1 is a flowchart of the method for detecting genes that inhibit proliferation, invasion and metastasis of breast cancer cells and promote apoptosis according to the embodiment of the present invention.
FIG. 2 is a schematic diagram of the fluorescent quantitative PCR detection of the expression of LncRNA-DKFZP434K028 in normal mammary epithelial cells MCF-10A and breast cancer cells MDA-MB-231, MCF-7 and T47D.
FIG. 3 is a schematic diagram showing the change of cell proliferation ability after infection with LncRNA-DKFZP434K028 lentivirus, which is provided in the examples of the present invention.
Fig. 4 is a schematic diagram of an exemplary image and a comparative schematic diagram of the cell scratch detection experiment provided by the embodiment of the present invention for detecting the invasion capacity of cells before and after infection.
Fig. 5 is a schematic diagram of an exemplary image for detecting apoptosis of cells before and after infection by using a flow cytometer according to an embodiment of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
Aiming at the problems in the prior art, the invention provides a gene for inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis and a detection method thereof, and the invention is described in detail below with reference to the accompanying drawings.
The gene for inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis provided by the embodiment of the invention is NR _026882, and the long-chain non-coding RNA is a recently discovered RNA without protein coding capacity, has a length of more than 200nt, and has an important regulation and control effect in the occurrence and development of tumors. LncRNA-DKFZP434K028 is located on chromosome chr11, and has a length of 936nt and a Gene ID of lnc-TMEM 258-3.
As shown in fig. 1, the method for detecting genes that inhibit proliferation, invasion and metastasis of breast cancer cells and promote apoptosis provided by the embodiment of the present invention includes the following steps:
s101: expression of LncRNA-DKFZP434K028 in cells: the expression of LncRNA-DKFZP434K028 in normal mammary epithelial cells MCF-10A and breast cancer cells MDA-MB-231, MCF-7 and T47D is detected by fluorescent quantitative PCR.
S102: lentivirus infected cells: the LncRNA-DKFZP434K028 in the cells is successfully knocked out by infecting the breast cancer cells MDA-MB-231 with shRNA lentivirus, and a stable transfer cell strain is screened out, wherein the MDA-MB-231 cells infected with RNAi lentivirus are named shLncRNA-DKFZP434K028, and the MDA-MB-231 cells infected with control lentivirus are named shCtrl.
S103: the CCK8 kit detects cell proliferation: cell proliferation is detected by a CCK8 kit, and the result shows that the LncRNA-DKFZP434K028 is knocked out to inhibit the proliferation capacity of breast cancer cells MDA-MB-231.
S104: the invasion capacity of infected cells is detected through a scratch experiment, and the result shows that the invasion capacity of the breast cancer cells MDA-MB-231 can be inhibited by knocking out LncRNA-DKFZP434K 028.
S105: detecting apoptosis of cells by flow cytometry: the apoptosis of the cells is detected by a flow cytometer, and the result shows that the LncRNA-DKFZP434K028 is knocked out to promote the apoptosis of breast cancer cells MDA-MB-231.
The technical solution of the present invention is further described below with reference to the accompanying drawings.
Expression of LncRNA-DKFZP434K028 in cells: the expression conditions of LncRNA-DKFZP434K028 in normal mammary epithelial cells MCF-10A and breast cancer cells MDA-MB-231 and MCF-7 are detected by fluorescent quantitative PCR, and the result shows that the expression of LncRNA-DKFZP434K028 in the breast cancer cells is obviously up-regulated compared with the expression of LncRNA-DKFZP434K028 in normal mammary epithelial cells MCF-10A, the expression level is the highest in highly invasive cells MDA-MB-231, and the expression level is the lowest in the less invasive cells MCF-7 (figure 2).
Fluorescent quantitative PCR (Real-time PCR) experimental steps:
1. extraction of total RNA from cells (TRIzol method).
(1) After the culture medium of normal mammary epithelial cells MCF-10A or breast cancer cells MDA-MB-231, T47D and MCF-7 in 6-well plates was aspirated, 1mL of TRIzol was added to each well to cover the cells, and the cells were completely lysed by pipetting 3 times with a pipette or a sample applicator and then transferred to a centrifuge tube.
(2) 0.2mL of chloroform (0.2 mL of chloroform in 1mL of TRIzol) was added to the centrifuge tube containing the lysate, and the mixture was thoroughly shaken on a shaker for 20 seconds and allowed to stand at room temperature for 5 minutes. 12000g 4 degrees C centrifugal 10 minutes, then suction containing total RNA upper aqueous phase to a new centrifugal tube, each mL TRIzol can suck about 0.6mL upper aqueous phase. The organic phase and the intermediate layer contain DNA and proteins and should be avoided.
(3) Adding isopropanol with the same volume as the upper water phase, reversing for several times, mixing, and precipitating at room temperature for 5 minutes. 12000g 4 ℃ centrifugal 10 minutes, in the bottom of the visible RNA precipitation. The supernatant was discarded, 1mL of 75% ethanol was added per mL of TRIzol, and the mixture was gently inverted to wash the RNA pellet. 12000g 4 ℃ centrifugal 2 minutes, discard the liquid, careful not discard RNA precipitation. Air-drying at room temperature for 5-10 min.
(4) Dissolving: an appropriate amount of DEPC-treated water was added to dissolve the RNA precipitate. Storing at-80 ℃.
2. First strand cDNA was synthesized using M-MLV reverse transcriptase. The synthesis reagents and conditions were as follows:
standing at 70 deg.C for 5min on ice for 5min
37℃60min 95℃5min
3. The expression level of LncRNA-DKFZP434K028 in cells was detected by SYBR Green fluorescent quantitative PCR kit from Bio-Rad. By 2–△△CTThe method calculates the relative expression level of LncRNA-DKFZP434K 028. The primer sequence of LncRNA-DKFZP434K028 is as follows: forward primer: 5'-CCACATACTCCAGCACCCAA-3', reverse primer: 5'-TCTTCACGGACCTAGCACCTT-3' are provided. GAPDH was used as internal reference. As shown in fig. 2.
Secondly, infecting cells with lentiviruses: the LncRNA-DKFZP434K028 in the cells is successfully knocked out by infecting the breast cancer cells MDA-MB-231 with shRNA lentivirus, and a stable cell strain is screened out, wherein the MDA-MB-231 cells infected with RNAi lentivirus are called shDKFZP434K028, and the MDA-MB-231 cells infected with control lentivirus are called shCtrl.
1. Primary reagent
2. Main instrument
3. Experimental procedure
3.1 preparation of target cells
3.1.1 cell Resuscitation
(1) Taking out the cell freezing tube from the liquid nitrogen tank;
(2) quickly placing into 37 deg.C water bath, and thawing quickly by shaking;
(3) after complete thawing, 1300rpm, centrifuging for 3 min;
(4) wiping the freezing tube with 75% alcohol for disinfection, and transferring to a biological safety cabinet;
(5) removing supernatant from the frozen stock solution, adding 1mL of fresh complete medium to resuspend the cells, inoculating the cell suspension into a 6-cm dish containing 3mL of complete medium, shaking the cell suspension gently, placing the cell suspension at 37 ℃ and 5% CO2Culturing in an incubator;
(6) the culture solution is replaced once the next day and then the culture is continued.
3.1.2 cell passages
(1) Passaging cells grown to 90% confluence;
(2) discarding the old culture solution, adding 2mL of sterilized D-Hank's solution, washing the cells, and then discarding the solution;
(3) adding 0.5mL of pancreatin digestive juice, digesting for about 1-2min at 37 ℃ until the cells are completely digested;
(4) adding 1mL of complete culture medium, blowing and beating for a plurality of times, and washing off cells on the wall;
(5) after mixing the cells evenly, dividing the cells into two new 6-cm dish, supplementing the complete culture medium to 4mL, and continuing to culture.
3.2 Lentiviral infection of cells of interest
(1) Carrying out pancreatin digestion on target cells in a logarithmic growth phase to prepare a cell suspension;
(2) inoculating the cell suspension (cell number is about 1500-2500) into 96-well, at 37 deg.C and 5% CO2Culturing in an incubator until the cell fusion degree reaches about 20-30%;
(3) adding a proper amount of virus according to the MOI value of the cells;
(4) observing the cell state after 12 hours, and replacing the culture medium;
(5) observing the expression condition of the reporter gene GFP on the lentivirus 2-3 days after infection, continuously culturing the cells until the cell fusion degree reaches 70-90% when the fluorescence rate reaches 70-90%, and collecting the cells to continue subsequent experiments.
The LncRNA-DKFZP434K028 shRNA lentivirus is customized by Shanghai Jikai gene company, and the name of the vector is GV 493. The target sequence is: CAAGTCACAGAGGGAGAGAAA are provided. Lentiviruses infect cells.
Thirdly, detecting cell proliferation by a CCK8 kit: CCK8 kit for detecting cell proliferation capacity before and after infection
1. Primary reagent
2. Main equipment
3. Experimental procedure
(1) After the pancreatin of each experimental group cell in the logarithmic growth phase is digested, the complete culture medium is re-suspended into cell suspension, and counting is carried out;
(2) determining the density of plated cells according to the growth speed of the cells; each group had 3 wells, the culture system was 100. mu.l/well, the number of cells added per well was consistent during plating, 5% CO at 37 ℃%2The incubator is used for 24h, 48h and 72 h.
(3) Add 10. mu.L of CCK8 solution to each well and incubate the plates in the incubator for 1 h.
(4) Absorbance at 450nm was measured with a microplate reader.
Fourth, cell scratch experiment detection invasion
1. Primary reagent
2. Main equipment
3. Experimental procedure
(1) After the pancreatin of each experimental group cell in the logarithmic growth phase is digested, the complete culture medium is re-suspended into a solution for counting;
(2) the plating density is determined according to the cell size, and the cell reaches the confluence of more than 90% on the next day. 37 ℃ and 5% CO2Culturing in an incubator, wherein each group has 3 multiple holes, and the culture system is 100 mu L/hole;
(3) changing a low-concentration serum culture medium on the next day, aligning a 10-microliter gun head to the central part of the lower end of the 6-pore plate, slightly pushing the lower end of the light-pore plate upwards to form scratches;
(4) gently rinsing with serum-free medium for 2-3 times, adding serum medium containing 0.5% FBS, and taking pictures for 0 h;
(5)37℃、5％CO2culturing in an incubator, and taking pictures of the target 6-hole plate by a microscope in 24h and 48h respectively;
(7) and (3) judging a control group according to the migration area aiming at the scratch experiment, and knocking down the difference of cell healing capacity of the group. As shown in fig. 4.
Flow cytometry for detecting apoptosis capacity
1. Primary reagent
2. Main equipment
3. Experimental procedure
(1) The cells of each experimental group in the logarithmic growth phase were washed twice with cold PBS, centrifuged after trypsinization, and the cold PBS was resuspended in a solution count and then counted in1×106Resuspend cells in 1 Xbinding buffer at individual cells/mL concentration.
(2) mu.L of the solution (1 × 10)5Individual cells) were transferred into a 5ml culture tube.
(3) Add 5. mu.L PE Annexin V and 5. mu.L 7-AAD in the dark.
(4) Cells were vortexed gently and incubated at room temperature (25 ℃) in the dark for 15 minutes.
(5) 400 μ L of 1 Xbinding buffer was added to each tube. Flow cytometry was analyzed within 1 hour.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Sequence listing
<110> Weifang medical college
<120> genes inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>43
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
<210>2
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
<210>5
<211>748
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
Claims (4)
1. A Gene for inhibiting the proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis is LncRNA-DKFZP434K028, seqname is NR _026882 and Gene ID is lnc-TMEM 258-3.
2. An expression vector for a breast cancer cell comprising the gene of claim 1.
3. A breast cancer detection kit constructed by using the gene of claim 1.
4. Use of the gene of claim 1 for inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010166621.2A CN111378661B (en) | 2020-03-11 | 2020-03-11 | Gene for inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010166621.2A CN111378661B (en) | 2020-03-11 | 2020-03-11 | Gene for inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111378661A true CN111378661A (en) | 2020-07-07 |
| CN111378661B CN111378661B (en) | 2022-04-15 |
Family
ID=71215359
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010166621.2A Active CN111378661B (en) | 2020-03-11 | 2020-03-11 | Gene for inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111378661B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114480633A (en) * | 2021-04-06 | 2022-05-13 | 嘉兴学院 | Application of DCAF13 gene in serving as target for inhibiting breast cancer cell proliferation |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160287622A1 (en) * | 2013-11-18 | 2016-10-06 | Massachusetts Institute Of Technology | Compositions and methods for treating immune and viral disorders and modulating protein-rna interaction |
| CN108277279A (en) * | 2018-01-30 | 2018-07-13 | 潍坊医学院 | A kind of application of lncRNA in diagnosing and/or treating breast cancer |
-
2020
- 2020-03-11 CN CN202010166621.2A patent/CN111378661B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160287622A1 (en) * | 2013-11-18 | 2016-10-06 | Massachusetts Institute Of Technology | Compositions and methods for treating immune and viral disorders and modulating protein-rna interaction |
| CN108277279A (en) * | 2018-01-30 | 2018-07-13 | 潍坊医学院 | A kind of application of lncRNA in diagnosing and/or treating breast cancer |
Non-Patent Citations (7)
| Title |
|---|
| GULDEN OLGUN等: "Discovering lncRNA mediated sponge interactions in breast cancer molecular subtypes", 《BIORXIV》 * |
| HUANG, QY等: "Long Non-Coding RNA: Dual Effects on Breast Cancer Metastasis and Clinical Applications", 《CANCERS》 * |
| LI J等: "Tanric：An interactive open platform to explore the function of lncRNAs in cancer", 《CANCER RESEARCH》 * |
| ZHAO, J等: "Long non-coding RNA Linc00152 is involved in cell cycle arrest, apoptosis, epithelial to mesenchymal transition, cell migration and invasion in gastric cancer", 《CELL CYCLE》 * |
| 无: "Homo sapiens MYRF antisense RNA 1 (MYRF-AS1), long non-coding RNA", 《NCBI GENBANK》 * |
| 王鹏: "人类长非编码RNA竞争三元组在癌症中调控机制的研究", 《中国博士学位论文全文数据库 医药卫生科技辑》 * |
| 黄艳霞等: "长链非编码RNA与胃癌相关性的研究进展", 《国际消化病杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114480633A (en) * | 2021-04-06 | 2022-05-13 | 嘉兴学院 | Application of DCAF13 gene in serving as target for inhibiting breast cancer cell proliferation |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111378661B (en) | 2022-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105524924A (en) | Cyclic RNA circ-ZKSCAN1 use | |
| CN108004322B (en) | Application of lncRNA in diagnosis and/or treatment of lung adenocarcinoma | |
| CN108277279B (en) | Application of lncRNA in diagnosis and/or treatment of breast cancer | |
| CN111378661B (en) | Gene for inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis | |
| CN111743912B (en) | Gene inhibitor for promoting colon cancer cell apoptosis and inhibiting colon cancer cell migration | |
| CN111378662B (en) | Gene for inhibiting proliferation, invasion and transfer of breast cancer cells, expression vector and application | |
| CN108660212B (en) | Application of WDR1 gene in preparation of non-small cell lung cancer treatment and detection products | |
| CN113278696B (en) | Molecular marker RAD51B-AS1 and application thereof | |
| CN114032236B (en) | shRNA of TMEM2 and application thereof | |
| CN111334508B (en) | Gene and expression vector for inhibiting proliferation, invasion and transfer of breast cancer cells | |
| CN111286539B (en) | Gastric cancer-related long non-coding RNA LINC02481 and application thereof | |
| CN110643707B (en) | ESCC (persistent resonant cell) -related lncRNA LLNLR-299G3.1 and application thereof | |
| CN110577952A (en) | Application of long non-coding RNA in diagnosis and treatment of breast cancer | |
| Wei et al. | MicroRNA-30a-3p inhibits malignant progression of hepatocellular carcinoma through regulating IGF1. | |
| CN111321147B (en) | Application of gene inhibitor in preparation of anti-gastric cancer metastasis preparation | |
| CN114480390B (en) | siRNA, siRNA plasmid and lentivirus for targeted inhibition of ZNF22 gene expression as well as construction method and application thereof | |
| CN112280859B (en) | Breast cancer marker and application thereof | |
| CN103667295B (en) | siRNA for FOXC1 gene expression inhibition, and application thereof | |
| CN116637123B (en) | Application of reagent for knocking down or down expression of C15orf39 gene in preparation of medicines for treating gastric cancer | |
| CN114832105B (en) | Application of inhibitor of C7orf50 gene or protein | |
| CN110628909B (en) | miRNA molecule miR-4500 related to endometrial cancer and application thereof | |
| CN113186289B (en) | Application of lncRNA in renal cancer urine screening and renal cancer treatment | |
| CN108060133B (en) | HPMC cell strain for stably and lowly expressing miR-497 and application thereof | |
| AU2021100731A4 (en) | A Use of PIWI interacting RNA piR-hsa-211106 | |
| CN110042160B (en) | Digestive system malignant tumor marker and method for preparing medicine for inhibiting digestive system malignant tumor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |