CN111378662B - Gene for inhibiting proliferation, invasion and transfer of breast cancer cells, expression vector and application - Google Patents
Gene for inhibiting proliferation, invasion and transfer of breast cancer cells, expression vector and application Download PDFInfo
- Publication number
- CN111378662B CN111378662B CN202010167282.XA CN202010167282A CN111378662B CN 111378662 B CN111378662 B CN 111378662B CN 202010167282 A CN202010167282 A CN 202010167282A CN 111378662 B CN111378662 B CN 111378662B
- Authority
- CN
- China
- Prior art keywords
- cells
- breast cancer
- linc00850
- invasion
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Oncology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Hospice & Palliative Care (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of genetic engineering, and discloses a gene for inhibiting proliferation, invasion and transfer of breast cancer cells, an expression vector and application thereof, wherein the gene is LINC00850, and is long-chain non-coding RNA which is RNA without protein coding capacity and has a length of more than 200 nt; LINC00850 is located on the X chromosome and is 697bps long and has a sequence name NR _ 109813. The invention detects the expression conditions of LINC00850 in normal mammary epithelial cells MCF-10A and breast cancer cells; compared with normal mammary epithelial cells MCF-10A, the expression of LINC00850 in breast cancer cells is obviously up-regulated, the expression level is the highest in highly invasive cells MDA-MB-231, and the expression level is the lowest in less invasive cells MCF-7. The invention has important significance for diagnosing and treating the breast cancer.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a gene for inhibiting proliferation, invasion and transfer of breast cancer cells, an expression vector and application.
Background
Currently, the closest prior art: the female breast is composed of skin, fibrous tissue, breast glands and fat, and breast cancer is a malignant tumor that occurs in the mammary gland epithelial tissue. Breast cancer occurs in 99% of women and only 1% in men. Mammary gland is not an important organ for maintaining human body life activity, and the in-situ breast cancer is not fatal; however, the breast cancer cells lose the characteristics of normal cells, and the cells are loosely connected and easily fall off. Once cancer cells are shed, free cancer cells can be disseminated to the whole body along with blood or lymph fluid to form metastasis, which endangers life. At present, breast cancer becomes a common tumor threatening the physical and mental health of women. The incidence of breast cancer worldwide has been on the rise since the end of the 70 s of the 20 th century. In the United states, 1 woman will have breast cancer in their lifetime. China is not a high-incidence country of breast cancer, but is not optimistic, and the growth rate of the incidence of breast cancer in China is 1-2% higher than that of the high-incidence country in recent years. According to 2009 breast cancer onset data published by the national cancer center and health department disease prevention and control agency 2012, it is shown that: the incidence of breast cancer of women in the national tumor registration area is 1 st of malignant tumors of women, the incidence (thickness) of breast cancer of women is 42.55/10 ten thousand in total nationwide, 51.91/10 ten thousand in cities and 23.12/10 ten thousand in rural areas. Breast cancer has become a major public health problem in the current society. The global breast cancer mortality rate has shown a decreasing trend since the 90 s of the 20 th century; firstly, the breast cancer screening work is carried out, so that the proportion of early cases is increased; secondly, the development of comprehensive treatment of breast cancer improves the curative effect. Breast cancer has become one of the most effective solid tumors.
In summary, the problems of the prior art are as follows:
(1) in the prior art, theoretical basis cannot be provided for expression in breast cancer cells, expression in highly invasive cells MDA-MB-231 and expression in less invasive cells MCF-7.
(2) The prior art can not accurately inhibit the proliferation, invasion and metastasis of breast cancer. Clinically, the breast cancer treatment cannot achieve the effects of inhibiting proliferation, invasion and metastasis, and cannot improve the survival rate of patients. Our technology provides a theoretical basis for the treatment of clinical target genes.
(3) The lncRNA can regulate and control coding protein, research the influence of the lncRNA on breast cancer proliferation and invasion and metastasis, is favorable for disclosing molecular mechanisms of breast cancer invasion and metastasis, is favorable for screening biomarkers for breast cancer diagnosis and prognosis judgment, and can design effective molecular targeted drugs for resisting breast cancer proliferation invasion and metastasis.
The difficulty of solving the technical problems is as follows: an accurate target medicine which can effectively inhibit the invasion and metastasis of breast cancer cells is searched.
The significance of solving the technical problems is as follows:
(1) provides a potential targeted drug for screening and inhibiting breast cancer invasion and metastasis, and the drug can play a role in inhibiting breast cancer invasion and metastasis by inhibiting lncRNA regulated protein.
(2) Provides a medicine for treating breast cancer, and realizes the precise molecular therapy of the breast cancer.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a gene for inhibiting proliferation, invasion and transfer of breast cancer cells, an expression vector and application.
The invention is realized in such a way that the gene for inhibiting the proliferation, invasion and metastasis of the breast cancer cells is LINC00850, and the sequence name is NR _ 109813.
Another object of the present invention is to provide an expression vector for breast cancer cells comprising the above gene.
The invention also aims to provide a breast cancer detection kit containing the gene construction.
The invention also aims to provide an application of the gene in inhibiting proliferation, invasion and metastasis of breast cancer cells.
In summary, the advantages and positive effects of the invention are: the invention detects the expression conditions of LINC00850 in normal mammary epithelial cells MCF-10A and breast cancer cells MDA-MB-231, T47D and MCF-7 through fluorescent quantitative PCR, and the result shows that compared with the normal mammary epithelial cells MCF-10A, the expression of LINC00850 in the breast cancer cells is obviously up-regulated, the expression level in highly invasive cells MDA-MB-231 is the highest, and the expression level in low invasive cells MCF-7 is the lowest. After the LINC00850 in MDA-MB-231 cells is knocked out, the proliferation capacity of the cells is obviously weakened. The LINC00850 knockout can obviously inhibit the invasion capacity of MDA-MB-231 cells. The invention has important significance for diagnosing and treating the breast cancer.
The gene for inhibiting the invasion and metastasis of breast cancer cells provides a certain experimental and theoretical basis for clinically designing effective molecular targeted drugs for resisting the invasion and metastasis of breast cancer.
Drawings
FIG. 1 is a flowchart of a method for detecting a gene that inhibits proliferation invasion and metastasis of breast cancer cells according to an embodiment of the present invention.
FIG. 2 is a schematic diagram of the fluorescent quantitative PCR detection of the expression of LINC00850 in normal mammary epithelial cells MCF-10A and breast cancer cells MDA-MB-231, T47D and MCF-7 according to the embodiment of the present invention.
FIG. 3 is a schematic diagram of an exemplary image of HCS cell proliferation assay for detecting changes in cell proliferation potency, provided by an embodiment of the invention.
FIG. 4 is a schematic representation of the change in cell proliferation capacity following lentivirus infection as provided by an embodiment of the present invention.
Fig. 5 is a schematic diagram of a typical image of the HCS cell scratch test for detecting the invasive ability of cells before and after infection according to an embodiment of the present invention.
Fig. 6 is a comparison diagram of the average invasion rate of cells before and after infection detected by the HCS cell scratch detection experiment provided in the embodiment of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
The invention provides a gene for inhibiting proliferation, invasion and metastasis of breast cancer cells, and the gene for inhibiting proliferation, invasion and metastasis of the breast cancer cells is LINC 00850.
Further, the LINC00850 is a long-chain non-coding RNA which is an RNA without the capacity of coding protein and has the length of more than 200 nt; LINC00850 is located on the X chromosome and is 697bps long and has a sequence name NR _ 109813.
Another object of the present invention is to provide a method for detecting a gene that inhibits proliferation invasion and metastasis of breast cancer cells, the method comprising the steps of:
first, expression of LINC00850 in cells: detecting the expression conditions of LINC00850 in normal mammary epithelial cells MCF-10A and breast cancer cells MDA-MB-231, T47D and MCF-7 by fluorescent quantitative PCR (polymerase chain reaction);
second, lentivirus infects cells: infecting breast cancer cells MDA-MB-231 by shRNA lentivirus, successfully knocking down LINC00850 in the cells, and screening a stable cell strain, wherein the MDA-MB-231 infected with the shRNA lentivirus is named shLINC00850, and the MDA-MB-231 infected with a control lentivirus is named shCtrl;
step three, cell proliferation is detected by Celigo cell counting: HCS cell proliferation experiment detects proliferation capacity of cells before and after infection, and the reduction of LINC00850 can inhibit the proliferation capacity of MDA-MB-231 cells;
fourthly, HCS cell scratch detection experiment detects the invasion capacity of cells before and after infection, and the invasion capacity of MDA-MB-231 cells can be inhibited by knocking down LINC00850
Further, the first fluorescent quantitative PCR comprises:
step one, extracting total RNA in cells;
step two, synthesizing first strand cDNA by using M-MLV reverse transcriptase;
step three, detecting the expression quantity of LINC00850 in the cells by using SYBR Green fluorescent quantitative PCR kit of Bio-Rad, and using 2–△△CTThe relative expression level of LINC00850 is calculated by the method.
Further, the step one of extracting total RNA from the cells specifically comprises the following steps:
(1) sucking up culture solution of normal mammary epithelial cells MCF-10A or breast cancer cells MDA-MB-231, T47D and MCF-7 in a 6-well plate, adding 1mL of TRIzol into each well to cover the cells, blowing and beating for 3 times by using a pipette or a sample injector, completely cracking the cells, and transferring the cells into a centrifuge tube;
(2) adding 0.2mL of chloroform into a centrifuge tube filled with the lysate, fully and uniformly shaking on a shaker for 20 seconds, and standing for 5 minutes at room temperature; centrifuging at 12000g for 10 min at 4 ℃; sucking the upper aqueous phase containing the total RNA into a new centrifuge tube, wherein about 0.6mL of the upper aqueous phase can be sucked per mL of TRIzol; the organic phase and the intermediate layer contain DNA and protein;
(3) adding isopropanol with the same volume as the upper water phase, reversing for several times, mixing, and precipitating at room temperature for 5 minutes. Centrifuging at 12000g for 10 min at 4 ℃, and detecting RNA precipitation at the bottom of the tube; discarding the supernatant, adding 1mL of 75% ethanol into each mL of TRIzol, and reversing and uniformly mixing to clean RNA precipitate; centrifuging at 12000g and 4 ℃ for 2 minutes, discarding liquid, discarding RNA precipitate, and air-drying at room temperature for 5-10 minutes;
(4) adding DEPC treated water to dissolve RNA precipitate, and storing at-80 deg.C;
further, the sequence of the step three LINC00850 primer is as follows:
forward primer：5’-ATCCGTGAAGCCATAACCA-3’；
reverse primer：5’-TTTCAGCATTCACTGCAGC-3’。
further, the second step specifically includes:
(1) preparing the cells of interest
Cell resuscitation
1) Taking out the cell freezing tube from the liquid nitrogen tank;
2) quickly placing into 37 deg.C water bath, and thawing quickly by shaking;
3) after complete thawing, 1300rpm, centrifuging for 3 min;
4) wiping the freezing tube with 75% alcohol for disinfection, and transferring to a biological safety cabinet;
5) removing supernatant from the frozen stock solution, adding 1mL of fresh complete medium to resuspend the cells, inoculating the cell suspension into a 6-cm dish containing 3mL of complete medium, shaking the cell suspension gently, placing the cell suspension at 37 ℃ and 5% CO2Culturing in an incubator;
6) replacing the culture solution once the next day and then continuing culturing;
(2) cell passage
1) Passaging cells grown to 90% confluence;
2) discarding the old culture solution, adding 2mL of sterilized D-Hank's solution, washing the cells, and then discarding the solution;
3) adding 0.5mL of pancreatin digestive juice, and digesting at 37 ℃ for about 1-2min until the cells are completely digested;
4) adding 1mL of complete culture medium, blowing and beating for a plurality of times, and washing off cells on the wall;
5) uniformly mixing the cells, dividing the cells into two new 6-cm dish, supplementing a complete culture medium to 4mL, and continuing to culture;
(3) lentiviral infection of target cells
1) Carrying out pancreatin digestion on target cells in a logarithmic growth phase to prepare a cell suspension;
2) the cell suspension was seeded in 96-well at 37 ℃ with 5% CO2Culturing in an incubator until the cell fusion degree reaches 20-30%;
3) adding a proper amount of virus according to the MOI value of the cells;
4) observing the cell state after 12 hours, and replacing the culture medium;
5) observing the expression condition of the reporter gene GFP on the lentivirus 2-3 days after infection, continuously culturing the cells until the cell fusion degree reaches 70-90% when the fluorescence rate reaches 70-90%, and collecting the cells to continue subsequent experiments.
Further, the name of the LINC00850 shRNA lentiviral vector is GV 115; three targets, SEQ ID NO: 2, a sequence; SEQ ID NO: 3; SEQ ID NO: 4, sequence I; the three viruses were mixed to infect cells.
Further, the third step specifically includes:
1) after the pancreatin of each experimental group cell in the logarithmic growth phase is digested, the complete culture medium is re-suspended into cell suspension, and counting is carried out;
2) the density of plated cells was determined according to the growth rate of the cells (; each group has 3 multiple wells, the culture system is 100 μ L/well, and the number of cells added into each well is 37 deg.C and 5% CO in the plating process2Culturing in an incubator;
3) starting from the next day after the plate laying, once per day, Celigo detection and plate reading are carried out, and the plate reading is continuously carried out for 5 days;
4) accurately calculating the number of cells with green fluorescence in each scanning pore plate by adjusting input parameters of analysis settings; the data were statistically plotted and cell proliferation curves were plotted for 5 days.
Further, the fourth step of HCS cell scratch detection experiment step:
1) after the pancreatin of each experimental group cell in the logarithmic growth phase is digested, the complete culture medium is re-suspended into a solution for counting;
2) the plating density is determined according to the cell size, and the cell reaches the confluence of more than 90% on the next day. 37 ℃ and 5% CO2Culturing in an incubator, wherein each group has 3 multiple holes, and the culture system is 100 mu L/hole;
3) changing the low-concentration serum culture medium the next day, aligning the central part of the lower end of the 96-well plate by using a scratch instrument, and upwards moving the central part of the lower end of the light-well plate to form a scratch;
4) gently rinsing with serum-free medium for 2-3 times, adding serum medium containing 0.5% FBS, and taking pictures for 0 h;
5)37℃、5％CO2culturing in an incubator, and selecting proper time to sweep the plate by using Celigo according to the healing degree;
6) migration area was analyzed with Celigo;
7) celigo scans and reads the target 96-well plate at 0h, 24h and 32h to obtain a scanning picture;
8) and (3) judging a control group according to the migration area aiming at the scratch experiment, and knocking down the difference of cell healing capacity of the group.
In view of the problems of the prior art, the present invention provides a gene for inhibiting proliferation, invasion and metastasis of breast cancer cells and a detection method thereof, and the present invention is described in detail below with reference to the accompanying drawings.
The gene for inhibiting proliferation, invasion and metastasis of breast cancer cells provided by the embodiment of the invention is LINC00850, and LINC00850 is long-chain non-coding RNA which is RNA without protein coding capacity, has the length of more than 200nt, and has an important regulation and control effect in the occurrence and development of tumors. LINC00850 is located on the X chromosome at 697bps length, sequence name NR _109813, sequence SEQ ID NO: 5.
as shown in fig. 1, the method for detecting a gene that inhibits proliferation, invasion and metastasis of breast cancer cells according to the embodiment of the present invention includes the following steps:
s101: expression of LINC00850 in cells: detecting the expression conditions of LINC00850 in normal mammary epithelial cells MCF-10A and breast cancer cells MDA-MB-231, T47D and MCF-7 by fluorescent quantitative PCR (polymerase chain reaction);
s102: lentivirus infected cells: infecting breast cancer cells MDA-MB-231 by shRNA lentivirus, successfully knocking down LINC00850 in the cells, and screening a stable cell strain, wherein the MDA-MB-231 infected with the shRNA lentivirus is named shLINC00850, and the MDA-MB-231 infected with a control lentivirus is named shCtrl;
s103: cell proliferation was measured by Celigo cell count: HCS cell proliferation experiment detects proliferation capacity of cells before and after infection, and reduction of the proliferation capacity of the cells MDA-MB-231 by the LINC00850 knocking down;
s104: HCS cell scratch detection experiments detect the invasion capacity of cells before and after infection, and the reduction of LINC00850 can inhibit the invasion capacity of MDA-MB-231 cells.
The technical solution of the present invention is further described below with reference to the accompanying drawings.
The detection method of the gene for inhibiting proliferation invasion and metastasis of the breast cancer cells, provided by the embodiment of the invention, comprises the following steps:
first, expression of LINC00850 in a cell: the expression conditions of LINC00850 in normal mammary epithelial cells MCF-10A and breast cancer cells MDA-MB-231, T47D and MCF-7 are detected by fluorescent quantitative PCR (polymerase chain reaction), and the result shows that the expression of LINC00850 in the breast cancer cells is obviously up-regulated compared with the expression of LINC00850 in normal mammary epithelial cells MCF-10A, the expression level of LINC00850 in highly invasive cells MDA-MB-231 is the highest, and the expression level of LINC00850 in less invasive cells MCF-7 is the lowest.
Fluorescent quantitative PCR (Real-time PCR) experimental steps:
1. extraction of total RNA from cells (TRIzol method).
1.1 sucking up the culture solution of normal mammary epithelial cells MCF-10A or breast cancer cells MDA-MB-231, T47D and MCF-7 in a 6-well plate, adding 1mL of TRIzol in each well to cover the cells, blowing and beating for 3 times by using a pipette or a sample injector, completely cracking the cells, and transferring the cells to a centrifuge tube.
1.2 Add 0.2mL of chloroform to the tube containing the lysate (0.2 mL of chloroform to 1mL of TRIzol), mix well on a shaker for 20 seconds, and leave at room temperature for 5 minutes. 12000g 4 degrees C centrifugal 10 minutes, then suction containing total RNA upper aqueous phase to a new centrifugal tube, each mL TRIzol can suck about 0.6mL upper aqueous phase. The organic phase and the intermediate layer contain DNA and proteins and should be avoided.
1.3 Add Isopropanol with equal volume of upper aqueous phase, reverse several times, mix well, precipitate for 5 minutes at room temperature. 12000g 4 ℃ centrifugal 10 minutes, in the bottom of the visible RNA precipitation. The supernatant was discarded, 1mL of 75% ethanol was added per mL of TRIzol, and the mixture was gently inverted to wash the RNA pellet. 12000g 4 ℃ centrifugal 2 minutes, discard the liquid, careful not discard RNA precipitation. Air-drying at room temperature for 5-10 min.
1.4 dissolution: an appropriate amount of DEPC-treated water was added to dissolve the RNA precipitate. Storing at-80 ℃.
2. First strand cDNA was synthesized using M-MLV reverse transcriptase. The synthesis reagents and conditions were as follows:
3. the expression level of LINC00850 in the cells was detected by SYBR Green fluorescent quantitative PCR kit from Bio-Rad. By 2–△△CTThe relative expression level of LINC00850 is calculated by the method. LINC00850 gThe sequence of the substance is as follows: forward primer SEQ ID NO: 1: 5'-ATCCGTGAAGCCATAACCA-3', reverse primer SEQ ID NO: 2: 5'-TTTCAGCATTCACTGCAGC-3' are provided. GAPDH was used as internal reference. As shown in fig. 2.
Secondly, infecting cells with lentiviruses: the breast cancer cell MDA-MB-231 is infected by shRNA lentivirus, LINC00850 in the cell is successfully knocked out, a stable cell strain is screened out, the MDA-MB-231 infected with RNAi lentivirus is named shLINC00850, and the MDA-MB-231 infected with control lentivirus is named shCtrl.
1. Primary reagent
2. Main instrument
3. Experimental procedure
1. Preparing the cells of interest
1.1 cell Resuscitation
(1) Taking out the cell freezing tube from the liquid nitrogen tank;
(2) quickly placing into 37 deg.C water bath, and thawing quickly by shaking;
(3) after complete thawing, 1300rpm, centrifuging for 3 min;
(4) wiping the freezing tube with 75% alcohol for disinfection, and transferring to a biological safety cabinet;
(5) removing supernatant from the frozen stock solution, adding 1mL of fresh complete medium to resuspend the cells, inoculating the cell suspension into a 6-cm dish containing 3mL of complete medium, shaking the cell suspension gently, placing the cell suspension at 37 ℃ and 5% CO2Culturing in an incubator;
(6) the culture solution is replaced once the next day and then the culture is continued.
1.2 cell passages
(1) Passaging cells grown to 90% confluence;
(2) discarding the old culture solution, adding 2mL of sterilized D-Hank's solution, washing the cells, and then discarding the solution;
(3) adding 0.5mL of pancreatin digestive juice, digesting for about 1-2min at 37 ℃ until the cells are completely digested;
(4) adding 1mL of complete culture medium, blowing and beating for a plurality of times, and washing off cells on the wall;
(5) after mixing the cells evenly, dividing the cells into two new 6-cm dish, supplementing the complete culture medium to 4mL, and continuing to culture.
2. Lentiviral infection of target cells
(1) Carrying out pancreatin digestion on target cells in a logarithmic growth phase to prepare a cell suspension;
(2) inoculating the cell suspension (cell number is about 1500-2500) into 96-well, at 37 deg.C and 5% CO2Culturing in an incubator until the cell fusion degree reaches about 20-30%;
(3) adding a proper amount of virus according to the MOI value of the cells;
(4) observing the cell state after 12 hours, and replacing the culture medium;
(5) observing the expression condition of the reporter gene GFP on the lentivirus 2-3 days after infection, continuously culturing the cells until the cell fusion degree reaches 70-90% when the fluorescence rate reaches 70-90%, and collecting the cells to continue subsequent experiments.
The LINC00850 shRNA lentivirus is customized by Shanghai Jikai Gene company, and the name of the vector is GV 115. Three targets, SEQ ID NO: 3, the sequence 1 is: AGGCTGCAGTGAATGCTGAAA, SEQ ID NO: 4, the sequence 2 is: CTGCCTGATATGTGAGCCAAT, SEQ ID NO: 5, the sequence 3 is: AAGCAACTGTACAAGTTTGCT are provided. The three viruses were mixed to infect cells.
Thirdly, cell proliferation is detected by Celigo cell counting: HCS cell proliferation experiments detect the proliferation capacity of cells before and after infection, and results show that the knockout of LINC00850 can inhibit the proliferation capacity of MDA-MB-231 cells;
1. primary reagent
2. Main equipment
3. Experimental procedure
1) After the pancreatin of each experimental group cell in the logarithmic growth phase is digested, the complete culture medium is re-suspended into cell suspension, and counting is carried out;
2) the plating cell density was determined according to the growth rate of the cells (most of the cells were plated at 2000 cells/well). Each group has 3 multiple wells, the culture system is 100 μ L/well, and the number of cells added into each well is 37 deg.C and 5% CO in the plating process2Culturing in an incubator;
3) starting from the next day after the plate laying, once per day, Celigo detection and plate reading are carried out, and the plate reading is continuously carried out for 5 days;
4) accurately calculating the number of cells with green fluorescence in each scanning pore plate by adjusting input parameters of analysis settings; the data were statistically plotted and cell proliferation curves were plotted for 5 days.
The results show that after knockout of LINC00850 in MDA-MB-231 cells, the proliferative capacity of the cells is significantly reduced (FIG. 3, FIG. 4).
Fourth, HCS cell scratch detection experiment detects invasion capacity of cells before and after infection
HCS cell scratch detection experiment step:
1) after the pancreatin of each experimental group cell in the logarithmic growth phase is digested, the complete culture medium is re-suspended into a solution for counting;
2) the plating density was determined by cell size (the number of plating cells was set at 50000 cells/well) based on the degree of cell confluence reached more than 90% the next day. 37 ℃ and 5% CO2Culturing in an incubator, wherein each group has 3 more wells, and the culture system is 100 mu L/well.
3) Changing the low-concentration serum culture medium the next day, aligning the lower end central part of the 96-pore plate by using a scratch instrument, and slightly pushing the lower end central part of the light-pore plate upwards to form a scratch.
4) Gently rinse 2-3 times with serum-free medium, add serum medium containing 0.5% FBS, and take pictures at 0 h.
5)37℃、5％CO2Culturing in an incubator, and selecting proper time to sweep the plate with Celigo according to the healing degree.
6) Migration area was analyzed by Celigo.
7) Celigo scans and reads the target 96-well plate at 0h, 24h and 32h to obtain scanning pictures.
8) And (3) judging a control group according to the migration area aiming at the scratch experiment, and knocking down the difference of cell healing capacity of the group.
The results show that the knockout of LINC00850 can obviously inhibit the invasive ability of MDA-MB-231 cells (figure 5, figure 6).
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
<110> Weifang medical college
<120> gene for inhibiting proliferation, invasion and transfer of breast cancer cells, expression vector and application
<160> 5
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atccgtgaagccataacca
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
tttcagcattcactgcagc
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
aggctgcagtgaatgctgaaa
<210>4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ctgcctgatatgtgagccaat
<210>5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
aagcaactgtacaagtttgct
Claims (2)
1. The application of an inhibitor for inhibiting gene expression in preparing a medicament for inhibiting proliferation, invasion and metastasis of breast cancer cells is characterized in that the gene is LINC00850, and the sequence name is NR _ 109813.
2. Use of a reagent for detecting the expression level of a gene as set forth in claim 1 in the preparation of a breast cancer detection kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010167282.XA CN111378662B (en) | 2020-03-11 | 2020-03-11 | Gene for inhibiting proliferation, invasion and transfer of breast cancer cells, expression vector and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010167282.XA CN111378662B (en) | 2020-03-11 | 2020-03-11 | Gene for inhibiting proliferation, invasion and transfer of breast cancer cells, expression vector and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111378662A CN111378662A (en) | 2020-07-07 |
| CN111378662B true CN111378662B (en) | 2022-04-01 |
Family
ID=71213518
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010167282.XA Active CN111378662B (en) | 2020-03-11 | 2020-03-11 | Gene for inhibiting proliferation, invasion and transfer of breast cancer cells, expression vector and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111378662B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107267606A (en) * | 2017-04-20 | 2017-10-20 | 浙江理工大学 | A kind of lncRNA and its application in lung cancer detection label or prognosis recurrence label is merged as breast cancer |
-
2020
- 2020-03-11 CN CN202010167282.XA patent/CN111378662B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107267606A (en) * | 2017-04-20 | 2017-10-20 | 浙江理工大学 | A kind of lncRNA and its application in lung cancer detection label or prognosis recurrence label is merged as breast cancer |
Non-Patent Citations (6)
| Title |
|---|
| Homo sapiens long intergenic non-protein coding RNA 850 (LINC00850), long non-coding RNA;Tran TH等;《NCBI GenBank》;20180312;第1-2页 * |
| Long non-coding RNAs may serve as biomarkers in breast cancer combined with primary lung cancer;Ding, XF等;《ONCOTARGET》;20170829;第8卷(第35期);第58210-58221页 * |
| q28) chromosomal inversion in a Duchenne muscular dystrophy patient with mental retardation reveals a novel long non-coding gene on Xq28.《JOURNAL OF HUMAN GENETICS》.2013,第58卷(第1期),第33-39页. * |
| Thi, HTT等.Molecular characterization of an X(p21.2 * |
| Tran TH等.Homo sapiens long intergenic non-protein coding RNA 850 (LINC00850), long non-coding RNA.《NCBI GenBank》.2018,第1-2页. * |
| 乳腺癌合并肺癌中长非编码RNA的表达及调控机制;张玉涵;《中国优秀硕士学位论文全文数据库 医药卫生科技辑》;20180615;第17-18、25页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111378662A (en) | 2020-07-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106834290B (en) | Circular RNA and application thereof | |
| CN105524924A (en) | Cyclic RNA circ-ZKSCAN1 use | |
| CN108004322B (en) | Application of lncRNA in diagnosis and/or treatment of lung adenocarcinoma | |
| CN108277279B (en) | Application of lncRNA in diagnosis and/or treatment of breast cancer | |
| CN109880902B (en) | Application of long-chain non-coding RNA RP11-499F3.2 in reversing drug-resistant treatment of tumor cetuximab | |
| CN111378661B (en) | Gene for inhibiting proliferation, invasion and metastasis of breast cancer cells and promoting apoptosis | |
| CN108660212B (en) | Application of WDR1 gene in preparation of non-small cell lung cancer treatment and detection products | |
| CN101670117B (en) | Application of miR-146a in preparing medicine for curing gastricism | |
| CN111378662B (en) | Gene for inhibiting proliferation, invasion and transfer of breast cancer cells, expression vector and application | |
| CN107475386A (en) | Long-chain non-coding RNA mark for diagnosis and treatment osteosarcoma | |
| CN111334508B (en) | Gene and expression vector for inhibiting proliferation, invasion and transfer of breast cancer cells | |
| CN113278696B (en) | Molecular marker RAD51B-AS1 and application thereof | |
| CN110643707B (en) | ESCC (persistent resonant cell) -related lncRNA LLNLR-299G3.1 and application thereof | |
| CN109172593B (en) | Application of miR-516a as target for treating bladder cancer | |
| CN113293208A (en) | Molecular marker related to lung cancer proliferation and metastasis and application thereof | |
| CN110628909B (en) | miRNA molecule miR-4500 related to endometrial cancer and application thereof | |
| CN113186289B (en) | Application of lncRNA in renal cancer urine screening and renal cancer treatment | |
| CN116637123B (en) | Application of reagent for knocking down or down expression of C15orf39 gene in preparation of medicines for treating gastric cancer | |
| CN114832105B (en) | Application of inhibitor of C7orf50 gene or protein | |
| CN114480390B (en) | siRNA, siRNA plasmid and lentivirus for targeted inhibition of ZNF22 gene expression as well as construction method and application thereof | |
| CN110042160B (en) | Digestive system malignant tumor marker and method for preparing medicine for inhibiting digestive system malignant tumor | |
| CN101670118A (en) | Application of miR-155 in preparing medicine for curing gastricism | |
| AU2021100731A4 (en) | A Use of PIWI interacting RNA piR-hsa-211106 | |
| CN113122638B (en) | Application of hsa-novel_circ_0006787 molecule in liver cancer treatment | |
| CN107365859A (en) | Molecular markers of the LncRNA as diagnosis and treatment osteosarcoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |