CN111363797A - Kit for detecting VPS11 gene A407V mutation - Google Patents
Kit for detecting VPS11 gene A407V mutation Download PDFInfo
- Publication number
- CN111363797A CN111363797A CN201811603542.2A CN201811603542A CN111363797A CN 111363797 A CN111363797 A CN 111363797A CN 201811603542 A CN201811603542 A CN 201811603542A CN 111363797 A CN111363797 A CN 111363797A
- Authority
- CN
- China
- Prior art keywords
- vps11
- gene
- mutation
- kit
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kit for detecting VPS11 gene A407V mutation, and belongs to the technical field of biotechnology and clinical molecular diagnosis. The invention discovers that the mutation of the VPS11 gene A407V can cause the generation of the Parkinson disease, and the etiology of the Parkinson disease can be diagnosed by detecting the mutation of the VPS11 gene A407V. The method based on the kit is a peptide PNA fluorescent probe method used by combining a PCR method, and mainly comprises a forward primer used for specifically amplifying VPS11 gene A407V mutation and a reverse PNA fluorescent probe primer complementary with VPS11 gene A407V mutation, wherein the sequences of the primers are respectively shown as SEQ ID No.1 and SEQ ID No. 2. The kit provided by the invention has the advantages of simple experimental operation, low cost, good result repeatability and good sensitivity, and is an important means for diagnosing the genetic etiology of the Parkinson's disease and carrying out basic scientific research.
Description
Technical Field
The invention relates to the technical field of biotechnology and clinical molecular diagnosis, in particular to a kit for detecting VPS11 gene A407V mutation.
Background
Parkinson's Disease (PD), also known as paralysis agitans (parkinsonism), is a common degenerative disease of the nervous system, common in the elderly, with an average age of about 60 years, and less common in young Parkinson's disease that starts under 40 years. The prevalence rate of PD in people over 65 years old in China is about 1.7%. The most prominent pathological change of parkinson's disease is the degenerative death of mesocerebral Dopaminergic (DA) neurons, which causes a marked reduction in striatal DA content and causes disease. PD is clinically classified as idiopathic/sporadic PD, familial/hereditary PD, secondary PD, and parkinsonism. Until now, the exact etiology of the Parkinson's disease is not clear, and no effective treatment and cure means exist, so that the method is particularly important for preventing the disease, most of the Parkinson's diseases are related to heredity, and the method is particularly important for genetic screening of patients with family history of the Parkinson's disease.
The current genetic research shows that LRRK2, SNCA, VPS35, GCH1, ATXN2, DNAJC13, TMEM230, GIGYF2, HTRA2, RIC3, EIF4G1, UCHL1, CHCHD2 and GBA gene mutation can cause the occurrence of autosomal dominant Parkinson disease; PRKN, PINK1, DJ1, ATP13A2, PLA2G6, FBXO7, DNAJC6, SYNJ1, SPG11, VPS13C, PODXL and PTRHD1 gene mutations can cause the generation of recessive autosomal Parkinson's disease; and the RAB39B gene can cause the occurrence of the accompanying X-chromosome Parkinson disease, however, genetic risk factors of a plurality of Parkinson disease patients are unknown, and no research indicates that the VPS11 gene mutation can cause the occurrence of the Parkinson disease at present.
Peptide Nucleic Acids (PNAs) are a class of DNA analogs that replace the sugar phosphate backbone with a polypeptide backbone. The third-generation antisense reagent is constructed by computer design on the basis of first-generation and second-generation antisense reagents and finally synthesized artificially, is a brand-new DNA analogue, namely a pentose phosphodiester bond framework in DNA is replaced by a neutral peptide chain amide 2-aminoethylglycine bond, the rest is the same as the DNA, and PNA can recognize and combine with DNA or RNA sequence in a Watson-Crick base pairing mode to form a stable double-helix structure. Because PNA has no negative charge and has no electrostatic repulsion with DNA and RNA, the stability and specificity of combination are greatly improved; unlike the hybridization between DNA and DNA or RNA, the hybridization between PNA and DNA or RNA is hardly affected by the salt concentration of the hybridization system, and the hybridization ability with DNA or RNA molecules is far superior to that of DNA/DNA or DNA/RNA in terms of high hybridization stability, excellent specific sequence recognition ability, and resistance to nuclease and protease hydrolysis.
The invention adopts PNA oligomer with specific sequence as probe. Because PNA is an analogue of artificially synthesized nucleic acid and is an achiral and uncharged molecule, the instability of hybridization caused by mutual repulsion of charges when oligonucleotide is combined with a target gene is avoided, the combination is not easily influenced by the ionic strength of a hybridization solution, so that the PNA shows extremely strong hybridization advantages, and the detection sensitivity is greatly improved.
Disclosure of Invention
The VPS11 gene A407V mutation is firstly found to cause the generation of the Parkinson disease by genetic screening in families with the Parkinson disease, so that the VPS11 gene can be used for diagnosing the etiology of the Parkinson disease.
The invention aims to provide application of a VPS11 gene in preparing a reagent or a kit for diagnosing the etiology of the Parkinson disease, and the diagnosis of the etiology of the Parkinson disease is carried out by detecting the mutation of the VPS11 gene A407V. Namely, the Parkinson disease etiology diagnosis reagent or the diagnosis kit is a reagent or a kit for detecting VPS11 gene A407V mutation.
In order to realize the purpose, the invention adopts the following technical scheme:
a reagent for detecting a mutation in VPS11 gene A407V, comprising:
forward primer VPS11-F for specific amplification of the VPS11 gene a407V mutation: 5'-gacctgcagttcattgtggcc-3', respectively;
reverse PNA fluorescent probe primer complementary to VPS11 Gene A407V mutant VPS11(PNA) -P-R: 5 '-fluorescent reporter-ttgctggacaaccccatcgtg-quencher-3'; wherein, the fluorescence reporter group comprises FAM, HEX, TET, JOE, VIC, ROX, Cy3, Cy5 and the like, and the quenching group comprises TAMRA, Eclipse, BHQ1, BHQ2, BHQ3, DABCYL and the like.
Further, the reagent for detecting the mutation of the VPS11 gene A407V comprises PCR reaction reagents, such as DNA polymerase with 5'→ 3' exo-activity, dNTPs, PCR Buffer, a solution containing Mg ions and the like.
Furthermore, the reagent for detecting the VPS11 gene A407V mutation comprises a positive reference product and a negative reference product. The positive reference substance is plasmid DNA carrying a fragment with a sequence shown in SEQ ID NO.3, and the concentration is preferably 3 ng/mu L; the sequence shown in SEQ ID NO.3 is a sequence of mutation of exon 7A 407V of VPS11 gene with the length of 501 bp. The negative reference substance is plasmid DNA carrying a fragment with a sequence shown in SEQ ID NO.4, and the concentration is preferably 3 ng/mu L; the sequence shown in SEQ ID NO.4 is a VPS11 gene 7 exon wild-type sequence with the length of 501 bp.
A kit for detecting VPS11 gene A407V mutation comprises the reagent.
The reagent or the kit for detecting the VPS11 gene A407V mutation is a Peptide Nucleic Acid (PNA) fluorescent probe method used in combination with a PCR method, and the principle is as follows: by constructing a PNA fluorescent probe complementary to the VPS11 gene mutant as a reverse primer, either mutation can result in PNA/DNA mismatch when the PNA sequence is complementarily bound to the VPS11 gene, thereby altering the melting temperature. Furthermore, specific PNA fluorescent probes and forward primers are designed according to the VPS11 gene mutant type, the VPS11 mutant type gene is subjected to fluorescent quantitative PCR amplification, and after the PCR amplification, the VPS11 gene mutant type and the wild type can be distinguished.
The detection method using the reagent or the kit comprises the following steps:
(1) extracting DNA of a sample to be detected; the sample to be detected comprises blood of a patient, a formaldehyde fixed paraffin embedded sample and a fresh tissue sample.
(2) Preparing a PCR reaction solution for real-time fluorescent quantitative PCR, wherein the PCR reaction solution comprises a DNA template, a forward primer VPS11-F, a reverse PNA fluorescent probe primer VPS11(PNA) -P-R, water, DNA polymerase with 5'→ 3' exo activity, dNTPs, 10 × PCR Buffer and a solution containing Mg ions, wherein the DNA template is extracted DNA of a sample to be detected, a positive reference product or a negative reference product.
(3) According to the positive reference substance, the negative reference substance, the CT value of the real-time fluorescence quantitative PCR of the sample DNA to be detected and the corresponding △ Rn value (subtracting the base line signal value from the standard indication signal value), the result is judged, when the CT value is equal to the CT valueM≤CTA<CTWAnd △ Rn(W)<△Rn(A)≤△Rn(M)When the mutation is detected, the mutation is indicated to exist in the sample; when CTW=CTAAnd △ Rn(A)≤△Rn(W)When the sample is wild type, the sample is wild type; wherein, CTARepresenting the CT value, CT, of the sample to be examinedWShowing the CT value, CT, of a negative referenceMRepresenting the CT value of a positive reference, △ Rn(A)Indicating △ Rn value of the sample to be detected, △ Rn(W)Indicates the negative reference △ Rn value, △ Rn(M)The expression shows △ Rn values of the positive reference, namely A represents the sample to be detected, W represents the negative reference, and M represents the positive reference.
Further, in the PCR reaction solution in the step (2), the final concentration of the DNA polymerase is 0.01-0.05U/. mu.L, the final concentration of the dNTPs is 0.2-0.6 mM, and the final concentration of the 10 × PCR Buffer is 1 ×2The final concentration of the primer is 1.5-5.0 mM, the final concentration of the forward primer VPS11-F is 0.05-0.9 mu M, and the final concentration of the reverse PNA fluorescent probe primer VPS11(PNA) -P-R is 0.05-0.9 mu M.
Compared with the prior art, the invention has the advantages and positive effects that: the invention firstly discovers that VPS11 gene A407V mutation can cause Parkinson's disease, provides a reagent for directly detecting VPS11 gene mutation in DNA of a Parkinson's disease patient, and the detection reagent can quickly detect the VPS11 gene mutation at the DNA level by a real-time fluorescent quantitative PCR method, and is different from the common real-time fluorescent quantitative PCR, a peptide nucleic acid PNA fluorescent probe used by the invention is more sensitive, and the invention provides a very powerful tool for new targeted drug discussion, basic scientific research and guiding patient medication for clinicians. The method is simple to operate, sample adding is carried out once, and the sample adding is carried out in a closed reaction system all the time from the beginning to the end of the PCR reaction, so that the pollution probability is reduced, and the probability of deviation of the result is reduced. The result is clearly and intuitively interpreted.
In a word, the kit for detecting the VPS11 gene mutation has the advantages of simple experimental operation, low cost, repeatability of results and good sensitivity, and is an important means for diagnosing the genetic etiology of the Parkinson's disease and carrying out basic scientific research.
Detailed Description
The following examples are intended to further illustrate the invention but should not be construed as limiting it. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
Example 1
The VPS11 gene A407V mutation is firstly found to cause the generation of the Parkinson disease by genetic screening in families with the Parkinson disease, so that the VPS11 gene can be used for diagnosing the etiology of the Parkinson disease patients.
A kit for detecting VPS11 gene A407V mutation mainly comprises:
(1) the primer and probe for detecting the VPS11 gene A407V mutation have the following sequences:
VPS11-F:5'-gacctgcagttcattgtggcc-3';
VPS11(PNA)-P-R:5'-FAM-ttgctggacaaccccatcgtg-BHQ1-3';
the method comprises the following steps: f represents a forward primer, and R represents a reverse primer; p: represents a fluorescent probe, and the fluorescent probe is a TaqMan fluorescent probe.
In the embodiment of the present invention, the fluorescent reporter group at the 5' end of the modified fluorescent probe may be: FAM, HEX, TET, JOE, VIC, ROX, Cy3, or Cy 5; the quenching group for modifying the 3' end of the fluorescent probe can be: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL, the fluorescent reporter group and the quenching group do not influence the amplification of the fluorescent quantitative PCR, and the type of the used instrument is selected according to the fluorescent reporter group and the quenching group of the probe to set the detectable fluorescent signal range.
Example 2
(1) Extraction of lymphocytes from blood
1) 1mL of fresh anticoagulated blood is adopted for the patient and is mixed with 1:1 of physiological saline.
2) 2mL of lymphocyte layering solution (Ficoll, stored in the dark at low temperature) are carefully added and 400g (about 1500 rpm, horizontal rotor with radius 1 cm) are centrifuged for 20 minutes.
3) The cells in the centrifuge tube are divided into four layers from top to bottom. The first layer is a plasma layer, the second layer is an annular milky white lymphocyte layer, the third layer is a transparent separation liquid layer, and the fourth layer is a red blood cell layer.
4) The second layer of cells was collected and placed in a tube containing 5mL of physiological saline, and after thoroughly mixing, the cells were centrifuged at 400g (about 1500 rpm) for 20 minutes. Washing the precipitate with normal saline for 2 times to obtain the desired lymphocyte.
The DNA of the lymphocytes is extracted as a template for subsequent real-time fluorescent quantitative PCR.
(2) Real-time fluorescent quantitative PCR is carried out by preparing PCR reaction system in reaction tube from DNA template, TaqDNA polymerase 0.3 uL with concentration of 5U/uL, dNTPs 2 uL with concentration of 10mmol/L, PCR Buffer 5 uL of 10 ×, MgCl with concentration of 25mmol/L2mu.L of the solution, 2.5. mu.L of 10. mu.M VPS11-F, 2.5. mu.L of 10. mu.M VPS11(PNA) -P-R, and 50. mu.L of sterile water. Wherein, the DNA templates are respectively 5 mug of extracted total DNA, 1 mug of positive reference substance with 3 ng/mug and 1 mug of negative reference substance with 3 ng/mug.
Placing each reaction tube into a reaction tank of a fluorescence quantitative PCR instrument, setting the type of a labeled fluorescent group, the name and the type of a sample, selecting a Taqman fluorescent probe to be used (a fluorescence reporter group of the product is FAM, and a fluorescence quenching group is BHQ1), defining a sample hole, and carrying out PCR amplification according to an amplification program provided in the following table 1:
TABLE 1 amplification procedure for PCR amplification reaction
Fluorescence values were read at the end of the third step of the amplification procedure.
Sixthly, analyzing and judging data:
selecting a positive reference product (mutant type) and a negative reference product (wild type) hole corresponding to the detection site of the sample, and comparing the three-hole PCR amplification curves:
when CTM≤CTA<CTWAnd △ Rn(W)<△Rn(A)≤△Rn(M)When the mutation is detected, the mutation is indicated to exist in the sample;
when CTW=CTAAnd △ Rn(A)≤△Rn(W)When the sample is wild type, the sample is wild type;
wherein, CTARepresenting the CT value, CT, of the sample to be examinedWShowing the CT value, CT, of a negative referenceMRepresenting the CT value of a positive reference sample, △ Rn(A)Indicating △ Rn value of the sample to be detected, △ Rn(W)Indicates the negative reference △ Rn value, △ Rn(M)Indicates the value of △ Rn as a positive reference.
Example 3
The method in example 2 was used to test 180 patients with Parkinson's disease, and the results showed 177 patients with CT value of 36, △ Rn value of 2 × 104Does not carry the A407V mutation of the VPS11 gene, has 3 CT values of 25, 22 and 21, and corresponds to △ Rn value of 14 × 104、16×104、17×104And carrying the A407V mutation of the VPS11 gene, wherein the CT value of a positive reference product is 21, and the corresponding △ Rn value is 17 × 104The CT value of the negative reference product is 36, and the corresponding △ Rn value is 2 × 104。
Namely, the A407V mutation was found in the VPS11 gene of 3 of 180 Parkinson's disease patients.
Although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to one skilled in the art that modifications may be made to the embodiments described in the foregoing embodiments, or that certain features may be substituted in the same manner as described above, without departing from the spirit or scope of the invention as defined by the appended claims.
Sequence listing
<110> Hubei university of industry
<120> a kit for detecting VPS11 gene A407V mutation
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gacctgcagt tcattgtggc c 21
<210>2
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ttgctggaca accccatcgt g 21
<210>3
<211>501
<212>DNA
<213>Homo sapiens
<400>3
gacctgcagt tcattgtggc cggggatgag tgtgtctact tgtaccagcc tgatgaacgt 60
gggccctgct tcgcctttga gggccataag ctcattgccc actggtttag aggctacctt 120
atcattgtct cccgtgaccg gaaggtttct cccaagtcag agtttaccag cagggattca 180
cagagctccg acaagcagat tctaaacatc tatgacctgt gcaacaagtt catagcctat 240
agcaccgtct ttgaggatgt agtggatgtg cttgctgagt ggggctccct gtacgtgctg 300
acgcgggatg ggcgggtcca cgcactgcag gagaaggaca cacagaccaa actggagatg 360
ctgtttaaga agaacctatt tgagatggcg attaaccttg ccaagagcca gcatctggac 420
agtgatgggc tggcccagat tttcatgcag tatggagacc atctctacag caagggcaac 480
cacgatgggg ttgtccagca a 501
<210>4
<211>501
<212>DNA
<213>Homo sapiens
<400>4
gacctgcagt tcattgtggc cggggatgag tgtgtctact tgtaccagcc tgatgaacgt 60
gggccctgct tcgcctttga gggccataag ctcattgccc actggtttag aggctacctt 120
atcattgtct cccgtgaccg gaaggtttct cccaagtcag agtttaccag cagggattca 180
cagagctccg acaagcagat tctaaacatc tatgacctgt gcaacaagtt catagcctat 240
agcaccgtct ttgaggatgt agtggatgtg cttgctgagtggggctccct gtacgtgctg 300
acgcgggatg ggcgggtcca cgcactgcag gagaaggaca cacagaccaa actggagatg 360
ctgtttaaga agaacctatt tgagatggcg attaaccttg ccaagagcca gcatctggac 420
agtgatgggc tggcccagat tttcatgcag tatggagacc atctctacag caagggcaac 480
cacgatgggg ctgtccagca a 501
Claims (7)
- Application of VPS11 gene in preparing Parkinson disease etiological diagnostic reagent or diagnostic kit.
- 2. Use according to claim 1, characterized in that: the Parkinson disease etiology diagnosis reagent or the diagnosis kit is a reagent or a kit for VPS11 gene A407V mutation detection.
- 3. A reagent for detecting a mutation of VPS11 gene A407V, which is characterized in that: the method comprises the following steps:forward primer VPS 11-F: 5'-gacctgcagttcattgtggcc-3', respectively;reverse PNA fluorescent probe primer VPS11(PNA) -P-R: 5 '-fluorescent reporter-ttgctggacaaccccatcgtg-quencher-3'.
- 4. The reagent according to claim 3, characterized in that: including PCR reaction reagents.
- 5. The reagent according to claim 3, characterized in that: comprises a positive reference substance and a negative reference substance.
- 6. The reagent according to claim 5, characterized in that: the positive reference substance is plasmid DNA carrying a fragment with a sequence shown in SEQ ID NO.3, and the negative reference substance is plasmid DNA carrying a fragment with a sequence shown in SEQ ID NO. 4.
- 7. A kit for detecting VPS11 gene A407V mutation is characterized in that: comprising an agent according to any one of claims 3 to 6.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811603542.2A CN111363797A (en) | 2018-12-26 | 2018-12-26 | Kit for detecting VPS11 gene A407V mutation |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811603542.2A CN111363797A (en) | 2018-12-26 | 2018-12-26 | Kit for detecting VPS11 gene A407V mutation |
Publications (1)
Publication Number | Publication Date |
---|---|
CN111363797A true CN111363797A (en) | 2020-07-03 |
Family
ID=71204530
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811603542.2A Withdrawn CN111363797A (en) | 2018-12-26 | 2018-12-26 | Kit for detecting VPS11 gene A407V mutation |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111363797A (en) |
-
2018
- 2018-12-26 CN CN201811603542.2A patent/CN111363797A/en not_active Withdrawn
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP2001514013A (en) | Method for analyzing LTC4 synthase polymorphism and use for diagnosis | |
CN111235272B (en) | Composition for once detecting multiple gene mutation of lung cancer and application thereof | |
CN113913512A (en) | Primer probe composition and kit for detecting spinal muscular atrophy related genes | |
CN111269978B (en) | Human ApoE genotyping detection kit | |
CN106834434B (en) | Nucleic acid, kit and method for detecting COX-1, COX-2 and GPIIIa gene polymorphism | |
CN106498028B (en) | Diagnostic method and kit for T790M mutation of EGFR | |
CN106498029B (en) | Method for increasing diagnostic efficiency of T790M mutation of EGFR | |
WO2021239081A1 (en) | Reagent capable of being used for detecting npc1l1 mutant genotyping, kit, usage method therfor and application thereof | |
CN110819709A (en) | Method for detecting CYP2C9 and VKORC1 gene polymorphism by fluorescent quantitative PCR (polymerase chain reaction) | |
CN106636365B (en) | Nucleic acid, kit and method for detecting A1166C polymorphic site of AGTR1 gene | |
CN111363797A (en) | Kit for detecting VPS11 gene A407V mutation | |
CN111363799A (en) | Kit for detecting K87R mutation of VPS39 gene | |
CN111363800A (en) | Kit for detecting R138Q mutation of VPS41 gene | |
CN111363798A (en) | Kit for detecting L192V mutation of VPS16 gene | |
CN111690736A (en) | Warfarin medication gene detection kit and use method thereof | |
CN110863044A (en) | Primer combination for detecting VCL gene mutation and application thereof | |
US7592137B2 (en) | Genetic testing kits and a method of bladder cancer | |
CN113444791B (en) | ARMS-PCR kit for assisting in screening familial papillary thyroid carcinoma | |
CN113265461B (en) | Primer group, probe group and kit for detecting high-frequency gene pathogenic variation | |
WO2000006768A1 (en) | Genetic polymorphisms in the human neurokinin 1 receptor gene and their uses in diagnosis and treatment of diseases | |
CN106755489A (en) | High sensitivity detection method of gene mutation and used kit | |
CN114457151A (en) | Detection kit for detecting gene mutation of phenylalanine hydroxylase and detection method thereof | |
CN114317721A (en) | Kit for in vitro detection of autosomal recessive inheritance non-syndromic deafness gene MYO15A | |
CN113981069A (en) | Primer and kit for detecting ADRB1 gene G1165C polymorphism, detection method and application thereof | |
CN112501281A (en) | Human APOE genotyping detection primer set, detection method and detection kit |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WW01 | Invention patent application withdrawn after publication |
Application publication date: 20200703 |
|
WW01 | Invention patent application withdrawn after publication |