CN111334545A - Preparation process of high-purity recombinant TRAIL - Google Patents
Preparation process of high-purity recombinant TRAIL Download PDFInfo
- Publication number
- CN111334545A CN111334545A CN202010213552.6A CN202010213552A CN111334545A CN 111334545 A CN111334545 A CN 111334545A CN 202010213552 A CN202010213552 A CN 202010213552A CN 111334545 A CN111334545 A CN 111334545A
- Authority
- CN
- China
- Prior art keywords
- trail
- plasmid
- gene
- escherichia coli
- culture medium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70575—NGF/TNF-superfamily, e.g. CD70, CD95L, CD153, CD154
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a preparation process of high-purity recombinant TRAIL, belonging to the field of gene recombination. Comprises five steps of thallus inoculation, fermentation culture, feeding culture, crushing collection and chromatographic separation. According to the invention, the promoter structure of gene recombination is researched, and acid-hydrolyzed casein is selected as an induced nutrient component, so that the yield of the recombined TRAIL is increased; when ferrous ions are used as chelate ions, not only can a better chromatographic separation effect be achieved, but also the growth of escherichia coli can not be negatively affected; the pH value of the nutrient components is reasonably controlled by researching a feeding mode, so that the ferrous ions are prevented from being converted into toxic substances to influence the biological activity of the recombinant TRAIL; the separation rate of the recombinant TRAIL is increased by further optimizing thallus crushing and TRAIL collection and selecting coarse silica gel as an adsorption medium. The yield and the purity of the TRAIL are improved.
Description
Technical Field
The invention belongs to the field of gene recombination, and particularly relates to a preparation process of high-purity recombinant TRAIL.
Background
Tumor necrosis factor related apoptosis inducing ligand (TRAIL) is used as potential anticancer drug, and is composed of 281 amino acids, belonging to II type transmembrane protein, having homology with the amino acid sequences of TNF-a and FasL, and capable of inducing Tumor cells to generate apoptosis, but TNF-a and FasL have toxic and side effects on cells, and can not be applied to clinic.
Due to the clinical use of TRAIL, usually in the order of hundreds of milligrams, the demand is greater. However, in the preparation of high-purity recombinant TRAIL, high-density fermentation by escherichia coli is required, but the metabolism of escherichia coli cells causes changes in a culture system due to absorption of nutrients, discharge of toxic byproducts and absorption of oxygen, and further influences the yield and purity of TRAIL. Therefore, high requirements are put on the selection and optimization of an expression system, a high-density fermentation process and a protein purification process and the quality control.
Disclosure of Invention
The purpose of the invention is as follows: provides a preparation process of high-purity recombinant TRAIL, which aims to solve the problems involved in the background technology.
The technical scheme is as follows: a preparation process of high-purity recombinant TRAIL comprises the following steps:
step one, inoculating a culture solution which is frozen and stored into a culture medium shake flask according to the proportion of 1-5%, and stirring for 0.5-1 hour at the rotating speed of 100-200 rpm and the temperature of 30-40 ℃;
secondly, inoculating the escherichia coli containing the recombinant plasmid of the recombinant TRAIL gene into a culture medium shake flask in a proportion of 0.5-10%; fermenting and culturing at the rotating speed of 200-250 rpm and the temperature of 30-40 ℃;
step three, sampling, detecting and continuously feeding materials when the fermentation culture is carried out for 8-10 hours, and always ensuring that the pH of a shake flask of the culture medium is 4.5-7.0; fermenting and culturing for 24-48 hours at the rotating speed of 200-250 rpm and the temperature of 30-40 ℃;
step four, centrifugally collecting thalli, mixing the thalli with a buffer solution, crushing the thalli in a high-pressure homogenizer, centrifugally cracking, and collecting supernatant to obtain recombinant TRAIL protein suspension;
and step five, obtaining the high-purity recombinant TRAIL protein through multiple chromatographies.
As a preferable scheme, the culture solution comprises the following components in percentage by mass:
tryptone 20-40 g/L
8-12 g/L of yeast extract
Acid hydrolysis casein 8-12 g/L
Glucose 8-12 g/L
0.01-0.5 g/L calcium chloride
0.5-1.0 g/L sodium chloride
5-10 g/L sodium dihydrogen phosphate
Ferrous acetate 0.02-0.05 g/L
Defoaming agent 1g/L
Adjusting the pH value to 5.5-6.8 with a proper amount of acetic acid.
As a preferred embodiment, the feeding comprises the following steps: mixing acid hydrolyzed casein and glucose in a ratio of (5-8): 1 to form a feed liquid, continuously adding the feed liquid into a culture medium shake flask at a speed of 1.0-1.8 g/min, monitoring the pH in the culture medium shake flask in real time, and adding a predetermined amount of acetic acid into the feed liquid to adjust the pH of the culture medium shake flask to 4.5-7.0.
Preferably, the buffer solution is a phosphate buffer solution containing 0.1-0.5 mol/L sodium chloride.
As a preferred embodiment, a small amount of coarse silica gel is suspended in the buffer solution.
As a preferred scheme, the preparation process of the recombinant TRAIL gene segment of the Escherichia coli comprises the following steps:
step one, construction of target gene
Uses human pancreas tissue cDNA as a template to carry out PCR amplification on a target gene consisting of a tryptophan promoter, a gene h-TRAIL segment, a terminator and a DNA extracellular region segment.
Step two, plasmid extraction
Extracting phoA-TRAIL plasmid from Escherichia coli; designing specific primers of a phoA-TRAIL gene segment of a target gene; wherein, the upstream primer: TCTAGAATTATGATAATGAATGATGGC, the partial sequence TCTAGA is Xba I endonuclease recognition sequence; a downstream primer: GGCTCGAGCGATATAGGTG, the partial sequence CTCGAG is the recognition sequence of Hind III endonuclease.
Step three, construction of gene vector
Firstly, extracting phoA-TRAIL plasmid from escherichia coli strain, then performing HindIII/Xba I double enzyme digestion on the PCR purified product of the target gene h-TRAIL and the phoA-TRAIL plasmid respectively, adopting a rapid DNA connection kit to connect the gene h-TRAIL fragment and the phoA-TRAIL plasmid fragment, transforming escherichia coli W3110 competent cells, and smearing kanamycin acid hydrolysis casein culture medium.
Step four, detecting the gene vector
After the single bacterium grows out, carrying out bacterium liquid PCR, then extracting the plasmid, carrying out plasmid PCR and sequencing the plasmid PCR.
As a preferred embodiment, the target gene wherein the PCR amplification reaction conditions: pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 30 s, renaturation at 62 ℃ for 30 s, extension at 72 ℃ for 40s, 30 cycles of execution, and extension at 72 ℃ for 600 s.
Has the advantages that: the invention relates to a preparation process of high-purity recombinant TRAIL, which is characterized in that the research is carried out through a promoter structure of gene recombination, acid-hydrolyzed casein is selected as an induced nutrient component, and the yield of the recombinant TRAIL is improved; when ferrous ions are used as chelate ions, not only can a better chromatographic separation effect be achieved, but also the growth of escherichia coli can not be negatively affected; the pH value of the nutrient components is reasonably controlled by researching a feeding mode, so that the ferrous ions are prevented from being converted into toxic substances to influence the biological activity of the recombinant TRAIL; the separation rate of the recombinant TRAIL is increased by further optimizing thallus crushing and TRAIL collection and selecting coarse silica gel as an adsorption medium. The yield and the purity of the TRAIL are improved.
Detailed Description
In the following description, numerous specific details are set forth in order to provide a more thorough understanding of the present invention. It will be apparent, however, to one skilled in the art, that the present invention may be practiced without one or more of these specific details. In other instances, well-known features have not been described in order to avoid obscuring the invention.
The conventional LB culture medium mainly consists of peptone, yeast and inorganic salts, and further research on the nitrogen source of the culture medium firstly finds that the tryptone has the best effect, and in the using process, relatively high Escherichia coli concentration can be obtained, but the yield of the recombinant TRAIL is relatively low because tryptophan has obvious inhibiting effect on the expression of a tryptophan promoter. Therefore, the applicant selects the composition taking tryptone as a main component and acid-hydrolyzed casein as an auxiliary component by combining with the specific structural design of gene recombination, and researches on the acid-hydrolyzed casein protein find that the tryptophan in the peptone can be damaged to a certain extent after being treated by acid, so that the yield of the recombinant TRAIL can be greatly enhanced. Secondly, further research on a carbon source in the culture medium shows that the highest growth density can be obtained when the glucose concentration is 8-12 g/L, and the growth density is gradually reduced as the culture time is prolonged and the glucose content is reduced. Finally, the inorganic salts in the culture medium are further studied, and not only can the inorganic salts regulate osmotic pressure, but also can provide some necessary inorganic elements for the growth of escherichia coli, such as calcium, magnesium, sodium and the like. The recombinant TRAIL needs to be chelated with metal ions and can be further chromatographically separated, wherein ferrous ions, nickel ions and zinc ions have the potential of being chelated ions, and when escherichia coli lives in the environments of the nickel ions and the zinc ions for a long time, the escherichia coli can be poisoned and damaged. Therefore, the applicant researches and discovers that the same effect can be achieved by using ferrous ions as chelate ions, and the iron ions have no obvious influence on the growth of escherichia coli. Because dynamic balance exists among the TRAIL monomer, the TRAIL chelate and ferrous ions, when the concentration of the ferric ions is higher, the concentration of the TRAIL chelate is improved, the concentration of the TRAIL monomer is reduced, and the expression of hTRAIL gene sequence by escherichia coli is induced.
However, when ferrous ions are used as chelate ions, there is a problem that when ferrous ions and ferric oxide ions are used, not only the effect of chelated TRAIL monomer is not achieved, but also the growth activity of Escherichia coli is negatively affected, and the effect of low concentration on the culture system is small. However, in alkaline environment, after iron ions further generate ferric hydroxide, the biological activity of TRAIL chelate body is severely inhibited from being reduced. Therefore, the pH value of the culture solution needs to be accurately controlled during the whole fermentation culture process. Among the factors that influence the pH of the culture solution are mainly lactic acid (hydrolysate of carbon source) and ammonia (hydrolysis of nitrogen source) in the metabolites, and the pH of the solution needs to be precisely controlled during feeding. The applicant designs that an excessive carbon source is added into an initial culture solution to avoid the culture solution from becoming alkaline, then a nitrogen source is gradually added to realize the uniformity of escherichia coli metabolism, but after the nitrogen source is added, ammonia generated by metabolism cannot neutralize acidity, pH cannot approach to neutrality, and the pH is further reduced so as to directly influence the normal growth of escherichia coli. Therefore, the nitrogen source and the carbon source are mixed according to a preset proportion to form a feed liquid, the feed liquid is continuously added into the shake flask of the culture medium, the pH in the shake flask of the culture medium is monitored in real time, and the pH of the shake flask of the culture medium is adjusted to 4.5-7.0 by adding a preset amount of acetic acid into the feed liquid, so that an ideal effect is achieved.
The thalli are crushed, TRAIL is collected for further optimization, and the concentration of the TRAIL in the supernatant is the highest when the concentration of sodium ions in the suspension is 0.1-0.5. When the nitrogen concentration is higher than the above range, the TRAIL concentration in the supernatant is reduced to some extent. In addition, the applicant adopts the electrostatic adsorption principle of TRAIL to increase the concentration of TRAIL in the supernatant, and through a plurality of experiments and verifications, the inventor finds that in a buffer solution with pH of 6.0, when the isoelectric point of TRAIL is about 3.5 away from the buffer solution and about 4 away from the isoelectric point of an adsorption medium, the adsorption effect is best, so that the applicant selects the concentration of TRAIL with the density of less than 1g/cm3The coarse-pore silica gel is used as an adsorption medium for further experiments.
In a further implementation process, the preparation process of the recombinant TRAIL gene fragment of the Escherichia coli comprises the following steps: constructing a target gene, namely performing PCR amplification on the target gene consisting of a tryptophan promoter, a gene h-TRAIL fragment, a terminator and a DNA extracellular region fragment by taking human pancreatic tissue cDNA as a template; the target gene comprises the following PCR amplification reaction conditions: pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 30 s, renaturation at 62 ℃ for 30 s, extension at 72 ℃ for 40s, 30 cycles of execution, extension at 72 ℃ for 600 s. Step two, plasmid extraction, namely extracting phoA-TRAIL plasmid from escherichia coli; designing specific primers of a phoA-TRAIL gene segment of a target gene; wherein, the upstream primer: TCTAGAATTATGATAATGAATGATGGC, the partial sequence TCTAGA is Xba I endonuclease recognition sequence; a downstream primer: GGCTCGAGCGATATAGGTG, the partial sequence CTCGAG is the recognition sequence of Hind III endonuclease. And step three, constructing a gene vector, namely extracting a phoA-TRAIL plasmid from an escherichia coli strain, performing HindIII/Xba I double enzyme digestion on a PCR purified product of a target gene h-TRAIL and the phoA-TRAIL plasmid respectively, connecting a gene h-TRAIL fragment and a phoA-TRAIL plasmid fragment by adopting a rapid DNA (deoxyribonucleic acid) connecting kit, transforming escherichia coli W3110 competent cells, and coating the competent cells in an acid-hydrolyzed casein culture medium of kanamycin. And step four, detecting the gene vector, carrying out bacteria liquid PCR after single bacteria grow out, then extracting the plasmid, carrying out plasmid PCR and sequencing the plasmid PCR. The preparation process of the escherichia coli of the recombinant TRAIL gene fragment is completed by the life science and technology college of Chinese medicine university.
The present invention is further illustrated by the examples described herein, which are intended to be illustrative of the invention and are not to be construed as limiting the invention.
Example 1
Step one, inoculating the culture solution stored in a freezing way into a culture medium shake flask in a proportion of 5 percent, and stirring for 1 hour at the rotating speed of 180rpm and the temperature of 37 ℃.
The culture solution comprises the following components in parts by mass: tryptone 27 g/L; 9g/L of yeast extract; acid hydrolysis casein 9 g/L; 10g/L of glucose; 0.5g/L of calcium chloride; 0.8g/L of sodium chloride; 8g/L of sodium dihydrogen phosphate; ferrous acetate 0.035 g/L; 1g/L of defoaming agent; adjusting the pH value to 6.5 by using a proper amount of acetic acid.
Secondly, inoculating the escherichia coli containing the recombinant plasmid of the recombinant TRAIL gene into a shake flask of a culture medium according to the proportion of 1 percent; fermenting and culturing at the rotating speed of 220rpm and the temperature of 36 ℃.
Wherein, the preparation process of the escherichia coli of the recombinant TRAIL gene segment comprises the following steps: constructing a target gene, namely performing PCR amplification on the target gene consisting of a tryptophan promoter, a gene h-TRAIL fragment, a terminator and a DNA extracellular region fragment by taking human pancreatic tissue cDNA as a template; the target gene comprises the following PCR amplification reaction conditions: pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 30 s, renaturation at 62 ℃ for 30 s, extension at 72 ℃ for 40s, 30 cycles of execution, extension at 72 ℃ for 600 s. Step two, plasmid extraction, namely extracting phoA-TRAIL plasmid from escherichia coli; designing specific primers of a phoA-TRAIL gene segment of a target gene; wherein, the upstream primer: TCTAGAATTATGATAATGAATGATGGC, the partial sequence TCTAGA is Xba I endonuclease recognition sequence; a downstream primer: GGCTCGAGCGATATAGGTG, the partial sequence CTCGAG is the recognition sequence of Hind III endonuclease. And step three, constructing a gene vector, namely extracting a phoA-TRAIL plasmid from an escherichia coli strain, performing HindIII/Xba I double enzyme digestion on a PCR purified product of a target gene h-TRAIL and the phoA-TRAIL plasmid respectively, connecting a gene h-TRAIL fragment and a phoA-TRAIL plasmid fragment by adopting a rapid DNA (deoxyribonucleic acid) connecting kit, transforming escherichia coli W3110 competent cells, and coating the competent cells in an acid-hydrolyzed casein culture medium of kanamycin. And step four, detecting the gene vector, carrying out bacteria liquid PCR after single bacteria grow out, then extracting the plasmid, carrying out plasmid PCR and sequencing the plasmid PCR. The preparation process of the escherichia coli of the recombinant TRAIL gene fragment is completed by the life science and technology college of Chinese medicine university.
Step three, performing fermentation culture for 9 hours, sampling and detecting, mixing acid hydrolyzed casein and glucose according to the proportion of 6.8:1 to form a feed liquid, then continuously adding the feed liquid into a culture medium shake flask at 1.2g/min, monitoring the pH in the culture medium shake flask in real time, and adding a predetermined amount of acetic acid into the feed liquid to always ensure that the pH in the culture medium shake flask is between 4.5 and 7.0; fermenting and culturing at the rotating speed of 220rpm and the temperature of 37 ℃ for 36 hours.
And step four, centrifugally collecting thalli, mixing the thalli with a buffer solution, crushing the thalli in a high-pressure homogenizer, centrifugally cracking the thalli, and collecting supernatant to obtain the recombinant TRAIL protein suspension. Wherein the buffer solution is a phosphate buffer solution containing 0.4mol/L of sodium chloride. And a small amount of coarse-pore silica gel is suspended in the buffer solution.
And step five, obtaining the high-purity recombinant TRAIL protein through multiple chromatographies.
Example 2
Step one, inoculating the culture solution stored in a freezing way into a culture medium shake flask according to the proportion of 1 percent, and stirring for 1 hour at the rotating speed of 100rpm and the temperature of 30 ℃.
The culture solution comprises the following components in parts by mass: tryptone 20 g/L; 8g/L of yeast extract; acid hydrolysis of casein 12 g/L; glucose 8 g/L; 0.01 g/L of calcium chloride; 0.5g/L of sodium chloride; 5g/L of sodium dihydrogen phosphate; ferrous acetate 0.02 g/L; 1g/L of defoaming agent; adjusting the pH value to 6.8 by using a proper amount of acetic acid.
Secondly, inoculating escherichia coli containing recombinant plasmids of the recombinant TRAIL genes into a culture medium shake flask in a proportion of 0.5 percent; fermenting and culturing at the rotating speed of 200rpm and the temperature of 30 ℃.
Wherein, the preparation process of the escherichia coli of the recombinant TRAIL gene segment comprises the following steps: constructing a target gene, namely performing PCR amplification on the target gene consisting of a tryptophan promoter, a gene h-TRAIL fragment, a terminator and a DNA extracellular region fragment by taking human pancreatic tissue cDNA as a template; the target gene comprises the following PCR amplification reaction conditions: pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 30 s, renaturation at 62 ℃ for 30 s, extension at 72 ℃ for 40s, 30 cycles of execution, extension at 72 ℃ for 600 s. Step two, plasmid extraction, namely extracting phoA-TRAIL plasmid from escherichia coli; designing specific primers of a phoA-TRAIL gene segment of a target gene; wherein, the upstream primer: TCTAGAATTATGATAATGAATGATGGC, the partial sequence TCTAGA is Xba I endonuclease recognition sequence; a downstream primer: GGCTCGAGCGATATAGGTG, the partial sequence CTCGAG is the recognition sequence of Hind III endonuclease. And step three, constructing a gene vector, namely extracting a phoA-TRAIL plasmid from an escherichia coli strain, performing HindIII/Xba I double enzyme digestion on a PCR purified product of a target gene h-TRAIL and the phoA-TRAIL plasmid respectively, connecting a gene h-TRAIL fragment and a phoA-TRAIL plasmid fragment by adopting a rapid DNA (deoxyribonucleic acid) connecting kit, transforming escherichia coli W3110 competent cells, and coating the competent cells in an acid-hydrolyzed casein culture medium of kanamycin. And step four, detecting the gene vector, carrying out bacteria liquid PCR after single bacteria grow out, then extracting the plasmid, carrying out plasmid PCR and sequencing the plasmid PCR. The preparation process of the escherichia coli of the recombinant TRAIL gene fragment is completed by the life science and technology college of Chinese medicine university.
Step three, performing fermentation culture for 8 hours, sampling and detecting, mixing acid hydrolyzed casein and glucose in a ratio of 5:1 to form a feed liquid, then continuously adding the feed liquid into a culture medium shake flask at 1.0g/min, monitoring the pH in the culture medium shake flask in real time, and adding a predetermined amount of acetic acid into the feed liquid to always ensure that the pH in the culture medium shake flask is 4.5-7.0; then, the mixture was subjected to fermentation culture at a rotation speed of 200rpm at a temperature of 30 ℃ for 24 hours.
And step four, centrifugally collecting thalli, mixing the thalli with a buffer solution, crushing the thalli in a high-pressure homogenizer, centrifugally cracking the thalli, and collecting supernatant to obtain the recombinant TRAIL protein suspension. Wherein the buffer solution is a phosphate buffer solution containing 0.1mol/L of sodium chloride. And a small amount of coarse-pore silica gel is suspended in the buffer solution.
And step five, obtaining the high-purity recombinant TRAIL protein through multiple chromatographies.
Example 3
Step one, inoculating the culture solution stored in a freezing way into a culture medium shake flask in a proportion of 5 percent, and stirring for 0.5 hour at the rotating speed of 200rpm and the temperature of 40 ℃.
The culture solution comprises the following components in parts by mass: tryptone 40 g/L; 12g/L of yeast extract; acid hydrolysis casein 8 g/L; 12g/L of glucose; 0.5g/L of calcium chloride; 1.0 g/L of sodium chloride; 10g/L of sodium dihydrogen phosphate; ferrous acetate 0.05 g/L; 1g/L of defoaming agent; adjusting the pH value to 5.5 by using a proper amount of acetic acid.
Secondly, inoculating escherichia coli containing recombinant plasmids of the recombinant TRAIL genes into a culture medium shake flask in a proportion of 10 percent; fermenting and culturing at the rotating speed of 250rpm and the temperature of 40 ℃.
Wherein, the preparation process of the escherichia coli of the recombinant TRAIL gene segment comprises the following steps: constructing a target gene, namely performing PCR amplification on the target gene consisting of a tryptophan promoter, a gene h-TRAIL fragment, a terminator and a DNA extracellular region fragment by taking human pancreatic tissue cDNA as a template; the target gene comprises the following PCR amplification reaction conditions: pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 30 s, renaturation at 62 ℃ for 30 s, extension at 72 ℃ for 40s, 30 cycles of execution, extension at 72 ℃ for 600 s. Step two, plasmid extraction, namely extracting phoA-TRAIL plasmid from escherichia coli; designing specific primers of a phoA-TRAIL gene segment of a target gene; wherein, the upstream primer: TCTAGAATTATGATAATGAATGATGGC, the partial sequence TCTAGA is Xba I endonuclease recognition sequence; a downstream primer: GGCTCGAGCGATATAGGTG, the partial sequence CTCGAG is the recognition sequence of Hind III endonuclease. And step three, constructing a gene vector, namely extracting a phoA-TRAIL plasmid from an escherichia coli strain, performing HindIII/Xba I double enzyme digestion on a PCR purified product of a target gene h-TRAIL and the phoA-TRAIL plasmid respectively, connecting a gene h-TRAIL fragment and a phoA-TRAIL plasmid fragment by adopting a rapid DNA (deoxyribonucleic acid) connecting kit, transforming escherichia coli W3110 competent cells, and coating the competent cells in an acid-hydrolyzed casein culture medium of kanamycin. And step four, detecting the gene vector, carrying out bacteria liquid PCR after single bacteria grow out, then extracting the plasmid, carrying out plasmid PCR and sequencing the plasmid PCR. The preparation process of the escherichia coli of the recombinant TRAIL gene fragment is completed by the life science and technology college of Chinese medicine university.
Step three, performing fermentation culture for 10 hours, sampling and detecting, mixing acid hydrolyzed casein and glucose in a ratio of 8:1 to form a feed liquid, then continuously adding the feed liquid into a culture medium shake flask at 1.8g/min, monitoring the pH in the culture medium shake flask in real time, and adding a predetermined amount of acetic acid into the feed liquid to always ensure that the pH in the culture medium shake flask is 4.5-7.0; then the fermentation culture was carried out at a rotation speed of 250rpm at a temperature of 40 ℃ for 48 hours.
And step four, centrifugally collecting thalli, mixing the thalli with a buffer solution, crushing the thalli in a high-pressure homogenizer, centrifugally cracking the thalli, and collecting supernatant to obtain the recombinant TRAIL protein suspension. Wherein the buffer solution is a phosphate buffer solution containing 0.5mol/L of sodium chloride. And a small amount of coarse-pore silica gel is suspended in the buffer solution.
And step five, obtaining the high-purity recombinant TRAIL protein through multiple chromatographies.
Example 4
On the basis of the embodiment 1, the components of the culture solution are adjusted, and specifically, the culture solution comprises the following components in percentage by mass: tryptone 36 g/L; 9g/L of yeast extract; 10g/L of glucose; 0.5g/L of calcium chloride; 0.8g/L of sodium chloride; 8g/L of sodium dihydrogen phosphate; ferrous acetate 0.035 g/L; 1g/L of defoaming agent; adjusting the pH value to 6.5 by using a proper amount of acetic acid.
The rest of the procedure was the same as in example 1.
Example 5
On the basis of the embodiment 1, nickel ions are adopted as chelating metal ions, and the culture solution comprises the following components by mass concentration: tryptone 27 g/L; 9g/L of yeast extract; acid hydrolysis casein 9 g/L; 10g/L of glucose; 0.5g/L of calcium chloride; 0.8g/L of sodium chloride; 8g/L of sodium dihydrogen phosphate; 0.035g/L nickel sulfate; 1g/L of defoaming agent; adjusting the pH value to 6.5 by using a proper amount of acetic acid.
The rest of the procedure was the same as in example 1.
Example 6
On the basis of example 1, the feeding process is adjusted, specifically: the initial culture solution was added with excess glucose, the feed solution with acid hydrolysis casein as the main was added continuously at 0.6g/min to the medium flask by monitoring the pH in the medium flask in real time. Then, the mixture was subjected to fermentation culture at a rotation speed of 200rpm at a temperature of 30 ℃ for 24 hours.
The rest of the procedure was the same as in example 1.
Example 6
On the basis of example 1, the feeding process is adjusted, specifically: the initial culture solution was added with excess glucose, the feed solution with acid hydrolysis casein as the main was added continuously at 0.6g/min to the medium flask by monitoring the pH in the medium flask in real time. Fermenting and culturing at the rotating speed of 220rpm and the temperature of 37 ℃ for 36 hours.
The rest of the procedure was the same as in example 1.
Example 7
Based on example 1, the TRAIL collection process was adjusted by crushing the cells. The method specifically comprises the following steps: and centrifuging to collect thalli, mixing the thalli with a buffer solution, crushing the thalli in a high-pressure homogenizer, centrifuging the thalli for cracking, and collecting supernatant to obtain the recombinant TRAIL protein suspension. Wherein the buffer solution is a phosphate buffer solution containing 0.4mol/L of sodium chloride.
The rest of the procedure was the same as in example 1.
Example of detection
In the above examples, growth of E.coli cells, expression of TRAIL protein, and concentration of TRAIL in cell disruption solution were examined. The specific data are as follows:
TABLE 1
Through comparative examples 1-7, TRAIL protein with higher concentration and purity can be obtained in examples 1, 2 and 3.
It should be noted that the various features described in the above embodiments may be combined in any suitable manner without departing from the scope of the invention. The invention is not described in detail in order to avoid unnecessary repetition.
Claims (7)
1. A preparation process of high-purity recombinant TRAIL is characterized by comprising the following steps:
step one, inoculating a culture solution which is frozen and stored into a culture medium shake flask according to the proportion of 1-5%, and stirring for 0.5-1 hour at the rotating speed of 100-200 rpm and the temperature of 30-40 ℃;
secondly, inoculating the escherichia coli containing the recombinant plasmid of the recombinant TRAIL gene into a culture medium shake flask in a proportion of 0.5-10%; fermenting and culturing at the rotating speed of 200-250 rpm and the temperature of 30-40 ℃;
step three, sampling, detecting and continuously feeding materials when the fermentation culture is carried out for 8-10 hours, and always ensuring that the pH of a shake flask of the culture medium is 4.5-7.0; fermenting and culturing for 24-48 hours at the rotating speed of 200-250 rpm and the temperature of 30-40 ℃;
step four, centrifugally collecting thalli, mixing the thalli with a buffer solution, crushing the thalli in a high-pressure homogenizer, centrifugally cracking, and collecting supernatant to obtain recombinant TRAIL protein suspension;
and step five, obtaining the high-purity recombinant TRAIL protein through multiple chromatographies.
2. The process for preparing high-purity recombinant TRAIL according to claim 1, wherein the culture solution comprises the following components by mass:
tryptone 20-40 g/L
8-12 g/L of yeast extract
Acid hydrolysis casein 8-12 g/L
Glucose 8-12 g/L
0.01-0.5 g/L calcium chloride
0.5-1.0 g/L sodium chloride
5-10 g/L sodium dihydrogen phosphate
Ferrous acetate 0.02-0.05 g/L
Defoaming agent 1g/L
Adjusting the pH value to 5.5-6.8 with a proper amount of acetic acid.
3. The process for preparing high-purity recombinant TRAIL according to claim 1, wherein the feeding comprises the following steps: mixing acid hydrolyzed casein and glucose in a ratio of (5-8): 1 to form a feed liquid, continuously adding the feed liquid into a culture medium shake flask at a speed of 1.0-1.8 g/min, monitoring the pH in the culture medium shake flask in real time, and adding a predetermined amount of acetic acid into the feed liquid to adjust the pH of the culture medium shake flask to 4.5-7.0.
4. The process for preparing high-purity recombinant TRAIL according to claim 1, wherein the buffer solution is a phosphate buffer solution containing 0.1-0.5 mol/L of sodium chloride.
5. The process for preparing high purity recombinant TRAIL according to claim 1, wherein a small amount of coarse porous silica gel is suspended in the buffer solution.
6. The process for preparing high-purity recombinant TRAIL according to claim 1, wherein the process for preparing Escherichia coli of the recombinant TRAIL gene segment comprises the following steps:
step one, construction of target gene
Using human pancreatic tissue cDNA as template to make PCR amplification to obtain target gene formed from tryptophan promoter, gene h-TRAIL fragment, terminator and DNA extracellular region fragment;
step two, plasmid extraction
Extracting phoA-TRAIL plasmid from Escherichia coli; designing specific primers of a phoA-TRAIL gene segment of a target gene; wherein, the upstream primer: TCTAGAATTATGATAATGAATGATGGC, the partial sequence TCTAGA is Xba I endonuclease recognition sequence; a downstream primer: GGCTCGAGCGATATAGGTG, the partial sequence CTCGAG is a recognition sequence of Hind III endonuclease;
step three, construction of gene vector
Firstly, extracting phoA-TRAIL plasmid from escherichia coli strain, then carrying out HindIII/Xba I double enzyme digestion on the PCR purified product of the target gene h-TRAIL and the phoA-TRAIL plasmid respectively, adopting a rapid DNA connection kit to connect the gene h-TRAIL fragment and the phoA-TRAIL plasmid fragment, transforming escherichia coli W3110 competent cells, smearing kanamycin acid hydrolysis casein culture medium,
step four, detecting the gene vector
After the single bacterium grows out, carrying out bacterium liquid PCR, then extracting the plasmid, carrying out plasmid PCR and sequencing the plasmid PCR.
7. The process for preparing high purity recombinant TRAIL according to claim 6, wherein the target gene has the following PCR amplification reaction conditions: pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 30 s, renaturation at 62 ℃ for 30 s, extension at 72 ℃ for 40s, 30 cycles of execution, extension at 72 ℃ for 600 s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010213552.6A CN111334545A (en) | 2020-03-24 | 2020-03-24 | Preparation process of high-purity recombinant TRAIL |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010213552.6A CN111334545A (en) | 2020-03-24 | 2020-03-24 | Preparation process of high-purity recombinant TRAIL |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111334545A true CN111334545A (en) | 2020-06-26 |
Family
ID=71180397
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010213552.6A Withdrawn CN111334545A (en) | 2020-03-24 | 2020-03-24 | Preparation process of high-purity recombinant TRAIL |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111334545A (en) |
-
2020
- 2020-03-24 CN CN202010213552.6A patent/CN111334545A/en not_active Withdrawn
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108467860B (en) | Method for high yield of gamma-aminobutyric acid | |
| US10829755B2 (en) | Genetically engineered arginine deiminase modified by site-directed mutagenesis | |
| CN109777763B (en) | Genetically engineered bacterium for producing L-theanine and construction and application thereof | |
| CN105420154B (en) | Double-gene knockout recombinant rhodococcus, construction method and application thereof | |
| CN106047913B (en) | Construction method of double-enzyme co-expression strain for producing alpha-ketoglutaric acid | |
| CN108949706B (en) | L-proline-4-hydroxylase, gene engineering bacterium thereof, construction method and application | |
| JP2022535648A (en) | Use of thermostable β-glucosidase in the production of gentiooligosaccharides | |
| CN104726478A (en) | Recombinant Escherichia coli for expressing arginine deiminase gene and application of recombinant Escherichia coli | |
| CN114874964A (en) | Construction method and application of recombinant escherichia coli for high yield of 2' -fucosyllactose | |
| CN112779175A (en) | Engineering saccharomyces cerevisiae and method for preparing artificial bear gall powder | |
| CN113073074B (en) | Genetically engineered bacterium for efficiently synthesizing riboflavin and application thereof | |
| CN102827853B (en) | Halogenohydrin dehalogenation enzyme gene mutant and application thereof | |
| CN112251428B (en) | Glutamic acid decarboxylase mutant and application thereof in production of gamma-aminobutyric acid | |
| CN111235136B (en) | Isocitrate lyase mutant and application thereof in preparation of aromatic amino acid | |
| CN113249364B (en) | Industrial fermentation production method of whole cell containing glutamate decarboxylase | |
| CN111334545A (en) | Preparation process of high-purity recombinant TRAIL | |
| CN115725520A (en) | Preparation method of glutathione synthetase and method for catalytically producing glutathione | |
| CN116041474A (en) | Method for producing Sox2 protein by fermentation | |
| CN112779236B (en) | Trans-butenoic acid transaminase engineering bacteria and high-density fermentation method and application thereof | |
| CN111471636B (en) | Genetically engineered bacterium for expressing human epidermal growth factor and application thereof | |
| CN114181288A (en) | Process for producing L-valine, gene used therefor and protein encoded by the gene | |
| CN112575022A (en) | Construction method of in-vitro artificial scaffold protein-mediated trehalose multienzyme complex | |
| CN114875003B (en) | Mutant of short-chain dehydrogenase, coding gene obtaining method and application of mutant | |
| CN116555156B (en) | Method for improving L-valine yield and recombinant bacterium used by same | |
| CN116004575B (en) | Beta-glucuronidase and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20200626 |