CN111333734A - Whooping cough filamentous hemagglutinin fusion protein and application thereof - Google Patents

Abstract

The invention relates to a pertussis filamentous hemagglutinin fusion protein and application thereof, wherein the fusion protein is formed by connecting a pertussis FHA amino acid residue 1877-2250 fragment and StxB through a peptide chain, and is used for constructing a subunit vaccine and successfully inducing expression in escherichia coli, and the immunogenicity of the fusion protein is identified through Western-blot and ELISA; after mice are immunized, the antibody titer with high level can be generated, and a new thought is provided for research of pertussis vaccines.

Description

Whooping cough filamentous hemagglutinin fusion protein and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to whooping cough filamentous hemagglutinin fusion protein and application thereof.

Background

Pertussis is an acute respiratory infectious disease caused by bordetella pertussis, one of the relatively new human infectious diseases. This disease was first to appear in france in 1414 years and is one of the preventable diseases in the world that is least well controlled using vaccines. Pertussis is clinically characterized by a paroxysmal or explosive multiple rapid cough accompanied by a characteristic "borygmus" like inspiratory roar, the most common complication being secondary pneumonia. The disease is common in children and infants, especially those of less than 6 months of age. Although prophylactic vaccines against pertussis exist and the vaccination rate is high, pertussis remains one of the major causes of childhood death.

Natural Filamentous Hemagglutinin (FHA), which is a bordetella pertussis adhesin expressed on the surface of bacterial cells, is also secreted into the extracellular environment and contains several domains that promote bacterial adhesion to ciliated respiratory epithelial cells, including the conserved tripeptide sequence RGD (Arg-Gly-Asp), carbohydrate recognition binding domains and heparin binding domains. FHA initiates phagocytosis by RGD binding to Type3complement receptors (CR 3) on the surface of macrophages and other cells, and inhibition of toxin-mediated intracellular killing can then promote bacterial survival. To explore the most immunogenic regions of FHA, Asgarian-Omran et al demonstrated that the most effective immune response was induced at FHA amino acid residues 1877-2250 as the most immunodominant region of FHA by measurement of different regions of FHA with human serum antibodies.

The shiga toxin B subunit (StxB) was earlier shown to be a carrier protein to provide protective mucosal humoral and cellular immune responses after rotavirus antigen stimulation of mice. StxB is used as an antigen carrier to be combined with a specific cell surface receptor, so that DC cells can efficiently take up antigen protein in a receptor-mediated endocytosis mode, and the initial T cells are obviously activated to proliferate. Meanwhile, StxB provides a more complex structure for antigen, is more beneficial to antigen presentation and lymph node drainage, and effectively induces the immune response of an organism. Therefore, in the field of vaccine development, StxB becomes one of the effective vectors for subunit vaccines.

Disclosure of Invention

The invention aims to provide a pertussis filamentous hemagglutinin fusion protein capable of generating high-level antibody titer, and provides a new idea for research of pertussis vaccines.

The invention provides a protein, which is a) or b) or c) or d):

a) a protein consisting of the amino acid sequence of SEQ ID No. 2;

b) a protein consisting of the amino acid sequence shown in the 37 th to 503 th positions of SEQ ID No. 2;

c) a fusion protein obtained by carboxyl terminal or/and amino terminal fusion protein label of the protein shown in a) or b);

d) the protein is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2.

Wherein, the SEQ ID No.2 consists of 511 amino acid residues, the 1 st to 36 th positions are the amino acid sequence coded by the corresponding sequence on pET28a (+), the 37 th to 126 th positions are StxB, the 127 nd and 130 th positions are connecting peptides, the 131 nd and 503 th positions are Fha_1877-2250The amino acid sequence encoded by the corresponding sequence on pET28a (+) at position 504 and 511. a) The protein of (a) is named as His-StxB-Fha_1877-2250The protein of b) is named StxB-Fha_1877-2250。

The invention also claims a biological material related to the protein, wherein the biological material is any one of the following B1) to B12):

B1) a nucleic acid molecule encoding the protein;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector comprising the nucleic acid molecule of B1);

B4) a recombinant vector comprising the expression cassette of B2);

B5) a recombinant microorganism comprising the nucleic acid molecule of B1);

B6) a recombinant microorganism comprising the expression cassette of B2);

B7) a recombinant microorganism containing the recombinant vector of B3);

B8) a recombinant microorganism containing the recombinant vector of B4);

B9) a transgenic animal cell line comprising the nucleic acid molecule of B1);

B10) a transgenic animal cell line comprising the expression cassette of B2);

B11) a transgenic animal cell line containing the recombinant vector of B3);

B12) a transgenic animal cell line comprising the recombinant vector of B4).

In the above products, the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

Wherein, B1) is the following gene shown in 1) or 2) or 3) or 4):

1) the coding sequence is a DNA molecule shown in SEQ ID No. 1;

2) the coding sequence is a DNA molecule shown in the 109-1509 th position of SEQ ID No. 1;

3) has more than 90% of identity with the DNA molecule defined in 1) or 2) and encodes the protein.

SEQ ID No.1 consists of 1536 nucleotides, the 1-108 th site is the sequence on pET28a (+), the 109-378 th site is the StxB gene, the 379-390 th site is the linker peptide gene, the 391-1509 th site is the Fha gene_1877-2250The 1510-1536 position of the gene is the sequence on pET28a (+). a) The gene name of (a) is His-StxB-Fha_1877-2250Gene, the gene name of b) is StxB-Fha_1877-2250A gene.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

In the above biological material, B2) the composition contains a code StxB-Fha_1877-2250The expression cassette for the nucleic acid molecule of (9) (StxB-Fha)_1877-2250Gene expression cassette), refers to a gene expression cassette capable of expressing StxB-Fha in a host cell_1877-2250The DNA of (1), which may include not only the promoter StxB-Fha_1877-2250The promoter for gene transcription can also comprise a promoter for stopping StxB-Fha_1877-2250A terminator of transcription. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. The StxB-Fha-containing vector can be constructed using an existing animal expression vector_1877-2250Recombinant expression vectors for gene expression cassettes.

A method for producing the protein, comprising the step of expressing a gene encoding the protein in an organism to obtain the protein; the organism is a microorganism, a plant or a non-human animal.

Wherein the expression of a gene encoding a protein in an organism comprises introducing the gene encoding the protein into a recipient microorganism to obtain a recombinant microorganism expressing the protein, and culturing the recombinant microorganism to express the protein.

Wherein the recombinant microorganism is pET28a-StxB-Fha_1877-2250The recombinant microorganism expressing the protein having the amino acid sequence of SEQ ID No.2, which was obtained by introducing Escherichia coli BL21(DE3), was named BL21(DE3)/pET28a-StxB-Fha_1877-2250The pET28a-StxB-Fha_1877-2250A recombinant vector obtained by replacing the sequence between the EcoRI and XhoI sites of the vector pET28a (+) with the DNA fragment shown in positions 109-1509 of SEQ ID No. 1.

Wherein the expression is inducible expression.

The invention also provides a vaccine for preventing pertussis in animals, which comprises the protein or the biological material.

The protein is prepared according to the method;

the nucleic acid molecule is a gene shown in the following 1) or 2) or 3):

1) the coding sequence is a DNA molecule shown in SEQ ID No. 1;

2) the coding sequence is a DNA molecule shown in the 109-1509 th position of SEQ ID No. 1;

3) a DNA molecule having 90% or more identity to the DNA molecule defined in 1) or 2) and encoding the protein of claim 1;

the recombinant vector is the pET28a-StxB-Fha_1877-2250；

The recombinant microorganism is E1) or E2):

E1) the recombinant microorganism is obtained by introducing a coding gene of the protein into a receptor microorganism to express the protein, wherein the receptor microorganism is any one of C1) -C4):

C1) a prokaryotic microorganism;

C2) gram-negative bacteria;

C3) an Escherichia bacterium;

C4) escherichia coli BL21(DE 3);

the recombinant microorganism is the strain BL21(DE3)/pET28a-StxB-Fha_1877-2250。

The active ingredient of the vaccine for preventing pertussis of animals is the protein or the biological material.

Any of the following applications should also fall within the scope of the present invention:

y1) the use of the protein in the preparation of a pertussis vaccine;

y2) use of the biomaterial for the preparation of a pertussis vaccine;

y3) for use in the preparation of a pertussis vaccine;

y4) in preparing pertussis diagnostic antigen;

y5) in the preparation of monoclonal antibodies.

The pertussis FHA amino acid residue 1877-2250 fragment and StxB are used as fusion proteins to construct subunit vaccines, successfully induce and express in Escherichia coli, and the immunogenicity of the fusion proteins is identified by Western-blot and ELISA; after mice are immunized, the antibody titer with high level can be generated, and a new thought is provided for research of pertussis vaccines.

Drawings

FIG. 1 SDS-PAGE expression analysis (A) and western blot identification (B) of recombinant proteins. In the figure, M represents Marker,1 represents the protein expression of E.coli BL21(DE3), and 2 represents E.coli BL21(DE3)/pET28a-Fha _1877-22503 represents Escherichia coli/pET 28a-StxB-Fha_1877-2250Protein expression of (c).

FIG. 2 SDS-PAGE analysis of the purified product. In the figure, 1 is BL21(DE3)/pET28a-Fha_1877-2250Inducible expression of the protein His-FHA_1877-2250(ii) a2 is BL21(DE3)/pET28a-StxB-Fha_1877-2250Inducible expression protein His-StxB-Fha_1877-2250。

FIG. 3ELISA detects antibody IgG in the serum of immunized mice.

FIG. 4 different dilutions of serum complement bactericidal activity.

Figure 5 survival of mice after challenge.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The following examples are expression vectors pET-28a (+) (Youbao, VT1207), pGEX-4T-1 (Youbao, VT1253) Escherichia coli BL21(DE3) competent cells (Beijing TransGen Biotech Co., Ltd.), Bordetex P1 strain (Yaoho, Jia lifting. enhanced pertussis research and prevention and control, maintenance of public vaccination confidence and concern of titer indicators disqualified vaccine events and their long term effects [ J ]. contemporary pediatric journal of China, 2018,20(01):1-4)

In the following example 1 × PBS (pH8.0) had a solute of NaCl 137mmol/L, KCl 2.7mmol/L, Na₂HPO₄4.3mmol/L，KH₂PO₄1.4 mmol/L; the solvent is water; pH 8.0.

Animal virus: the biological material is available to the applicant for the public in accordance with the relevant national biosafety regulations, and is only used for repeating the relevant experiments of the present invention, and is not used for other purposes.

Example 1 preparation of a vaccine for the prevention of pertussis in animals

The invention relates to a gene of 3 proteins, namely His-StxB-Fha with the nucleotide sequence of SEQ ID No.1_1877-2250Gene (protein with SEQ ID No.2 coded amino acid sequence)

His-StxB-Fha_1877-2250) The nucleotide sequence is StxB-Fha at position 109-1509 of SEQ ID No.1_1877-2250Gene (encoding amino acid sequence is protein StxB-Fha at 37-503 th position of SEQ ID No.2_1877-2250) And His-Fha as a control_1877-2250Gene (encoding protein His-Fha)_1877-2250)。

SEQ ID No.1 consists of 1536 nucleotides, the 1-108 th site is the sequence on pET28a (+), the 109-378 th site is the StxB gene, the 379-390 th site is the linker peptide gene, the 391-1509 th site is the Fha gene_1877-2250The 1510-1536 position of the gene is the sequence on pET28a (+). a) The gene name of (a) is His-StxB-Fha_1877-2250Gene, the gene name of b) is StxB-Fha_1877-2250A gene.

Wherein, SEQ ID No.2 consists of 511 amino acid residues, the 1 st to 36 th positions are the amino acid sequence coded by the corresponding sequence on pET28a (+), the 37 th to 126 th positions are StxB, the 127 th and 130 th positions are connecting peptide131-503 sites are Fha_1877-2250The amino acid sequence encoded by the corresponding sequence on pET28a (+) at position 504 and 511. a) The protein of (a) is named as His-StxB-Fha_1877-2250The protein of b) is named StxB-Fha_1877-2250。

His-Fha_1877-2250The gene is His-StxB-Fha shown in SEQ ID No.1_1877-2250The 109-390 th position of the gene lacks a DNA molecule obtained by keeping the other nucleotides of SEQ ID No.1 unchanged.

1. Expression of His-StxB-Fha_1877-2250The recombinant Escherichia coli BL21(DE3)/pET28a-StxB-Fha_1877-2250Construction of

StxB-Fha shown in the 109-1509 th position of SEQ ID No.1 was synthesized by chemical synthesis_1877-2250A gene (encoding a protein represented by amino acid residues 37-503 of SEQ ID No. 2).

PCR amplification was performed with StxB-Fha_1877-2250The gene was used as a template with the use of the forward primer F1 (sequence 5' -CG)GAATTCAAAAAAACATTATTAATAGCTGC-3 ') and a downstream primer R1 (sequence 5' -GC)CTCGAGACCATCCGCCAGGCTGGTCTGCGCCGCACCAATA-3') in StxB-Fha_1877-2250The EcoR I site (underlined sequence) and the XhoI recognition site (underlined sequence) were added to both ends of the gene to obtain a gene containing StxB-Fha shown in the 109-and 1509-positions of SEQ ID No.1_1877-2250PCR products of the gene.

The mixture containing StxB-Fha_1877-2250The PCR product of the gene was digested with EcoR I and XhoI, and the desired fragment (StxB-Fha) was recovered_1877-2250Genes); meanwhile, the vector pET28a (+) is cut by enzyme with EcoR I and XhoI, and the large fragment of the vector is recovered; and connecting the recovered target fragment with the recovered vector large fragment to obtain the target plasmid. Coli BL21(DE3) competent cells were transformed with the plasmid of interest, plated on LB plates containing kanamycin (50. mu.g/mL), and cultured overnight in an incubator at 37 ℃. The positive monoclone obtained after the monoclone is verified by PCR is picked the next day and sent to Tianyihui company for sequencing. The sequencing result was shown to be StxB-Fha indicated by the 109-1509 th positions of SEQ ID No.1_1877-2250The gene replaces the fragment between the EcoR I and XhoI recognition sites of pET28a (+) and maintains the other sequence of pET28(+)The recombinant expression vector obtained without shuffling was named pET28a-StxB-Fha_1877-2250。pET28a-StxB-Fha_1877-2250Comprises His-StxB-Fha_1877-2250Gene (His-tagged StxB-Fha)_1877-2250A gene).

His-StxB-Fha_1877-2250The nucleotide sequence of the gene is shown in SEQ ID No.1, and the encoded protein His-StxB-Fha shown in SEQ ID No.2_1877-2250. Will contain pET28a-StxB-Fha_1877-2250The recombinant Escherichia coli strain of (1) was named as BL21(DE3)/pET28a-StxB-Fha_1877-2250。BL21(DE3)/pET28a-StxB-Fha_1877-2250Inducible expression of protein His-StxB-Fha with amino acid sequence of SEQ ID No.2_1877-2250。

2. Expression of His-Fha_1877-2250The recombinant Escherichia coli BL21(DE3)/pET28a-Fha_1877-2250Construction of

Referring to step 1, pET28a-Fha_1877-2250Escherichia coli BL21(DE3) was introduced to obtain a recombinant vector containing His-Fha_1877-2250Recombinant escherichia coli BL21(DE3)/pET28a-Fha of gene_1877-2250。

His-Fha_1877-2250The gene is His-StxB-Fha shown in SEQ ID No.1_1877-2250The 109-390 th position of the gene lacks a DNA molecule obtained by keeping the other nucleotides of SEQ ID No.1 unchanged.

BL21(DE3)/pET28a-Fha_1877-2250Inducible expression of protein His-Fha_1877-2250. Protein His-Fha_1877-2250Is protein His-StxB-Fha with amino acid sequence shown as SEQ ID No.2_1877-2250A protein obtained by deleting from positions 37 to 130 and keeping the other amino acid residues of SEQ ID No.2 unchanged.

Among them, pET28a-Fha_1877-2250Is prepared from pET28a-StxB-Fha_1877-2250His-StxB-Fha in (1)_1877-2250Gene replacement by His-Fha_1877-2250The gene is maintained as pET28a-StxB-Fha_1877-2250The other nucleotide of (a) is not changed to obtain a recombinant vector.

3. Induced expression of a Gene of interest

Respectively mixing Escherichia coli BL21(DE3), BL21(DE3)/pET28a-StxB-Fha_1877-2250And BL21(DE3)/pET28a-Fha_1877-2250Plating overnight, selecting monoclonal antibody, inoculating into LB liquid culture medium containing kanamycin, culturing at 28 deg.C in 220r/min shaking table until OD reaches about 0.6, adding IPTG with final concentration of 1mmol/L, inducing for 12h, collecting fermentation broth, centrifuging to collect 1mL thallus, adding 90 μ L ddH₂O resuspending the strain, adding 90. mu.L of 2 × SDS Buffer, mixing well, performing SDS-PAGE detection on the fusion protein with 12% SDS-PAGE gel after boiling water bath for 10min, transferring the recombinant protein to PVDF membrane by 160mA and 45min after SDS-PAGE electrophoresis, sealing 5% skimmed milk powder sealing solution at 37 ℃ for 1h, washing the membrane with 1 × PBST for 3 times, adding 1: 1000 diluted HRP-labeled His-tag antibody at 37 ℃ for incubation for 1h and washing the membrane with 1 × PBST for 3 times, detecting the recombinant protein with SuperSignal West Pico Plus (from Thermo Fisher Scientific Co.) after 7min each time by using a gel imager, wherein the 2 × SDS Buffer comprises (SDS, 32g, DTT, 6.17g, bromophenol blue, 0.4, glycerol, 160mL, 1mol/L of tips-HCI with pH of 6.8, 100mL, and the mixture is detected by ddH₂O constant volume to 1L)

As shown in FIG. 1, M represents Marker,1 represents the protein expression of E.coli BL21(DE3), and 2 represents E.coli BL21(DE3)/pET28a-Fha _1877-22503 represents Escherichia coli/pET 28a-StxB-Fha_1877-2250Protein expression profile of (2). Coli pET28a-Fha compared with E.coli BL21(DE3)_1877-2250And BL21(DE3)/pET28a-StxB-Fha_1877-2250The protein bands (shown in figure 1A) obviously expressed at 40 and 50kDa and the target protein His-FHA_1877-2250、His-StxB-Fha_1877-2250The predicted values of 41 and 51kDa are essentially identical. As shown in FIG. 1B, Western blot further verifies that the target protein required by us is correctly expressed.

4 purification and renaturation of recombinant proteins

Respectively mixing Escherichia coli BL21(DE3)/pET28a-StxB-Fha_1877-2250And BL21(DE3)/pET28a-Fha_1877-2250Plating overnight, selecting single clone, inoculating into LB liquid culture medium containing kanamycin, culturing at 28 deg.C in 220r/min shaking table until OD reaches about 0.6, and adding 1mmol/L final concentrationAfter 12 hours of IPTG induction, 500mL of fermentation broth was collected, the supernatant was centrifuged off, the cell pellet was resuspended in loading buffer A1 (solute: 0.5mol/L NaCl,13.3mL of Tsirrs-HCL, 0.1mmol/L of Imidazole; solvent: water; pH7.5), and the cells were disrupted with a cell disrupter. Centrifuging, taking the crushed precipitate, using a buffer solution A2(0.5mol/L NaCl,13.3ml/L Tirs-HCL,0.1mmol/LImidazole, 8M Urea; water as a solvent; pH7.5) containing Urea to resuspend the bacterial liquid, after the crushed bacterial is completely dissolved, centrifuging at 12000r/min for 10min, and taking the supernatant (protein sample) for purification.

The nickel column (Shanghai Bogelong Biotechnology Co., Ltd.) was equilibrated with 10 column volumes of buffer A2, and then the protein sample was loaded at a flow rate of 4mL/min, and finally the target protein was eluted with 5 column volumes of an eluent (solute: 0.5mol/L NaCl,13.3mL/L Tirs-HCL, 8M Urea, 0.5mol/L Imidazole, solvent: water; pH 7.4). The target protein was collected by adding it to a treated dialysis bag, dialyzed at 4 ℃ into a buffer [ solvent: 1 × PBS (pH8.0), solute: 4mM GSH, 0.4mM GSSG, 0.4M L-Arginine, 1M Urea. RTM., 1mM GSH, PBS]Neutralizing renaturation, dialyzing renaturated protein in 1 × PBS (pH8.0) solution for about 6-8h, filtering supernatant with 0.22 μm filter, and packaging to obtain protein His-StxB-Fha_1877-2250Solution (from BL21(DE3)/pET28a-StxB-Fha_1877-2250Prepared from) and the protein His-StxB-Fha_1877-2250Solution (from BL21(DE3)/pET28a-Fha_1877-2250Prepared) and frozen to-80 ℃.

After being purified by a nickel ion column affinity chromatography method, the high-purity protein inclusion body can be obtained. The renatured protein His-StxB-Fha_1877-2250Solution and protein His-StxB-Fha_1877-2250The solution was verified by SDS-PAGE to be BL21(DE3)/pET28a-Fha_1877-2250Inducible expression of the protein His-FHA_1877-2250、BL21(DE3)/pET28a-StxB-Fha_1877-2250Inducible expression protein His-StxB-Fha_1877-2250The relative molecular mass is consistent with the theoretical size, and the purity is over 98 percent (as shown in figure 2, M is Marker in figure 2, and 1 is BL21(DE3)/pET28a-Fha_1877-2250Inducible expression of the protein His-FHA_1877-2250(ii) a2 is BL21(DE3)/pET28a-StxB-Fha_1877-2250Inducible expression protein His-StxB-Fha_1877-2250)。

5 animal Immunity evaluation test

30 healthy, 5-6 week old female BALB/c mice weighing 18g were randomly divided into three groups of 10 mice each: FHA_1877-2250Group StxB-Fha_1877-2250Group, PBS immune Control group (Control). All mice were immunized 3 times subcutaneously with two weeks intervals. Each immunization was as follows: FHA_1877-2250Each mouse was immunized with 100. mu.L of immunogen consisting of 90. mu.L of His-FHA_1877-2250Protein solution (solute is His-Fha)_1877-2250Solvent 1 × PBS (pH8.0)) and 10. mu.L of aluminum hydroxide adjuvant to make His-FHA_1877-2250The immunization dose of (2.5) mu g/mouse; StxB-FHA_1877-2250Each mouse was immunized with 100. mu.L of immunogen consisting of 90. mu.L His-StxB-FHA_1877-2250Protein solution (solute is His-StxB-Fha)_1877-2250Solvent 1 × PBS (pH8.0)) and 10. mu.L of aluminum hydroxide adjuvant, and allowing His-StxB-FHA to react_1877-2250The immunization dose of (2.5) mu g/mouse, and a PBS immunization control group immunized 100. mu.L of immunogen per mouse, the 100. mu.L of immunogen consisted of 90. mu.L of 1 × PBS (pH8.0) and 10. mu.L of aluminum hydroxide adjuvant.

Collecting blood 10 days after the third immunization via tail vein, centrifuging at 6000r/min after overnight at 4 deg.C, and measuring mouse serum antibody level by indirect ELISA method, inoculating 2-half lethal dose (1.21 × 10) to each abdominal cavity of three groups of mice 14 days after the third immunization⁸CFU) ptx P1 bacterial solution, observed for 10 days after infection, and counting the death condition of the mice. After 18h, the mice show symptoms of reduced activity, listlessness and the like, after 24h, the mice in the control group and the experimental group begin to die, after 72h of toxicity attack, the mice in the control group all die, and FHA _1877-22506 mice in the immunized group died within 4 days, StxB-Fha_1877-22504 mice in the immunized group died, and the rest of the mice slowly recovered to health after experiencing cachexia. As shown in FIG. 5, it is noted that the fusion protein StxB-Fha is shown in FIG. 5_1877-2250Has better potential protection effect, and the effective protection rate is 60 percent.

FHA with GST tag_1877-2250Preparation of protein: chemical synthesis of FHA as shown in the 1391-1509 position of the sequence_1877-2250The gene segment takes FHA gene segment as a template and GXTfhha-up (G)GAATTCGACGAGCACCGTCACCTGCTG, the EcoR I site is underlined) and GXTfha-dn (GAC)GTCGACACCATCCGCCAGGCT, Sal I site is underlined) as a primer, PCR amplification is carried out, the obtained amplification product fragment and pGEX-4T-1 plasmid are connected through EcoR I and Sal I double enzyme digestion to construct recombinant plasmid pGEX-4T-1-FHA, after the sequencing is correct, the recombinant plasmid pGEX-4T-1-FHA is introduced into DL21 for induced expression, and after purification and renaturation, FHA with GST tag is obtained_1877-2250A protein.

The method for measuring the level of the mouse serum antibody by adopting the indirect ELISA method comprises the following steps: with FHA tagged with GST_1877-2250Protein is used as coating antigen, 100 mu L/hole coating enzyme label plate contains GST-Fha_1877-2250Protein 10. mu.g, coated overnight at 4 ℃. The next day, washing with PBST 3 times, adding 5% skimmed milk, blocking at 37 deg.C for 1h, washing with PBST three times, adding 1:50 times diluted mouse serum (i.e. the initial dilution ratio of mouse serum is 1:50, then sequentially diluting according to the time-to-time dilution principle to 1/2), incubating at 100 μ L/well, incubating at 37 deg.C for 1h, washing with PBST 3 times, adding 1: 20000 diluted HRP-labeled goat anti-mouse IgG was used as a secondary antibody, incubated at 37 ℃ for 1h, washed with PBST for 3 times, added with TMB (solid TMB Kit (20x) available from Kangji Shiji Biotech) solution, developed in dark for 15 minutes, finally added with stop solution (55.5mL of concentrated sulfuric acid, 444.5 distilled water, used after cooling) for 5 minutes, and then read the absorbance at 450nm with a microplate reader. The positive judgment standard is 2.1 times of the average OD value of the serum of the control mice.

Mice were treated with His-StxB-Fha, respectively_1877-2250、His-FHA_1877-2250After three times of immunization of the recombinant protein, the serum of the mouse at the 10 th day after the last immunization is taken to detect the antibody titer. As shown in FIG. 3, it is clear from FIG. 3 that StxB-Fha is not the same as StxB-Fha_1877-2250Group or FHA_1877-2250The groups all produced specific antibodies against FHA, with antibody titers significantly different from those of the negative control, and StxB-Fha_1877-2250The titer of the antibody generated by the protein can reach 1: 3200 (as shown in the figure)3) in comparison with FHA_1877-2250Protein-immunized mice are capable of producing higher levels of specific antibodies. ELISA detection proves that the recombinant protein StxB-Fha_1877-2250After the mice are immunized, the body can be effectively stimulated to generate specific B cell immune response.

6 serum in vitro sterilization experiment

Pertussis ptx P1 strain was cultured to OD₆₀₀At 2.0, the cells were diluted with physiological saline to a bacterial concentration of 100-. Mixing 10 μ L of diluted bacterial liquid with 10 μ L of diluted 10 μ L of mouse serum (water bath at 58 ℃ for 30 minutes in advance to inactivate complement components therein) of step 5 at the 10 th day after the third immunization, incubating at 37 ℃ for 1 hour, adding 20 μ L of complement, mixing well, incubating at 37 ℃ for 1 hour, coating LB plate on the whole, incubating at 37 ℃ in an incubator for 5 days, calculating the total number of plate colonies, and calculating the sterilization rate.

Detection of StxB-Fha by in vitro Sterilization experiments_1877-2250The group serum has bactericidal activity. As a result, as shown in FIG. 4, the initial concentration of serum almost achieved 80% bactericidal effect, but the effect was significantly reduced when the serum was diluted 80-fold. But in general StxB-Fha_1877-2250Serum bactericidal efficiency of the group is greater than that of FHA_1877-2250The group was slightly better.

In the above experiment, statistical analysis was performed using SAS 9.2 software, One-way ANOVA (One-way ANOVA) was used, and the difference P < 0.05 was statistically significant.

The immunity achieved by vaccination is not lifelong and its protective effect tends to diminish over a period of 4 to 10 years, so that today the incidence of pertussis is rising again. Therefore, the development of a new generation vaccine requires further research on the pathogenesis of bordetella pertussis and the immune effect of the vaccine. The low immunogenicity of subunit vaccines is a common problem, and cannot generate sufficient stimulation after entering an organism, the immune system has poor activation capability, and various vaccine delivery systems (such as extracellular vesicles, self-assembled protein nanoparticles, virus-like particles and the like) can be adopted to promote the antigen to be more efficiently identified and delivered by antigen presenting cells and stimulate T cell-dependent immune response, and related researches are also in progress.

As a major outer membrane protein of pertussis, FHA is not only abundant, but also a major component of today's pertussis acellular vaccine (apv). StxB fragment was constructed to FHA in this experiment_1877-2250Performing fusion expression at the N-terminal, and purifying the StxB-Fha_1877-2250Protein selection the immunogenicity of the protein was assessed using the Bp146 strain. The results of this study showed that FHA_1877-2250The protection rate of the group mice reaches 40%, that is, single FHA_1877-2250The antigen can stimulate the body to generate certain immune protection, which is consistent with the report of Asgarian-Omran and the like. On the basis, StxB-Fha fused with StxB_1877-2250The protection rate of the group is improved. StxB-Fha detected by indirect ELISA although the experimental groups did not differ significantly in the subsequent in vitro bactericidal experiments_1877-2250The highest antibody titer can reach 1: 3200, and StxB and FHA are verified_1877-2250The fusion of (a) helps to improve the immunogenicity and immunoprotection of the single antigen.

Although the embodiments of the present invention have been described with reference to the accompanying drawings, it is not intended to limit the scope of the present invention, and it should be understood by those skilled in the art that various modifications and variations can be made without inventive efforts by those skilled in the art based on the technical solution of the present invention.

Sequence listing

<110> military medical research institute of military science institute of people's liberation force of China

<120> whooping cough filamentous hemagglutinin fusion protein and application thereof

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>1536

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60

atggctagca tgactggtgg acagcaaatg ggtcgcggat ccgaattcaa aaaaacatta 120

ttaatagctg catcgctttc atttttttca gcaagtgcgc tggcgacgcc tgattgtgta 180

actggaaagg tggagtatac aaaatataat gatgacgata cctttacagt taaagtgggt 240

gataaagaat tatttaccaa cagatggaat cttcagtctc ttcttctcag tgcgcaaatt 300

acggggatga ctgtaaccat taaaactaat gcctgtcata atggaggggg attcagcgaa 360

gttatttttc gtctgcaggg cggatccggc gacgagcacc gtcacctgct gaacgaaggc 420

gtgatccagg cgggtggcca tggtcacatt ggtggcgacg tggataaccg tagcgtggtt 480

cgtaccgtta gcgcgatgga gtacttcaag accccgctgc cggttagcct gaccgcgctg 540

gataaccgtg cgggtctgag cccggcgacc tggaactttc agagcaccta cgaactgctg 600

gactatctgc tggatcaaaa ccgttacgag tatatctggg gcctgtaccc gacctatacc 660

gaatggagcg tgaacaccct gaaaaacctg gacctgggtt atcaagcgaa gccggcgccg 720

accgctccgc cgatgccgaa agcgccggag ctggatctgc gtggtcacac cctggagagc 780

gcggaaggcc gtaagatttt cggtgaatac aagaaactgc agggcgagta tgaaaaggcg 840

aaaatggcgg tgcaagcggt tgaggcgtac ggtgaagcga cccgtcgtgt gcacgaccag 900

ctgggtcaac gttatggcaa agcgctgggt ggcatggacg cggagaccaa ggaagtggat 960

ggcatcattc aagagtttgc ggcggacctg cgtaccgttt acgcgaaaca ggcggatcaa 1020

gcgaccatcg acgcggaaac cgataaagtt gcgcagcgtt ataagagcca aatcgatgcg 1080

gtgcgtctgc aggcgattca accgggtcgt gttaccctgg cgaaggcgct gagcgcggcg 1140

ctgggtgcgg actggcgtgc gctgggtcac agccagctga tgcaacgttg gaaggatttc 1200

aaagcgggca agcgtggcgc ggagattgcg ttttacccga aagaacagac cgttctggcg 1260

gcgggtgcgg gtctgaccct gagcaacggt gcgatccaca acggcgagaa cgcggcgcaa 1320

aaccgtggtc gtccggaagg cctgaaaatt ggtgcgcaca gcgcgaccag cgtgagcggc 1380

agctttgatg cgctgcgtga tgttggtctg gagaagcgtc tggacatcga cgatgcgctg 1440

gcggcggtgc tggttaaccc gcacatcttt acccgtattg gtgcggcgca gaccagcctg 1500

gcggatggtc tcgagcacca ccaccaccac cactga 1536

<210>2

<211>511

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro

1 5 10 15

Arg Gly Ser His Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg

20 25 30

Gly Ser Glu Phe Lys Lys Thr Leu Leu Ile Ala Ala Ser Leu Ser Phe

35 40 45

Phe Ser Ala Ser Ala Leu Ala Thr Pro Asp Cys Val Thr Gly Lys Val

50 55 60

Glu Tyr Thr Lys Tyr Asn Asp Asp Asp Thr Phe Thr Val Lys Val Gly

65 70 75 80

Asp Lys Glu Leu Phe Thr Asn Arg Trp Asn Leu Gln Ser Leu Leu Leu

85 90 95

Ser Ala Gln Ile Thr Gly Met Thr Val Thr Ile Lys Thr Asn Ala Cys

100 105 110

His Asn Gly Gly Gly Phe Ser Glu Val Ile Phe Arg Leu Gln Gly Gly

115 120 125

Ser Gly Asp Glu His Arg His Leu Leu Asn Glu Gly Val Ile Gln Ala

130 135 140

Gly Gly His Gly His Ile Gly Gly Asp Val Asp Asn Arg Ser Val Val

145 150 155 160

Arg Thr Val Ser Ala Met Glu Tyr Phe Lys Thr Pro Leu Pro Val Ser

165 170 175

Leu Thr Ala Leu Asp Asn Arg Ala Gly Leu Ser Pro Ala Thr Trp Asn

180 185 190

Phe Gln Ser Thr Tyr Glu Leu Leu Asp Tyr Leu Leu Asp Gln Asn Arg

195 200 205

Tyr Glu Tyr Ile Trp Gly Leu Tyr Pro Thr Tyr Thr Glu Trp Ser Val

210 215 220

Asn Thr Leu Lys Asn Leu Asp Leu Gly Tyr Gln Ala Lys Pro Ala Pro

225 230 235 240

Thr Ala Pro Pro Met Pro Lys Ala Pro Glu Leu Asp Leu Arg Gly His

245 250 255

Thr Leu Glu Ser Ala Glu Gly Arg Lys Ile Phe Gly Glu Tyr Lys Lys

260 265 270

Leu Gln Gly Glu Tyr Glu Lys Ala Lys Met Ala Val Gln Ala Val Glu

275 280 285

Ala Tyr Gly Glu Ala Thr Arg Arg Val His Asp Gln Leu Gly Gln Arg

290 295 300

Tyr Gly Lys Ala Leu Gly Gly Met Asp Ala Glu Thr Lys Glu Val Asp

305 310 315 320

Gly Ile Ile Gln Glu Phe Ala Ala Asp Leu Arg Thr Val Tyr Ala Lys

325 330 335

Gln Ala Asp Gln Ala Thr Ile Asp Ala Glu Thr Asp Lys Val Ala Gln

340 345 350

Arg Tyr Lys Ser Gln Ile Asp Ala Val Arg Leu Gln Ala Ile Gln Pro

355 360 365

Gly Arg Val Thr Leu Ala Lys Ala Leu Ser Ala Ala Leu Gly Ala Asp

370 375 380

Trp Arg Ala Leu Gly His Ser Gln Leu Met Gln Arg Trp Lys Asp Phe

385 390 395 400

Lys Ala Gly Lys Arg Gly Ala Glu Ile Ala Phe Tyr Pro Lys Glu Gln

405 410 415

Thr Val Leu Ala Ala Gly Ala Gly Leu Thr Leu Ser Asn Gly Ala Ile

420 425 430

His Asn Gly Glu Asn Ala Ala Gln Asn Arg Gly Arg Pro Glu Gly Leu

435 440 445

Lys Ile Gly Ala His Ser Ala Thr Ser Val Ser Gly Ser Phe Asp Ala

450 455 460

Leu Arg Asp Val Gly Leu Glu Lys Arg Leu Asp Ile Asp Asp Ala Leu

465 470 475 480

Ala Ala Val Leu Val Asn Pro His Ile Phe Thr Arg Ile Gly Ala Ala

485 490 495

Gln Thr Ser Leu Ala Asp Gly Leu Glu His His His His His His

500 505 510

Claims (10)

1. A protein, wherein the protein is a) or b) or c) or d):

a) a protein having the amino acid sequence of SEQ ID No. 2;

b) the amino acid sequence is the protein of 37 th-503 th position of SEQ ID No. 2;

c) a fusion protein obtained by carboxyl terminal or/and amino terminal fusion protein label of the protein shown in a) or b);

d) the protein with the same activity is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2.

2. The biomaterial related to the protein of claim 1, which is any one of the following B1) to B12):

B1) a nucleic acid molecule encoding the protein;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector comprising the nucleic acid molecule of B1);

B4) a recombinant vector comprising the expression cassette of B2);

B5) a recombinant microorganism comprising the nucleic acid molecule of B1);

B6) a recombinant microorganism comprising the expression cassette of B2);

B7) a recombinant microorganism containing the recombinant vector of B3);

B8) a recombinant microorganism containing the recombinant vector of B4);

B9) a transgenic animal cell line comprising the nucleic acid molecule of B1);

B10) a transgenic animal cell line comprising the expression cassette of B2);

B11) a transgenic animal cell line containing the recombinant vector of B3);

B12) a transgenic animal cell line comprising the recombinant vector of B4).

3. The biomaterial of claim 2, wherein: B1) the nucleic acid molecule is a gene shown in the following 1) or 2) or 3) or 4):

1) the coding sequence is a DNA molecule shown in SEQ ID No. 1;

2) the coding sequence is a DNA molecule shown in the 109-1509 th position of SEQ ID No. 1;

3) a DNA molecule having 90% or more identity to the DNA molecule defined in 1) or 2) and encoding the protein of claim 1.

4. A method for producing the protein of claim 1, comprising the step of expressing a gene encoding the protein of claim 1 in an organism to obtain the protein; the organism is a microorganism, a plant or a non-human animal.

5. The method of claim 4, wherein: the expression of a gene encoding a protein in an organism comprises introducing the gene encoding the protein into a recipient microorganism to obtain a recombinant microorganism expressing the protein, culturing the recombinant microorganism, and expressing the recombinant microorganism to obtain the protein.

6. The method of claim 5, wherein: the recombinant microorganism is pET28a-StxB-Fha_1877-2250The recombinant microorganism expressing the protein having the amino acid sequence of SEQ ID No.2, which was obtained by introducing Escherichia coli BL21(DE3) as described in pET28a-StxB-Fha_1877-2250In order to replace the sequence between the EcoR I and XhoI sites of the vector pET28a (+) with the DNA fragment shown in the 109-1509 th positions of SEQ ID No.1The recombinant vector obtained.

7. The method according to any one of claims 4-6, wherein: the expression is inducible expression.

8. A vaccine for the prevention of pertussis in an animal, comprising the protein of claim 1 or the biomaterial of claim 2 or 3.

9. The vaccine of claim 1, wherein: the active ingredient of the vaccine for preventing pertussis of animals is the protein or the biological material.

10. Any of the following applications:

y1) use of the protein of claim 1 for the preparation of a pertussis vaccine;

y2) use of the biomaterial of claim 2 or 3 for the preparation of a pertussis vaccine;

y3) the use of the method of any one of claims 3 to 6 for the manufacture of a pertussis vaccine;

y4) use of the protein of claim 1 for the preparation of a pertussis diagnostic antigen;

y5) use of the protein of claim 1 for the preparation of monoclonal antibodies.

Images