CN111304294A - Rapid detection system and method for combination of PCDA (Poly carbonate-co-polymerase chain reaction) vesicles and CRISPR (clustered regularly interspaced short palindromic repeats) - Google Patents

Rapid detection system and method for combination of PCDA (Poly carbonate-co-polymerase chain reaction) vesicles and CRISPR (clustered regularly interspaced short palindromic repeats) Download PDF

Info

Publication number
CN111304294A
CN111304294A CN202010054825.7A CN202010054825A CN111304294A CN 111304294 A CN111304294 A CN 111304294A CN 202010054825 A CN202010054825 A CN 202010054825A CN 111304294 A CN111304294 A CN 111304294A
Authority
CN
China
Prior art keywords
pcda
vesicle
substance
rapid detection
crispr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010054825.7A
Other languages
Chinese (zh)
Inventor
李小刚
刘士忠
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Beijing Polytechnic
Original Assignee
Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Beijing Polytechnic
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Peking Union Medical College Hospital Chinese Academy of Medical Sciences, Beijing Polytechnic filed Critical Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Priority to CN202010054825.7A priority Critical patent/CN111304294A/en
Publication of CN111304294A publication Critical patent/CN111304294A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a rapid detection system for PCDA vesicle-bound CRISPR, which comprises reagents R1 and R2 for detecting a target substance, wherein R1 comprises a substance to be detected or a related group of the substance, and R2 comprises a target DNA, a Cas protein-sgRNA complex and a PCDA vesicle. The detection method of the invention has the following advantages: (1) the test does not need special instruments, and the qualitative measurement can be only visible by naked eyes; (2) the operation is simple and rapid, heterogeneous testing is realized, and enzyme labeling and separation are not needed; (3) the method has the advantages of sensitivity, accurate result, simple sample treatment and low detection cost.

Description

Rapid detection system and method for combination of PCDA (Poly carbonate-co-polymerase chain reaction) vesicles and CRISPR (clustered regularly interspaced short palindromic repeats)
Technical Field
The invention relates to the technical field of biological medicines, in particular to a rapid detection system and a rapid detection method for combination of PCDA (10,12-pentacosadiynoic acid,10, 12-pentacosadiynoic acid) vesicles and CRISPR (clustered regularly interspaced short palindromic acid).
Background
CRISPR (clustered regularly interspaced short palindromic repeats) is a repetitive sequence in a prokaryotic genome and is an immune weapon generated by fighting bacteria and viruses in the history of life evolution. In brief, viruses can integrate their genes into bacteria, and the bacteria use their cellular tools to serve their gene replication, and have evolved the CRISPR-Cas9 system to eliminate the foreign invader genes of viruses, and by using this system, bacteria can excise viral genes from their genomes without the existence of voice, which is the unique immune system of bacteria.
The bordered Institute (Broad Institute) is a high-level genomics research center belonging to the american college of labor technology (MIT) and harvard university, whose peak team is working on developing CRISPR-Cas13 molecular diagnostic techniques. Unlike Cas9 protein for gene editing, Cas13 protein indiscriminately cleaves the encountered RNA after cleavage of the target sequence — "collateral cleavage" (compare cleavage); this property makes it unusable for gene editing but is a boon for diagnosis, and the cleavage increases the sensitivity of the detection signal. In 2018, the diagnosis technology is named as SHELLLOCK (specific high-sensitivity enzymatic reporter unlocking), and the system comprises Cas13, a corresponding sgRNA targeting a virus to be detected and a reporter RNA chain capable of emitting fluorescence after cutting; when these Cas13 proteins recognize the targeted RNA strand, the corresponding template is cleaved, which subsequently activates its "side-cleavage" activity, which in turn cleaves the reporter RNA and releases a detectable fluorescent signal.
The Doudna team at Burkeley university, California found that when Cas12a protein can cut the targeted dsDNA, non-specific single-stranded DNA (ssDNA) can be cut efficiently, and the technology of DETECTR (DNA endonuclease targeted CRISPR trans reporter) is developed based on the discovery; the system comprises Cas12a, sgrnas targeting specific sequences, and a non-specific ssDNA fluorescence reporter (FQ-labeled reporter). Once Cas12a detects the DNA sequence of interest, the target sequence is cleaved, and the fluorescent reporter sequence is cleaved, releasing a fluorescent signal. CRISPR diagnostics are currently mainly used for molecular diagnostics, including viruses, microorganisms, cfDNA, etc.
Polydiacetylene (PDA) vesicles are of great interest because of their special optical properties. Diacetylenes (diacetylenes) also called diacetylene or diacetylene are amphiphilic molecules which exist in a solution in the form of vesicles, and two adjacent alkynyl groups in the diacetylene molecules generate polydiacetylene through 1, 4-addition reaction under the irradiation of ultraviolet light; the visible light excites delocalized electrons of the molecular skeleton to generate pi-pi transition, the solution is blue, and the maximum absorption in the ultraviolet-visible spectrum is about 650 nm.
Polydiacetylene (PDA) has unique performance advantages, mainly reflected in the following aspects: first, PDA can be prepared by UV or gamma radiation self-assembly from diacetylene such as 10,12-pentacosadiynoic acid (PCDA) monomers, without the need for addition of catalysts or initiators during polymerization, and the purity of the product PDA polymer is high; second, upon exposure to a specific environmental stimulus, the blue PDA vesicle solution (maximum absorption wavelength about 640nm) can turn red (maximum absorption wavelength about 550nm), and this color transition can be directly observed by the naked eye; third, PDA vesicles in the blue state do not have fluorescent properties, while their red state is fluorescent, which makes polydiacetylene more suitable for developing changes in the environment outside the fluorescent sensor.
Depending on the degree of conversion of PDA vesicles from blue to red, a colorimetric response value (CR) can be used to quantify: CR (%) ═ (PB)0-PBf/PB0) X 100% of formula: PB ═ ABlue color/(ABlue color+ARed colour)，ABlue colorAnd ARed colourThe absorption values of the blue (ultraviolet absorption wavelength of 650nm) or red (ultraviolet absorption wavelength of 540nm) states of the vesicle system respectively; PB (PB)0Vesicle system A as blank control groupBlue color/(ABlue color+ARed colour) The ratio of (A) to (B); PB (PB)fFor the post-production vesicle system A after response to the environmentBlue color/(ABlue color+ARed colour) The value of (c). According to the formula, when the color of the vesicle is not changed, the CR% is 0%, and the larger the CR% value is, the stronger the color transformation degree of the system is, and the smaller the CR% value is.
In view of the above, it is an endeavor of those skilled in the art to develop a method for easily and rapidly detecting a target nucleic acid or other small molecules based on the prior art.
Disclosure of Invention
In order to realize rapid detection of specificity of a substance to be detected, the invention aims to provide a rapid detection system and a rapid detection method for combining a PCDA (10,12-pentacosadiynoic acid,10, 12-pentacosadiynoic acid) vesicle with a CRISPR (clustered regularly interspaced short palindromic acid).
Firstly, the invention provides a rapid detection system for binding CRISPR by PCDA vesicles, which comprises reagents R1 and R2 for detecting a target substance, wherein R1 comprises a substance to be detected or a related set group of the substance, and R2 comprises a target DNA, a Cas protein-sgRNA complex and PCDA vesicles.
The invention firstly connects diacetylene monomer such as 10,12-pentacosadiynoic acid (PCDA) with oligonucleotide, then introduces two oligonucleotides which are complementary with opposite end parts of target DNA into two liposomes respectively (figure 1), and then obtains PDA-DNA1 and PDA-DNA2 through polymerization. After treatment with 20. mu.M target DNA, the mixture of PDA-DNA1 and PDA-DNA2 turned from deep blue to red, with the absorption maximum shifted from 640nm to 540 nm. The force applied to the conjugated structure of the liposome resulting in the color transition results from the hybridization of the two oligonucleotides to the target DNA. Furthermore, no color change was observed upon addition of mismatched oligonucleotides, indicating that the detection system can detect target DNA sequence-specifically.
In a preferred embodiment, the R1 comprises a target nucleic acid. Isothermal amplification is required for target nucleic acid, and there are commercially available kits for isothermal amplification, such as Jiangsu Qitian gene Biotechnology GmbH.
The specific operation steps are as follows:
1. the following reaction system (single sample/reaction) was prepared in a 1.5mL centrifuge tube
Purified water 17.5. mu.L
Basic buffer 25. mu.L
Forward primer (10. mu.M) 2. mu.L
Reverse primer (10. mu.M) 2. mu.L
Template DNA 1. mu.L
Total volume 47.5. mu.L
Note 1: the specification recommends that the sample adding amount of the template DNA is 1 mu L, and if a researcher changes the sample adding amount of the template DNA, the amount of corresponding purified water needs to be reduced, so that the volume of the prepared solution is 47.5 mu L. If the sample addition amount is 5. mu.L, the purified water amount is 13.5. mu.L, and the total volume is not changed to 47.5. mu.L. The solution was mixed thoroughly and centrifuged.
2. Adding the mixed 47.5 mu L solution into a basic reaction unit filled with the freeze-dried powder to ensure that the freeze-dried powder is fully and uniformly redissolved. (Note that this step cannot be mixed by vigorous shaking with a vortex shaker).
3. To each reaction tube, 2.5. mu.L of magnesium acetate solution was added, and the tube was closed and collected instantaneously and mixed well. (Note that this step also did not allow vigorous shaking on a vortex shaker).
4. The reaction tube is placed at 37 ℃ for reaction for 20-40 minutes.
5. After completion of the reaction, the reaction tubes were taken out, 50. mu.L of phenol/chloroform (1:1) was added to each reaction tube, sufficiently shaken to homogenize, and centrifuged at 12000rpm for 1 minute.
6. 10 μ L of the supernatant was aspirated for detection.
After isothermal amplification, the amplified product is added into a system containing paired gRNAs, target DNA sequences of Cas proteins (including Cas12a, Cas13, Cas14 and the like) and PCDA-DNA vesicles, and color change is observed to qualitatively detect whether target nucleic acid exists or not.
When the target nucleic acid exists in the detection system, the target DNA sequence is cut once the Cas12a detects the target DNA sequence, and the degree of the blue-red change of the vesicle probe is inhibited, so that the rapid detection system of the target nucleic acid is established.
In a preferred embodiment, R1 is a buffer system of a small molecule specific antibody and a small molecule specific recognition group.
The system realizes the qualitative analysis of the micromolecules by the principle that free micromolecules in a liquid system compete with micromolecule probes coupled on micromolecule specific recognition groups for binding sites of specific antibodies and the inhibition condition of the vesicle probes from blue to red.
Preferably, the small molecule specific recognition group is a small molecule modified DNA/RNA probe comprising a nucleic acid sequence of the corresponding PAM sequence required for recognition by the Cas protein.
In a preferred implementation, the base sequences of the small molecule modified DNA/RNA probe are shown as SEQ ID No.2 and SEQ ID No. 3.
Preferably, the small molecules are organic molecules with molecular weight less than 2000 Da; the small molecules comprise small molecules to be detected in therapeutic drugs, hormones, drugs, agricultural and veterinary drugs and living metabolites.
The small molecules comprise clinical treatment small molecule drugs such as cyclosporine, tacrolimus, carbamazepine, theophylline and the like. Preferably, the small molecule comprises biotin.
Preferably, Cas proteins include Cas12a, Cas13, Cas14 and other Cas series proteins.
Further, the invention provides a quantitative detection method of PCDA vesicle-associated CRISPR, which comprises the following steps:
(1) calculating the reaction speed of the standard substance with different concentrations to draw a standard curve
Through an automatic sample adding instrument, firstly adding a standard substance, then adding an R1 reagent, and finally adding an R2 reagent, measuring fluorescence values at different time points, calculating the reaction rates of the standard substances with different concentrations, and drawing a standard curve;
in the actual operation process, the proportion of the R1 reagent and the R2 reagent needs to be continuously adjusted to obtain a more ideal reaction standard curve.
(2) Calculating the concentration of the analyte in the sample system
And (2) sequentially adding the liquid sample, the R1 reagent and the R2 reagent into the automatic sample adding instrument according to the sequence of the step (1), and obtaining the concentration value of the substance to be detected in the sample according to the reaction rate value of the sample and the relational expression between the reaction rate and the concentration of the standard substance in the standard curve.
In a preferred embodiment, the R1 comprises a target nucleic acid; the R2 comprises target DNA, bin buffer, Cas protein-sgRNA complex and PCDA vesicle, and the R2 is a buffer system; the Cas protein-sgRNA complex and the PCDA vesicle may be added sequentially or simultaneously.
In another preferred embodiment, said R1 comprises biotin; the R2 comprises target DNA, bin buffer, Cas protein-sgRNA complex and PCDA vesicle, and the R2 is a buffer system; the Cas protein-sgRNA complex and the PCDA vesicle can be added sequentially or simultaneously; preferably, the Cas protein-sgRNA complex and PCDA vesicle are added sequentially to the R1 solution.
The system of the Cas protein-sgRNA complex is as follows:
50mM NaCl，10mM Tris-HCl，10mM MgCl2，100μg/ml BSA，pH 7.9(25℃)。
furthermore, the invention provides a qualitative detection method for PCDA vesicle-associated CRISPR, which comprises the following steps:
(1) preparing a target detection object and preparing an R1 solution;
(2) a solution R2 was added to the reaction mixture to carry out a color reaction, and whether or not the analyte contained the target substance was judged.
Furthermore, the invention also provides a rapid detection test strip for the combination of the PCDA vesicles and the CRISPR, the test strip coats a detection reagent R2 of a target substance to be detected, and the R2 comprises target DNA, a Cas protein-sgRNA complex and the PCDA vesicles.
Still further, the present invention provides the use of the method and system in assays for food, drug or enzyme activity.
Advantageous effects
The detection method of the invention has the following advantages: (1) the test does not need special instruments, and the qualitative measurement can be only visible by naked eyes; (2) the operation is simple and rapid, heterogeneous testing is realized, and enzyme labeling and separation are not needed; (3) the method has the advantages of sensitivity, accurate result, simple sample treatment and low detection cost. Specifically, compared with the traditional enzyme-linked immunoassay method, HPLC and HPLC-MS methods, the visual detection method provided by the invention is simple and rapid to operate, accurate in detection result, high in sensitivity, convenient and rapid in probe synthesis and low in cost; the method has good prospect for clinical large-area popularization and application in the future, especially for small and medium hospitals lacking expensive instruments; and is suitable for measuring the activity of food, drugs and enzyme.
Drawings
FIG. 1 shows a schematic representation of the use of PCDA vesicles, the circles in the figure indicating vesicles;
FIG. 2 shows fluorescence scan spectra corresponding to biotin samples of the present invention;
FIG. 3 is a graph showing a standard curve of biotin in accordance with the present invention.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
Buffers used in the present invention:
1X bing buffer：
Tris-HCL 20mM，KCL 100mM，MgCL250mM, DTT 1mM, glycerol 5%, heparin 50. mu.g/ML.
1X buffer Cas protein-sgRNA complex:
50mM NaCl，
10mM Tris-HCl，
10mM MgCl2，
100μg/ml BSA，
pH 7.9(25℃)。
example (b): rapid detection of small molecules of PCDA vesicle combined CRISPR
The biotin sample sigma-Aldrich was diluted with a 1Xbuffer gradient to make up biotin solutions at concentrations of 0,0.5,5,10,20,40,90, 170. mu.g/ml.
Preparation of frozen plates
1. Salmon sperm DNA 200. mu.l (concentration 1mg/ml) was added to a 96-well black plate, incubated at 37 ℃ for 2 hours, and then washed 3 times with 200. mu.l of deionized water.
2. Preparing a Cas protein-sgRNA complex: cas12a 50nM, sgRNA62.5nM in 1Xbuffer was incubated for 0.5 h at 37 ℃ followed by 50ul per well in 96-well plates, frozen for 2 h at-20 ℃ and then stored freeze-dried at 4 ℃. The base sequence of the sgRNA is shown in SEQ ID No. 1.
3. When in use, 50ul of deionized water is added into each hole, redissolved and incubated and shaken at 37 ℃ for 0.5 hour.
4.1 preparation of Biotin-modified DNA probes: and (4) adopting a customized synthesis mode to carry out raw customization.
4.2 preparation of R1 solution: 10ul of each diluted biotin solution sample and a biotin-modified DNA probe form a mixed solution, wherein the base sequence of the DNA probe is shown as SEQ ID No.2 and SEQ ID No.3, the concentration of the small molecule-modified DNA probe is 100pM, and the volume of the mixed solution is 25 ul. TS: GTGTCAAAAATGGGACTTATGACTACCCAAAA/biotinT/ACTCAGA (biotin-modified Bidding blue) SEQ ID No.2
NTS：TCTGAGTATTTTGGGTAGTCATAAGTCCCATTTTTGACAC SEQ ID No.3
Streptavidin-coupled Dynabeads, zermer fly ltd (Thermo), were used diluted 10-fold with 1 Xbuffer.
Streptavidin-coupled Dynabeads solution 50ul was added to the above mixed solution to form R1 solution of biotin, incubated for 30 minutes, and then magnetically separated.
4.3 preparation of R2 solution: the R2 solution contained Cas protein-sgRNA complex solution (625nM), PCDA vesicles (500nM) in 1Xbing buffer solution 100 ul.
4.4 add 10ul of the biotin solution in R1 to the Cas protein-sgRNA complex solution in R2 solution, incubate and shake for 0.5 h at 37 ℃, and then add PCDA vesicle solution to carry out color reaction.
5. Fluorescence scanning detects the absorption peak of the 4.4 mixed solution,
as a result: the fluorescence scanning spectrum corresponding to the biotin sample is shown in figure 2, and the result proves that the method can accurately quantify the content of biotin. Plotting a standard curve according to the concentration value and the fluorescence value, as shown in FIG. 3, the linear range of the fluorescence standard curve is 0.5-180. mu.g mL-1Degree of correlation (R)2＝0.99)。
6. Compared with the HPLC-MS method, the biotin quantitative detection method is operated according to the conventional method. The results are shown in Table 1.
Addition amount (μ g mL)-1) The method detects HPLC-MS
5 5.05 5.03
10 10.8 10.5
90 93 91.5
The invention has the following quantitative detection: quantitative detection can be achieved by means of UV and fluorescence detection, as described above.
The invention has the following qualitative detection: the qualitative determination of the invention is only visible by naked eyes, the conversion from blue to red indicates that the target substance exists, and the substance detected in the embodiment is biotin.
In addition, test paper strips can be made at a later stage for rapid detection.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Beijing collaboration of China medical science institute and Beijing electronics technology and occupational institute of Hospital
Rapid detection system and method for combining PCDA (Poly-paraphenylalanine diphosphate synthase) vesicle with CRISPR (clustered regularly interspaced short palindromic repeats)
<130>p190364
<141>2020-01-17
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>35
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
uaauuucuac uaaguguaga ugggagcaaa gccca 35
<210>2
<211>32
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>2
gtgtcaaaaa tgggacttat gactacccaa aa 32
<210>3
<211>40
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>3
tctgagtatt ttgggtagtc ataagtccca tttttgacac 40

Claims (10)

1. A rapid detection system for PCDA vesicle-associated CRISPR, comprising reagents R1 and R2 for detecting a substance of interest, wherein R1 comprises the substance to be detected or a cognate group of the substance, and wherein R2 comprises a target DNA, a Cas protein-sgRNA complex and a PCDA vesicle.
2. The rapid detection system of claim 1, wherein R1 comprises a buffer system of a target nucleic acid or a small molecule-specific antibody and a small molecule-specific recognition group.
3. The rapid detection system according to claim 2, wherein the system is characterized in that the qualitative analysis of the small molecules is realized by the principle that free small molecules in a liquid system compete with small molecule probes coupled on specific recognition groups of the small molecules for binding sites of specific antibodies, and the vesicle probes are inhibited from changing from blue to red.
4. The rapid detection system according to claim 2, wherein the small molecule specific recognition group is a small molecule modified DNA/RNA probe comprising a nucleic acid sequence for recognition of a corresponding PAM sequence by the Cas protein.
5. The rapid detection system of claim 2, wherein the small molecules are organic molecules having a molecular weight of less than 2000 Da; the small molecules comprise small molecules to be detected in therapeutic drugs, hormones, drugs, agricultural and veterinary drugs and living metabolites.
6. A quantitative detection method for PCDA vesicle combination CRISPR comprises the following steps:
(1) calculating the reaction speed of the standard substance with different concentrations to draw a standard curve
Through an automatic sample adding instrument, firstly adding a standard substance, then adding an R1 reagent, and finally adding an R2 reagent, measuring fluorescence values at different time points, calculating the reaction rates of the standard substances with different concentrations, and drawing a standard curve;
(2) calculating the concentration of the analyte in the sample system
And (2) sequentially adding the liquid sample, the R1 reagent and the R2 reagent into the automatic sample adding instrument according to the sequence of the step (1), and obtaining the concentration value of the substance to be detected in the sample according to the reaction rate value of the sample and the relational expression between the reaction rate and the concentration of the standard substance in the standard curve.
7. The rapid detection method according to claim 6, wherein R1 comprises a target nucleic acid; the R2 comprises target DNA, bin buffer, Cas protein-sgRNA complex and PCDA vesicle, and the R2 is a buffer system; the Cas protein-sgRNA complex and the PCDA vesicle may be added sequentially or simultaneously.
8. The rapid detection method of claim 6, wherein R1 comprises biotin; the R2 comprises target DNA, bin buffer, Cas protein-sgRNA complex and PCDA vesicle, and the R2 is a buffer system; the Cas protein-sgRNA complex and PCDA vesicles were added sequentially to the R1 solution.
9. A qualitative detection method for PCDA vesicle combination CRISPR comprises the following steps:
(1) preparing a target detection object and preparing an R1 solution;
(2) a solution R2 was added to the reaction mixture to carry out a color reaction, and whether or not the analyte contained the target substance was judged.
10. The test strip for rapid detection of the PCDA vesicle-bound CRISPR is characterized in that the test strip coats a detection reagent R2 of a target substance to be detected, and R2 comprises a target DNA, a Cas protein-sgRNA complex and a PCDA vesicle.
CN202010054825.7A 2020-01-17 2020-01-17 Rapid detection system and method for combination of PCDA (Poly carbonate-co-polymerase chain reaction) vesicles and CRISPR (clustered regularly interspaced short palindromic repeats) Pending CN111304294A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010054825.7A CN111304294A (en) 2020-01-17 2020-01-17 Rapid detection system and method for combination of PCDA (Poly carbonate-co-polymerase chain reaction) vesicles and CRISPR (clustered regularly interspaced short palindromic repeats)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010054825.7A CN111304294A (en) 2020-01-17 2020-01-17 Rapid detection system and method for combination of PCDA (Poly carbonate-co-polymerase chain reaction) vesicles and CRISPR (clustered regularly interspaced short palindromic repeats)

Publications (1)

Publication Number Publication Date
CN111304294A true CN111304294A (en) 2020-06-19

Family

ID=71152882

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010054825.7A Pending CN111304294A (en) 2020-01-17 2020-01-17 Rapid detection system and method for combination of PCDA (Poly carbonate-co-polymerase chain reaction) vesicles and CRISPR (clustered regularly interspaced short palindromic repeats)

Country Status (1)

Country Link
CN (1) CN111304294A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107488710A (en) * 2017-07-14 2017-12-19 上海吐露港生物科技有限公司 A kind of purposes of Cas albumen and the detection method and kit of target nucleic acids molecule
CN108195828A (en) * 2016-12-08 2018-06-22 南开大学 A kind of non-marked homogeneously detects the colorimetric method of sodium benzoate

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108195828A (en) * 2016-12-08 2018-06-22 南开大学 A kind of non-marked homogeneously detects the colorimetric method of sodium benzoate
CN107488710A (en) * 2017-07-14 2017-12-19 上海吐露港生物科技有限公司 A kind of purposes of Cas albumen and the detection method and kit of target nucleic acids molecule

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHUNGANG WANG ET AL.: "Colorimetric detection of oligonucleotides using a polydiacetylene vesicle sensor", 《ANALYTICAL AND BIOANALYTICAL CHEMISTRY》 *
胡孝林 等: "基于CRISPR/Cas系统的生物传感策略研究进展", 《生物技术通报》 *
邓洁丽 等: "联乙炔囊泡——一种基于分子组装的生物分子识别器件", 《化学进展》 *

Similar Documents

Publication Publication Date Title
CN111593145B (en) CRISPR/Cas12 one-step nucleic acid detection method and novel coronavirus detection kit
Palaz et al. CRISPR-based tools: Alternative methods for the diagnosis of COVID-19
Xie et al. Advancing sensing technology with CRISPR: From the detection of nucleic acids to a broad range of analytes–a review
JP2021129581A (en) Detection of nucleic acids
CN108486234A (en) A kind of method and its application of CRISPR partings PCR
CN111187804A (en) Rapid detection kit and detection method for mycoplasma pneumoniae nucleic acid based on CRISPR/Cas12a
US20200370100A1 (en) Fluorescent nucleic acid nanostructure-graphene biosensor for nucleic acid detection
Li et al. CRISPR-Cas-mediated diagnostics
CN105018590A (en) Detection kit capable of simultaneous detection of protein ligand and genes and application thereof
Zhou et al. CRISPR/Cas13a combined with hybridization chain reaction for visual detection of influenza A (H1N1) virus
Li et al. A simple and rapid method to assay SARS-CoV-2 RNA based on a primer exchange reaction
CN114395636A (en) Mycoplasma hominis detection system based on RPA-CRISPR/Cas12a and application thereof
CN111826467B (en) Compositions, test tube devices and methods for rapid detection of novel coronavirus nucleic acids
CN107988318B (en) Method for rapidly detecting nucleic acid based on electrochemical potential pretreatment technology and application
Wang et al. Next-generation CRISPR-based diagnostic tools for human diseases
Padmanaban et al. CRISPR–Cas system and its use in the diagnosis of infectious diseases
CN116479150A (en) Single tube one-step method for rapidly detecting methicillin-resistant staphylococcus aureus by RPA-Cas12a/Cas13a
CN116356079A (en) RPA-CRISPR-Cas12a based visual detection kit for detecting Gaota virus and application
CN116445594A (en) Sequencing method suitable for in-situ detection of continuous multiple nucleotide sites and application thereof
CN111007240A (en) Homogeneous enzyme immunoassay system based on CRISPR technology and method and application thereof
CN111304294A (en) Rapid detection system and method for combination of PCDA (Poly carbonate-co-polymerase chain reaction) vesicles and CRISPR (clustered regularly interspaced short palindromic repeats)
KR20230016230A (en) Kit for detecting target materials and method for detecting target materials using the same
CN108384786B (en) Detection method of aptamer binding protein
CN111979295B (en) Tyrosine phosphatase biosensor and detection method and application thereof
Shen et al. Progress in recombinant polymerase nucleic acid amplification technology

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20200619

WD01 Invention patent application deemed withdrawn after publication