CN111286531A - Application of circulating nucleic acid as marker of hypertension, diabetes and hyperlipidemia - Google Patents

Abstract

The invention relates to the use of circulating nucleic acids as markers for hypertension, diabetes and hyperlipidemia. The invention identifies a group of miRNA marker molecules aiming at atherosclerosis related diseases by establishing a specific system screening and stable detection method for serum circulating miRNA of a coronary heart disease patient; the invention further discovers the important contribution of the circulating miRNA in the prediction of atherosclerosis related diseases through case control research and prospective population research. The research result provides important theoretical and methodological basis for the clinical application of the circulating miRNA.

Description

Application of circulating nucleic acid as marker of hypertension, diabetes and hyperlipidemia

Technical Field

The invention relates to the use of circulating nucleic acids as markers for hypertension, diabetes and hyperlipidemia. In particular, the invention relates to the application of circulating microRNA (miRNA) in the prediction of hypertension, diabetes and hyperlipidemia; more specifically, the invention relates to application of miR-10a-5p in hypertension, diabetes and hyperlipidemia prediction, which comprises the steps of preparing a kit for hypertension, diabetes and hyperlipidemia prediction based on miR-10a-5p, preparing a microarray for hypertension, diabetes and hyperlipidemia prediction, and using the kit and the microarray for hypertension, diabetes and hyperlipidemia prediction.

Background

Atherosclerosis is a chronic inflammatory vascular disease whose mechanism is not yet clear, and its mechanism of occurrence has been widely focused and studied. Typically, blood vessels are composed of an adventitial layer, a media layer, and an intimal layer. The intima layer is composed of the innermost endothelial cells of the blood vessel and the internal elastic lamina. Vascular endothelial cell damage and dysfunction are generally considered to be the initiating factors of atherosclerosis. The vascular endothelium not only protects the integrity of the vascular structure, but also is a receptor and a reactor of the blood vessel for various external injury stimulation signals, and has a vital effect on maintaining the vascular homeostasis. The vascular endothelial cells are activated under the stimulation of a plurality of risk factors such as ischemia, hypoxia, high sugar, high fat, smoking and the like, and start the generation of atherosclerosis and participate in the whole process. Atherosclerosis-related disease events include hypertension, diabetes, hyperlipidemia, etc., and current research has established that hypertension, diabetes, and hyperlipidemia are the main risk factors for coronary atherosclerotic heart disease (also known as coronary heart disease).

According to the WHO statistics of the world health organization, about 876 million people die of coronary heart disease in 2015 globally, accounting for 15.5 percent of the total death number, and living the first cause of death worldwide (WHO 2017 updates data in 1 month). In fact, coronary heart disease has been stable at the first of ten causes of death worldwide between 2000 and 2015. Coronary heart disease is the first killer threatening the life and health of residents in developed countries and developing countries. In china, the mortality rate of coronary heart disease has risen year by year in recent years. According to statistics of 'annual book of Chinese hygiene and birth control statistics in 2017', the death rate of coronary heart disease of urban residents in 2016 in China is 113.46/10 ten thousand, and the prevalence rate of men (116.73/10 ten thousand) is higher than that of women (110.09/10 ten thousand) on the whole. Coronary heart disease seriously threatens the life health of people in China.

In consideration of the serious threat of coronary heart disease, the exploration and research of new coronary heart disease markers and risk prediction factors are of great significance. In particular, if a high risk group (e.g., a patient with hypertension, diabetes, and hyperlipidemia or a group at risk of developing hypertension, diabetes, and hyperlipidemia) can be identified early through risk prediction and intervened early, it is expected to become a key to prevent the occurrence of a serious cardiovascular event. In this regard, the currently known markers and risk predictors do not sufficiently satisfy this need, and therefore there is a need to screen out new markers and risk predictors that can be used to predict atherosclerosis-related diseases. The ideal marker needs to meet the following requirements: 1) can be obtained in a way without damaging the body; 2) high sensitivity and accuracy to target diseases; 3) the ability to detect early in the disease; 4) sensitive response to disease-related changes; 5) a longer half-life in the sample; 6) can be detected quickly and accurately.

In this regard, circulating mirnas in body fluids have the following advantages over traditional marker molecules: 1) and (3) more stable: the circulating miRNA has good stability in blood plasma and blood serum, and the content of the circulating miRNA still keeps relatively stable after being treated under various extreme conditions such as boiling, repeated freeze thawing, strong acid, strong base, DNase, RNase and the like; 2) more sensitive: researches find that some miRNA changes in early stage of diseases and can indicate the occurrence of the diseases, and the development of nucleic acid in-vitro amplification technology enables the detection of low-abundance molecules to be possible; 3) more specifically: the miRNA has the specificity of tissue expression and pathological process, different diseases have respective specific circulating miRNA expression profiles, and sequence specificity amplification based on base pairing avoids technical false positive; 4) more convenient: compared with the detection of protein markers which need to screen and prepare specific antibodies, miRNA can be directly detected.

It has been found that some tissue-specific mirnas are involved in the regulation of cholesterol, lipids, carbohydrates, etc. in vivo. Therefore, in recent years, some experts and scholars have focused attention on miRNA as a marker for prediction of atherosclerosis-related diseases (such as hypertension, diabetes and hyperlipidemia). The research has found that some miRNA has a certain effect on the prediction of coronary heart disease and other vascular diseases through the tracking investigation of people. For example, studies have suggested that miR-652 may be a predictor of acute coronary syndrome events. On the one hand, however, most of the current miRNA studies are directly validated in human experiments with mirnas reported in the literature as candidate molecules, this strategy limits the discovery of new miRNA markers, and these lack of systematic screening studies lack potency comparison between miRNA markers. On the other hand, the sample size in the current marker research generally stays in dozens of cases, some cases even only aim at dozens of small sample populations, and large-scale population samples lacking long-term follow-up are also important reasons for poor consistency of results discovered by different platforms, so that the prediction research result of miRNA is not accurate enough and the clinical prospect is limited. In addition, most of the current studies on circulating miRNA as a marker of atherosclerosis-related diseases focus on circulating miRNA as a diagnostic marker, and the studies on circulating miRNA as a predictive marker in the general population are very deficient.

Disclosure of Invention

In order to solve the problems, the invention firstly collects the serum and peripheral blood mononuclear cells of coronary heart disease patients and healthy control groups respectively, extracts total RNA and carries out small RNA sequencing. And finally, preliminarily screening 48 disease-specific candidate circulating miRNAs based on miRNA difference change, serum abundance and other parameters. Then, the screening of detection methods such as stability, repeatability and the like of the miRNAs is completed through real-time quantitative PCR and sequencing, and 5 candidate circulating miRNAs capable of being stably detected are obtained. Then, serum levels of 5 candidate circulating mirnas were detected in a northern population comprising 39 coronary heart disease patients and 39 healthy people, and a significant difference in serum levels of 4 mirnas in coronary heart disease patients was found (p <0.05), wherein the level of miR-10a-5p was down-regulated by up to 90%; meanwhile, the AUC area of the curve of the miR-10a-5p in the subject reaches 0.817, and the coronary heart disease diagnosis efficiency is extremely high. Further, in order to discuss the prediction effect of the candidate miRNA molecule miR-10a-5p related to vascular inflammation on atherosclerosis related diseases in the population, the invention utilizes questionnaires and physical examination related data and serum samples of 5984 average follow-up general populations in 12 areas collected by the hospital for Fuwei cardiovascular disease of Chinese medical academy in 2010-2017, detects the baseline miRNA levels of 2838 baseline serum in 4 northern areas, collects new events including hypertension, diabetes and hyperlipidemia, constructs a prospective nested case control research queue, and confirms that miR-10a-5p has obvious improvement on the prediction of hypertension, diabetes and hyperlipidemia through single-factor and multi-factor combined logistic analysis. Thus, the present invention has been completed.

According to a first aspect of the present invention, the present invention provides a kit for the prediction of hypertension, diabetes and hyperlipidemia, characterized in that the kit comprises a circulating nucleic acid detection reagent, wherein the circulating nucleic acid comprises circulating miR-10a-5 p.

According to a second aspect of the invention, the invention provides the use of a circulating nucleic acid detection reagent for the preparation of a kit for the prediction of hypertension, diabetes and hyperlipidemia, wherein the circulating nucleic acid comprises circulating miR-10a-5 p.

According to a third aspect of the present invention, there is provided a microarray for the prediction of hypertension, diabetes and hyperlipidemia, comprising a circulating nucleic acid detection probe, wherein the circulating nucleic acid comprises circulating miR-10a-5 p.

According to a fourth aspect of the invention, the invention provides the use of a circulating nucleic acid detection probe in the preparation of a microarray for the prediction of hypertension, diabetes and hyperlipidemia, wherein the circulating nucleic acid comprises circulating miR-10a-5 p.

According to a fifth aspect of the invention, there is provided the use of a circulating nucleic acid for predicting hypertension, diabetes and hyperlipidemia, wherein the circulating nucleic acid comprises circulating miR-10a-5 p.

According to a sixth aspect of the present invention, there is provided a method for predicting hypertension, diabetes and hyperlipidemia, comprising the step of detecting circulating nucleic acids in a body fluid, wherein the circulating nucleic acids comprise circulating miR-10a-5 p.

Preferably, in the first to sixth aspects of the invention, the circulating nucleic acid further comprises one or more of miR-126-3p, miR-210-3p, miR-423-3p and miR-92a-3 p.

Preferably, in the first aspect through the sixth aspect of the present invention, the circulating nucleic acid is derived from a body fluid; more preferably, the body fluid is serum or plasma.

Preferably, in the first to sixth aspects of the invention, hypertension, diabetes and hyperlipidemia are predicted in a population over 35 years old, including but not limited to a population over 35 years old, over 40 years old, over 45 years old, over 50 years old, over 55 years old, over 60 years old, over 65 years old, over 70 years old. Preferably, in the first to sixth aspects of the invention, hypertension, diabetes and hyperlipidemia are predicted in a population under 75 years of age, including but not limited to, hypertension, diabetes and hyperlipidemia in a population under 75 years of age, under 70 years of age, under 65 years of age, under 60 years of age, under 55 years of age, under 50 years of age, under 45 years of age, under 40 years of age. Preferably, hypertension, diabetes and hyperlipidemia may be predicted in a population within any age range defined by the above upper and lower age limits or within any age range therebetween.

Preferably, in the first to sixth aspects of the invention, the kits and microarrays of the invention further comprise reagents for detecting an internal reference, more preferably, the internal reference is a small nuclear RNA RNU6 (U6); the methods and uses of the invention further comprise detecting an internal reference, preferably the internal reference is nuclear small RNA RNU6 (U6).

Preferably, in the first to sixth aspects of the invention, the kit of the invention comprises a circulating nucleic acid detection primer, the sequence of which is shown in any one of SEQ ID No.6 to SEQ ID No. 16; the microarray of the invention comprises a circulating nucleic acid detection probe, wherein the sequence of the circulating nucleic acid detection probe is shown as any one of SEQ ID NO. 6-SEQ ID NO. 16; the method and the application comprise the step of detecting the circulating nucleic acid by utilizing a circulating nucleic acid detection primer and/or a circulating nucleic acid detection probe, wherein the sequence of the circulating nucleic acid detection primer and/or the circulating nucleic acid detection probe is shown as any one of SEQ ID NO. 6-SEQ ID NO. 16. Advantageous effects

In conclusion, the invention identifies a group of candidate circulating miRNA markers by screening a specificity system of serum circulating miRNA of a coronary heart disease patient and establishing a stable detection method. Furthermore, the invention discovers the important contribution of miR-10a-5p in the prediction of atherosclerosis related diseases (particularly hypertension, diabetes and hyperlipidemia) through case control research and prospective population research. Considering that early identification of high risk group and early intervention by risk prediction are the key to preventing serious cardiovascular disease events, the marker and risk prediction factor circulation miR-10a-5p identified by the invention provide an effective and reliable means for preventing and treating atherosclerosis related diseases such as hypertension, diabetes, hyperlipidemia and the like.

Drawings

Figure 1 shows the results of stability detection experiments for candidate mirnas and internal reference U6. (A) The same sample is subjected to three times of repeated experiment results; (B) and (5) performing stability experiments among different samples. T1-T3 are three replicates of the same sample, and S1-S5 are five different serum samples.

FIG. 2 shows the content change of miR-10a-5p in the serum of a coronary heart disease patient and the analysis of coronary heart disease diagnostic efficacy. (A) A miRNA population verification box type graph; (B) ROC curve chart of miR-10a-5p for diagnosing coronary heart disease. Where CAD indicates coronary patients and HC indicates healthy controls.

FIG. 3 shows the content variation of miR-10a-5p in PBMCs of patients with coronary heart disease. Where CAD indicates coronary patients and HC indicates healthy controls.

FIG. 4 shows the expression changes of miR-10a-5p and positive controls IL-6 and IL-8 under stimulation of endothelial cell TNF α, (A) the expression changes of the positive controls IL-6 and IL-8 over time, and (B) the expression changes of miR-10a-5p over time.

Detailed Description

1. Extraction of circulating miRNAs

Compared with miRNA in tissues or cells, the content of circulating miRNA in body fluid is much lower, meanwhile, the miRNA is only 22-25nt, small segments are not easy to enrich in the extraction process, and the circulating miRNA exists in a form of being combined with protein or vesicles, so that great difficulty is brought to extraction and purification of the circulating miRNA.

The extraction of circulating miRNA mainly adopts a reagent for liquid extraction and a kit based on an adsorption column. The reagents are commonly used

And

LS Reagent (Invitrogen), after combining serum or plasma with Reagent, removing protein and other factors which may affect subsequent reaction by phenol/chloroform extraction, and then carrying out ethanol precipitation, but different methods have differences in the process, and miRNA is lost to different degrees.

Another extraction method is mainly based on column binding kit, and is commonly used

mirNasosation kit (Ambion), mirVana PARIS kit (Ambion) and

miRNA kit (QIAGEN). These kits are mainly designed to differentiate the sizes of RNAs by mixing them with alcohols of different concentrations and using the difference in affinity between the RNAs and a silica or glass fiber column, and usually, the sizes of the RNAs are 200nt or lessIs enriched. Compared with

The reagent means, the kit has certain advantages, mainly the relatively small amount of the sample required at the beginning.

2. Detection of circulating mirnas

The strategy for the study of circulating mirnas as disease markers is generally divided into two steps: (1) discovery processes based on high-throughput or multigene screening; (2) the results were verified by the qRT-PCR method.

The high-throughput screening method mainly comprises miRNA microarray, deep sequencing and qRT-PCRarray. Each of these three approaches has its advantages and disadvantages. miRNA microarray is a microarray of a large number of DNA sequences immobilized on a solid substrate, and is analyzed by fluorescent signals of probes hybridized to target sequences. However, because the sequence of the miRNA is short and the similarity of the miRNA sequences of the same family is high, the false positive rate of the miRNA microarray for expression profiling analysis is high. deep sequencing can solve the problems of short miRNA sequence and high homology, and can research and discover the polymorphism of miRNA and unknown miRNA, but deep sequencing requires a large amount of RNA, a large amount of body fluid is required for RNA extraction, and meanwhile deep sequencing costs a lot, which can limit the incorporation of multiple samples in the discovery period. In many studies, sequencing is performed by mixing a fluid sample, but this method may make some miRNA differences difficult to detect, and the method requires complicated data analysis and is time-consuming. miRNA qRT-pcraray is the shortest time consuming of the three methods, which is analyzed by qRT-PCR on 754 known mirnas in two 384 well plates. However, because of the low abundance of circulating mirnas, pre-amplification is usually performed before qRT-PCR array, which may cause some mirnas to be supersaturated in the detection and introduce bias. Meanwhile, the method of qRT-PCR array needs a proper internal reference for correction, but no proper unified internal reference is found in the current research of circulating miRNA.

The validation phase of circulating miRNA studies is typically performed by fluorescent quantitative-reverse transcription PCR (qRT-PCR). Because of the short sequence of miRNA, this is the detectionOne difficulty of this is that there are two main strategies, one of which is to use Stem-loop primers (Stem-loop primers) in reverse transcription to obtain sequence-extended cDNA; another strategy is to first extend the poly (A) tail of miRNA and then reverse transcribe the extended RNA using oligo dT. There are different ways to detect miRNA after obtaining cDNA. Mainly comprises a Taqman probe method based on sequence specificity, an LNA probe and a non-specific probe

Green dye method. The sensitivity of the Taqman probe and LNA probe methods is high, but the cost is high;

the Green dye method has relatively low sensitivity, but low cost, and is convenient for large-scale verification and analysis.

3. Internal reference selection for circulating mirnas

In the research of circulating miRNA, the relative quantification is almost carried out by adopting qRT-PCR in the verification stage, and the proper internal reference selection is crucial to the analysis of data, but at present, no housekeeping gene in serum or plasma can be used as a stable internal reference, and the discovery and selection can refer to the research method of tissue and cell level, and the following methods are mainly adopted:

(1) genes reported in literature are selected as internal references, mainly miR-16 and nuclear small RNARNU6(U6), RNU44 and RNU 48. Although the above genes are widely used as internal references, there are some studies that find that their levels vary under different physiological or pathological conditions. And the other is that exogenous miRNA is added as internal reference in the extraction process, such as nematodes miRNAcel-miR-39, cel-miR-54 and cel-miR-328, so that the extraction efficiency can be detected.

(2) Screening the gene with stable expression as internal reference. The main analytical methods are geNorm and NormFinder. GeNorm is the ratio of one gene to the other, assuming that the mean of the standard deviations of all ratios is defined as the M value, and the two genes with the smallest M value are combined to the final reference, see Vandersampele, J., et al, Accurate normalization of real-time quantitative RT-PCR data byggetric averaging of multiple internal control genes, Genome Biol,3(7), RESEARCH0034 (2002). NormFinder is the assessment of the stability of genes (Standard definition, SD), see the literature Andersen, C.L., J.L.Jensen, and T.F.Orntoft, Normalization of real-time quantitative transcription-PCR data a model-based variable evaluation approach to identification genes Suitd for Normalization, applied handblader and color scanner data, Cancer Res,64, 5245-5250 (2004).

(3) The mean value of all gene expressions was used as an internal control. This approach presupposes that the RNA addition is the same for different samples.

In the context of the present invention, it is preferred to use RNU6(RNA, U6small nuclear RNA) as an internal reference for the calibration of miRNA levels, considering that studies have shown that in some cardiovascular diseases (e.g. peripheral arterial obstruction, heart failure, etc.) miR-16 is differentially expressed in patients and healthy persons, and studies have shown that miR-17 levels are elevated in stroke patients. In addition, some studies use mirnas with unchanged expression abundance in experimental groups and control groups as internal references based on high-throughput sequencing data, but the method has certain risks due to limited sample amount of early high-throughput sequencing and errors possibly caused by sequencing. Before the actual experiment operation, the stability of the selected internal reference needs to be verified through a population sample with a certain scale.

4. Kits and microarrays of the invention

The kit and the microarray are used for detecting circulating nucleic acid, and the circulating nucleic acid comprises circulating miR-10a-5 p. One skilled in the art can select appropriate controls (such as but not limited to miR-126-3p, miR-210-3p, miR-423-3p and miR-92a-3p) or internal controls (such as but not limited to nuclear small RNA RNU6) as needed for detection with circulating miR-10a-5 p.

Without limitation, a circulating nucleic acid detecting primer or a circulating nucleic acid detecting probe may be used to prepare the kit or microarray of the present invention, for example, one skilled in the art may prepare the kit or microarray of the present invention based on the sequences shown in tables 2 and 3, but the present invention is not limited thereto. Specifically, one skilled in the art can appropriately design and synthesize miRNA-specific stem-loop primers (such as, but not limited to, miRNA-specific stem-loop primers shown in table 2) used in the reverse transcription process, based on known miRNA sequences; likewise, miRNA-specific detection primers used in PCR processes (such as, but not limited to, the miRNA-specific detection primers shown in table 3) can also be appropriately designed and synthesized by those skilled in the art based on known miRNA sequences.

In addition, the kit of the present invention may further comprise a DNA purification reagent (e.g., Nucleon)^TMKit, lysis buffer, protease solution, etc.); PCR reagents (e.g., reaction buffer, thermostable polymerase, dNTPs, etc.), but the present invention is not limited thereto. Probes for detecting circulating nucleic acids can be labeled with different detectable means. Such detectable means refer to compounds, biomolecules or biomimetic materials that can be conjugated, linked or attached to the probes to provide quantifiable indices (e.g., density, concentration, quantity, etc.). Examples of detectable means include fluorescent labels, luminescent materials, bioluminescent materials and radioisotopes, but the invention is not limited thereto. Details and choices of detectable tools will be apparent to those skilled in the art.

In a particularly preferred embodiment of the invention, circulating mirnas in serum are quantitatively detected as follows:

performing fluorescent quantitative PCR on a cDNA template obtained by reverse transcription of circulating miRNA,

the reaction system is as follows: 2.5. mu.l Hotmaster Taq enzyme buffer (Tiangen), 20. mu.M Forward primer (Ruibo), 0.25. mu.l Hotmaster Taq enzyme (2.5U/. mu.l Tiangen), 1. mu.l Hotmaster Taq enzyme buffer (Tiangen)

Green I (Invitrogen), 2.5. mu.lcDNA, plus RNase-free purified water to a 25. mu.l system;

the reaction conditions are as follows: preheating at 95 ℃ for 10 min; denaturation at 95 ℃ for 15s, annealing and extension at 60 ℃ for 60s, and carrying out 40 cycles, and collecting the dissolution curve after the reaction is finished.

Examples

The present invention will be described in further detail with reference to examples, but the present invention is not limited to these examples.

Research population and ethical declaration

(1) Coronary heart disease and healthy population for case contrast study

The coronary heart disease population used in this study was hospitalized from cooperative hospitals in northern areas of china, 39 from affiliated hospitals of the university of jining medical, shandong province, and 30 from affiliated hospitals of Yanghui, Jilin province, respectively. Coronary heart disease is defined according to the following criteria: patients with myocardial infarction; PCI (percutaneous coronary intervention) or CABG (coronary artery bypass graft); angiograms of at least one major coronary artery show a 60% diameter stenosis. The blood pressure was measured with a standard mercury sphygmomanometer, 1 measurement was performed every 5 minutes, 3 blood pressure measurements were performed, and the average of the 3 readings was calculated as the final value of the blood pressure (systolic and diastolic). Hypertension is defined as patients undergoing treatment for reduced pressure, or systolic and diastolic blood pressures greater than or equal to 140 and/or 90mmHg as demonstrated in three different day tests. Diabetes is determined according to the diagnostic criteria of the American diabetes Association (administration of hypoglycemic agents, or fasting blood glucose levels of 7mmol/L or more or less than 11.1mmol/L or 2h post-prandial blood glucose levels). Hyperlipidemia is defined as being treated or as low density lipoprotein cholesterol ≥ 130mg/dl or total cholesterol ≥ 200 mg/dl. Smoking no smoking and smoking grouping are based on self-reporting. Body Mass Index (BMI) is calculated according to the formula: weight (kg)/height squared (m)²). The 61 healthy control groups were from the physical population of the department of medical university affiliated xuanwu hospital physical examination center of capital medical university and the department of Yanbian university affiliated of Yanji City of Jilin province, who had physical examination follow-up information for at least 6 years and simultaneously satisfied the following conditions: CAD has no family history; no clinical CAD symptoms (angina pectoris, chest distress, shortness of breath); the resting Electrocardiogram (EKG) is normal in morphology. Patients with stroke, peripheral vascular disease and kidney disease were excluded.

The sample collection was approved by the local hospital ethics committee and all panelists signed informed consent.

(2) General follow-up large sample population for prospective studies

Collected in 2009-2010 by the hospital for non-hospital cardiovascular diseases of the Chinese academy of medicine sciences. According to the whole group random sampling method, 35-64 years old people are selected from 12 different areas of North China, south China, northeast China, northwest China and southwest in a physical examination mode to investigate the coronary heart disease risk factors. 2016 + 2017, follow-up visits were made to 4 of the 12 regions, with a median follow-up time of 6.21 years, and end-point events such as hypertension, hyperglycemia, hyperlipidemia and the like were recorded in the population. The follow-up rate reaches 88.8 percent. After eliminating invalid data, 2838 persons as the final valid data are left, and all 2838 serum samples are taken for the invention.

The project is approved by ethical committee of Fuwei cardiovascular disease Hospital of Chinese medical science institute, and all investigators sign informed consent.

Experimental methods

1. Collection, isolation and preservation of serum samples

All study specimens were collected using a standardized collection protocol. 3ml of blood is collected from the fasting vein of a subject and is placed in a dry vacuum tube, the blood is stood at room temperature and centrifuged at high speed of 12000g for 10min after the blood is normally coagulated, and the upper layer serum is taken and stored at low temperature of minus 80 ℃ for standby.

2. Human peripheral blood mononuclear cell separation

The collected anticoagulated blood was separated into serum and peripheral blood mononuclear cells (hereinafter referred to as PBMC) from the human peripheral blood lymphocyte fraction. The method mainly comprises the following steps: 3ml of human peripheral blood lymphocyte separation liquid is added into a centrifuge tube, and then a certain amount of anticoagulant (less than 3ml) is slowly put into the upper layer of the separation liquid along the tube wall. Centrifuge at 400g for 2min at room temperature. Taking out the solution, collecting the supernatant as serum, sucking 1-2ml, adding into a centrifuge tube, and storing at-80 deg.C. The middle layer was white as PBMC layer, carefully pipetted into centrifuge tubes, and washed once with 5ml PBS. Centrifuging at 250g for 10min, removing supernatant to obtain cell precipitate, adding trizol for lysis, and storing at-80 deg.C.

3. Total RNA extraction

(1) Serum total RNA extraction: total RNA in serum was extracted with TRIzol LS. The method comprises the following specific steps: adding TRIzol LS with volume 3 times of that of 100 μ l of serum, fully shaking, mixing, standing at room temperature for 5-10min, adding 240 μ l of chloroform, fully shaking, mixing, and standing at room temperature for 5-10 min. Centrifuging at 12000g for 15min at 4 deg.C, sucking supernatant, adding 500 μ l isopropanol, standing for 10min, centrifuging at 12000g for 10min at 4 deg.C, discarding supernatant, washing with 75% ethanol for 1-2 times, air drying at room temperature, and dissolving with DEPC water. The final concentration of each RNA sample was 100-200 ng/. mu.l, and the total amount was not less than 1. mu.g.

(2) Extracting total RNA of cells: total RNA was extracted from the cells using TRIzol. The method comprises the following specific steps: and (3) cracking the collected cells by using TRIzol, fully shaking and mixing uniformly, adding 100 mu l of trichloromethane, fully shaking and mixing uniformly, and standing at room temperature for 8-10 min. Centrifuging at 12000g for 15min at 4 deg.C, sucking supernatant, adding 250 μ l isopropanol, standing for 10min, centrifuging at 12000g for 10min at 4 deg.C, discarding supernatant, washing with 75% ethanol for 1-2 times, air drying at room temperature, and dissolving with DEPC water. The final concentration of each RNA sample was 100-200 ng/. mu.l, and the total amount was not less than 1. mu.g.

Sequencing of miRNA

And after the quality of the serum and cell RNA samples is qualified, performing miRNA high-throughput sequencing in a high-throughput sequencing center of Beijing university. The sequencing platform adopts Illumina HiSeq 2500 with the sequencing depth of 4G.

5. Extraction of serum miRNA

And extracting miRNA in the serum by adopting an miRNA extraction and separation kit. The main method comprises the following steps: and (3) taking 200 mu l of serum from each serum sample, and extracting miRNA in the serum according to the miRNAute miRNA extraction and separation kit steps. Finally, 20. mu.l of DEPC was added to each sample to dissolve in water twice. Samples were stored at-80 ℃ for subsequent q-RT-PCR detection.

Reverse transcription of miRNA

(1) Reverse transcription of serum miRNA: the reaction system for reverse transcription of miRNA into cDNA is as follows: buffer TS 2. mu.l; dNTP (10mM) 1. mu.l; RT primer 5. mu.M; RNase inhibitor (RNase inhibitor) 0.25. mu.l; reverse transcriptase 0.5. mu.l; 20ng of sample; DEPC water was added to 10. mu.l of the reaction. Reaction conditions are as follows: preheating at 25 deg.C for 10min, incubating at 42 deg.C for 30min, and inactivating reverse transcriptase at 80 deg.C for 5 min. The reaction was carried out in a conventional PCR apparatus.

(2) Reverse transcription of cellular miRNA: firstly, a stem-loop method is used for reverse transcribing specific miRNA in total RNA into cDNA, and a reaction system is as follows: buffer TS 4. mu.l; dNTP (10mM) 1. mu.l; RT primer 5. mu.M; RNase inhibitor (RNase inhibitor) 0.5. mu.l; 1. mu.l of Reverse transcriptase; 500ng of sample; DEPC water was added to 20. mu.l of the reaction. Reaction conditions are as follows: preheating at 25 deg.C for 10min, incubating at 42 deg.C for 30min, and inactivating reverse transcriptase at 80 deg.C for 5 min. The reaction was carried out in a conventional PCR apparatus.

Quantitative detection of miRNA

(1) Quantitative detection of serum miRNA: and (3) carrying out fluorescence quantitative PCR on the cDNA template after the reverse transcription of the serum. The reaction system is as follows: 2.5. mu.l Hotmaster Taq enzyme buffer (Tiangen), 20. mu.M Forward primer (Ruibo), 0.25. mu.l Hotmaster Taq enzyme (2.5U/. mu.l Tiangen), 1. mu.l Hotmaster Taq enzyme buffer (Tiangen)

Green I (Invitrogen), 2.5. mu.l cDNA, plus RNase-free purified water to a 25. mu.l system. The reaction conditions were as follows: preheating at 95 ℃ for 10min, denaturing at 95 ℃ for 15s, and annealing and extending at 60 ℃ for 60 s. After the end of 40 cycles, the dissolution curves were collected. The U6 is used as an experimental internal reference of miRNA, the CT value of the internal reference U6 is subtracted from the CT value of miRNA to obtain the Delta CT, and the Delta CT value obtained by subtracting the Delta CT value of each sample from the median Delta CT value (sample size is less than or equal to 100) or the average Delta CT value (sample size is greater than 100) of a control group is used as the normalized relative content of each sample in a population verification experiment.

(2) Quantitative detection of cellular miRNA: and carrying out fluorescent quantitative PCR on the cDNA template after cell reverse transcription. The reaction system is as follows: 2.5. mu.l Hotmaster Taq enzyme buffer (Tiangen), 20. mu.M Forward primer (Ruibo), 0.25. mu.l Hotmaster Taq enzyme (2.5U/. mu.l Tiangen), 1. mu.l Hotmaster Taq enzyme buffer (Tiangen)

Green I (Invitrogen), 1. mu.l cDNA, plus RNase-free purified water to a 25. mu.l system. The reaction conditions were as follows: preheating at 95 ℃ for 10min, denaturing at 95 ℃ for 15s, and annealing and extending at 60 ℃ for 60 s. After the end of 40 cycles, the dissolution curves were collected. The experimental internal control of miRNA U6 was used, the CT value of internal control U6 was subtracted from the CT value of miRNA to obtain Δ CT, and fold change was expressed as 2^ - (Δ CTcase- Δ CTcontrol).

8. Sequencing detection of serum miRNA PCR product

5 μ l of PCR product was subjected to agarose electrophoresis, and the product recovered by cutting the gel was subjected to TA cloning. The reaction system is as follows: 2 XT 4DNA Rapid Ligation Buffer 5 μ l; 1. mu.l of T4DNA Ligase (3U/. mu.l); pGM-T vector (50 ng/. mu.l) 1. mu.l; 1.5 mul of target PCR fragment; ddH₂O1.5. mu.l. After being flicked and mixed evenly, the mixture reacts for 10min at 25 ℃. Add 5. mu.l of ligation product to 30-50. mu.l of competent cells. After gently mixing, the mixture was inserted into ice and ice-cooled for 30 min. The competent cells after ice bath are inserted into water at 42 ℃, quickly taken out of the ice bath for 2-3min after water bath for 1min, and added with 400 mul of 2 XYT culture medium without antibiotics, and shake-cultured for 1h at constant temperature of 180pm and 37 ℃ by a shaking table. Then, 10. mu.l of IPTG (50mg/ml) and 40. mu.l of X-Gal (20mg/ml) were added to 200. mu.l of the bacterial solution, mixed together and applied to an agar plate. White colonies were picked for PCR sequencing.

9. Cell experiments

(1) Isolation and culture of umbilical vein endothelial cells

The endothelial cells were isolated within the ultra-clean bench from fresh umbilical cord for 6 h. The main process is as follows: firstly, soaking the umbilical cord in a D-hanks solution, finding a vein port at one end of the umbilical cord, injecting the D-hanks into the vein by using a syringe, and flushing for three times. The umbilical cord was clamped at one end with a hemostat, 10-15ml of collagenase II at 37 ℃ was injected into the vein orifice at the other end, and then clamped with the hemostat. Gently massage the umbilical cord several times to accelerate the digestion of HUVEC cells from the venous endothelium. Soaking the umbilical cord in D-hanks solution, and keeping the temperature at 37 ℃ for 13 min. The injected collagenase is collected into a centrifuge tube, and is simultaneously injected with D-hanks solution to wash twice, 10ml each time. The washed solution was collected into a centrifuge tube together with collagenase. Centrifuging at 1200g for 5min, removing supernatant, collecting cell precipitate, adding 10-15ml ECM complete culture medium (containing 5% FBS, 1% growth factor, and 1% double antibody), re-suspending, plating, and adding CO₂An incubator. Changing the solution once for 4-6h, and subculturing or freezing and storing by liquid nitrogen after the cells are converged. Cells passed to 3-7 passages were used for subsequent experiments.

(2) Hypoxia and TNF α treatment of cells

When HUVEC cells grow to 60-70% density, starving and culturing 6-12 by replacing ECM basal medium (without FBS, growth factors, double antibody and the like)h, then the cells were placed in an oxygen-deficient chamber (37 ℃, 94% N)₂，1％O₂，5％CO₂) Incubate at constant temperature for 24h or, alternatively, incubate with ECM starvation medium containing human TNF α (20ng/ml) at 37 ℃ in a cell incubator for a set time.

10. Statistical analysis

In the experiment, the miRNA content difference analysis of the samples of the coronary heart disease patient and the healthy person is completed by student t test of SPSS 22.0 software. P<0.05 is a significant difference. For the diagnostic efficacy of circulating miRNA molecules on disease, a Receiver (ROC) curve was plotted using prism 5.0. In the high-throughput sequencing data, miRNA with different abundances in serum are subjected to clustering analysis through R language software, so that candidate miRNA molecules which can be used for follow-up experimental verification can be selected. In the population verification in the discovery stage, clustering analysis is carried out on miRNA with different contents in patient serum through R language software, and the discrimination of candidate miRNA molecules on coronary heart disease patients and healthy people is analyzed. In prospective study of follow-up large sample general population, the basic characteristics of the population sample are counted through SAS9.4 software, and continuous variable is used

And representing, classifying variable rate representation. And simultaneously, single and multiple logistic models are analyzed by using SAS9.4 software to analyze the relevance of traditional risk factors and candidate miRNA molecules to the occurrence of diseases. For the relationship between circulating miRNA and coronary events, the cross-sectional survey used a non-conditional Logistic regression model, and the degree of correlation was expressed as Odds Ratio (OR) and 95% confidence interval (95% CI). And (3) constructing a prediction model by using the R language, and analyzing the prediction efficiency of the candidate miRNA molecules in the diseases.

MiRNA sequence and detection primer sequence

TABLE 1 mature sequences of miRNA

miRNA	Sequence (5' ->3’)	SEQ ID NO.
			hsa-miR-10a-5p	UACCCUGUAGAUCCGAAUUUGUG		1
hsa-miR-126-3p	UCGUACCGUGAGUAAUAAUGCG						2
			hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA		3
hsa-miR-423-3p	AGCUCGGUCUGAGGCCCCUCAGU						4
			hsa-miR-92a-3p	UAUUGCACUUGUCCCGGCCUGU	5

TABLE 2 sequence of miRNA-specific stem-loop primers

TABLE 3 sequence of miRNA-specific detection primers

Example 1 preliminary screening of 48 candidate miRNAs based on miRNA sequencing data

Serum and PBMCs of coronary heart disease patients and healthy persons were subjected to miRNA sequencing at the Beijing university sequencing center. Wherein, 1022 kinds of miRNA and 976 kinds of miRNA are respectively detected in human serum samples of patients with coronary heart disease and healthy people; meanwhile, 1027 and 918 mirnas were detected in PBMC samples of coronary heart disease patients and healthy persons. The number of Reads for each set of mirnas was normalized to the t-PM value (t-PM: individual miRNA Reads/total Reads in sample 10^ 6). And carrying out cluster analysis on 483 miRNAs with t-PM values larger than 50. Then, the variation of the content of 483 miRNAs in serum and blood cells was counted, and the results are shown in Table 4, wherein the content of 132 miRNAs in serum and PBMC is changed simultaneously. It is presumed that there is some correlation between the levels of these mirnas in serum and PBMCs. Further, 483 miRNAs with t-PM values larger than 50 are screened according to the variation standard that the ratio of an experimental group/a control group is less than 0.8 or more than 2, and 48 candidate miRNA molecules are selected as preliminary candidate marker molecules for subsequent experimental verification.

TABLE 4 number of miRNAs with differences in serum and PBMC content

Example 2 screening of 5 candidate miRNAs based on miRNA detection stability

And (3) detecting the stability and the repeatability of the preliminarily screened 48 miRNA candidate molecules in a fluorescent quantitative PCR method. Through multiple q-RT-PCR and sequencing experiments, only 10 miRNAs can be detected in serum and a full-length sequence can be detected in sequencing verification. Of the 10 miRNAs, 5 miRNAs have better detection stability in serum, and further, the 5 miRNAs are subjected to a repeated detection experiment. 5 healthy human sera were selected, and three replicates of each sample were run starting from the extraction of miRNA. Figure 1 is the result of a repeat experiment of 5 candidate mirnas and an internal reference U6. As can be seen from fig. 1, the CT values of mirnas were between 15 and 35, and the standard deviation of the duplicate experiments for each sample was less than 2.

Based on the results, 5 miRNA molecules of miR-10a-5p, miR-126-3p, miR-210-3p, miR-423-3p and miR-92a-3p are selected to carry out a population verification experiment.

Example 3 diagnostic efficacy of miRNA candidate molecules on coronary artery disease population

In order to detect whether 5 circulating miRNA molecules screened based on a sequencing result can effectively distinguish coronary heart disease patients from healthy people, 39 coronary heart disease patients from northern regions and 39 healthy people with sex and age matching are selected as discovery sets to be detected (the age of the coronary heart disease patients is 63.1 +/-7.41 years, and the age of the healthy people is 59 +/-7.29 years).

The content of 5 miRNA candidate molecules in a serum sample is detected by a q-RT-PCR method, two groups of standardized data are subjected to two-tail T-test, the analysis result is shown in table 5 and figure 2, and the table 5 shows that the content of miR-10a-5p is extremely significant in difference between a patient and a healthy person, the change amplitude is obvious, and the content is adjusted by 85% compared with the content of the healthy person.

TABLE 5 variation of the content of candidate miRNAs in serum of patients with coronary heart disease (discovery phase)

Note: HC: health control, healthy control

Meanwhile, the test subject curve is used for evaluating the diagnostic efficacy of the miR-10a-5p on the coronary heart disease. As shown in FIG. 2, the AUC area under the subject curve of miR-10a-5P is as high as 0.817, and the difference is extremely significant (P <0.0001), so that the method has quite high efficiency in diagnosing coronary heart disease.

To further determine the correlation between serum levels and blood cell levels of these candidate mirnas, miRNA content of PBMCs in coronary heart disease and healthy populations was examined by q-RT-PCR. Specifically, 30 coronary heart disease patients and 30 healthy people with age-matched gender were selected, peripheral blood mononuclear cells were isolated, total cellular RNA was extracted, and the level of candidate miRNA molecules in the sample was determined by fluorescent quantitative PCR. As shown in figure 3, miR-10a-5p was also down-regulated in PBMCs of coronary heart disease patients compared to healthy humans, and the differences were significant (p <0.05), suggesting that changes in serum mirnas were correlated with miRNA changes in PBMCs in coronary heart disease patients.

Example 4 prediction of atherosclerosis-related diseases by circulating miRNAs

Since coronary heart disease is a chronic inflammatory reaction process of blood vessels, a plurality of cytokines can trigger activation of vascular endothelial cells and an inflammatory process, human TNF α inflammatory factors are used for stimulating HUVEC, reaction and change conditions of miRNA are detected, and the result is shown in figure 4. known TNF α/NF-kB response factors IL-6 and IL-8 are used as positive controls, figure 4A is the change conditions of IL-6 and IL-8 at various time points, the IL-6 and IL-8 are found to be remarkably increased (p is less than 0.0001) at various time points under the stimulation condition of TNF α, figure 4B is the change condition of miR-10a-5p at various time points, and it can be seen that miR-10a-5p is remarkably reduced (p is less than 0.05) at 12h, 24h and 36h under the stimulation of TNF α, the response of miRNA molecules to the stimulation of TNF α is consistent with the change of the blood serum content of a patient, and the miRNA content is possibly related to the endothelial serum, and the miRNA is found to be an important source, and the miRNA is used as an early-phase of the early-inflammatory response of miRNA, and the miRNA is indicated that the change of the miRNA, and the inflammation of the miRNA, the early-10-5-10-miRNA is used as a.

Subsequently, a collection of atherosclerosis-related disease events (including hypertension, diabetes and hyperlipidemia) was performed. And collecting related information by professionals trained at each monitoring point according to a uniformly established standardized event table. The project center asks experts to check events and sends out experts to check missing reports. Hypertension is defined as a patient who has been treated for hypotensive treatment, or who has been tested to confirm systolic and diastolic blood pressures of 140 or greater, or 90mmHg or greater on three different days. Diabetes is determined according to the diagnostic criteria of the American diabetes Association (administration of hypoglycemic agents, or fasting blood glucose levels of 7mmol/L or more or less than 11.1mmol/L or 2h post-prandial blood glucose levels). Hyperlipidemia is defined as being treated with either LDL cholesterol > 130mg/dL or total cholesterol > 200 mg/dL. 164 hypertension, 222 hyperlipidemia and 108 diabetic events were collected according to the above criteria.

Then, the prospective nested case-control study population was constructed. Based on the follow-up results of 6 years, the prospective nested case-control study was constructed by matching 4 controls randomly by trend scoring for each atherosclerosis-related event case in 2838 population samples. Three nested case control research groups are constructed in total and respectively participate in the predictive analysis of hypertension, diabetes and hyperlipidemia, and the sample numbers are 820 cases, 540 cases and 1110 cases respectively. The basic body examination information such as gender, age, Body Mass Index (BMI), Total Cholesterol (TC) and the like of the crowd samples before 6 years are counted, and the related physical examination index information of the crowd with diseases (case) after 6 years and the crowd without diseases (control) is compared according to the statistics of whether the crowd samples with diseases after 6 years are attacked or not. In the nested case-control study population, the age of the non-diseased population of the hypertension study group was 48.70 ± 7.87 years, and the age of the diseased population was 51.28 ± 7.59 years; the age of the non-disease-suffering population in the diabetes research group is 50.67 +/-7.92 years, and the age of the disease-suffering population is 51.76 +/-7.31 years; the age of the non-diseased population in the hyperlipemia study group is 50.48 +/-7.91 years, and the age of the diseased population is 50.75 +/-7.75 years.

Next, a one-way analysis of the association of circulating mirnas and traditional risk factors with disease development was performed. Dividing the screened nested case contrast study population into a diseased group and a non-diseased group, and analyzing the relevance of single risk factors or circulating miRNA content and new diseases one by using a single-factor logistic model and SAS9.4 software. Specific results are shown in tables 6, 7 and 8.

TABLE 6 Single-term logistic regression analysis of factors affecting hypertension onset

TABLE 7 Single-term logistic regression analysis of the factors affecting diabetes onset

TABLE 8 Single-term logistic regression analysis of the incidence factors of hyperlipidemia

As can be seen from Table 6, the age, blood glucose level, Body Mass Index (BMI), drinking rate and other traditional risk factors are related to the occurrence of hypertension (OR >1), and have significance (P <0.05), which is in line with the known conclusion. Meanwhile, the serum content of miR-10a-5P is found to be negatively correlated with the occurrence of hypertension (OR <1), and is also significant (P is 0.0001).

As can be seen from Table 7, Body Mass Index (BMI), Total Cholesterol (TC), Low Density Lipoprotein (LDLC) and blood glucose level are positively correlated with the occurrence of diabetes (OR >1) and significant (P < 0.05). The serum content of High Density Lipoprotein (HDLC) and miR-10a-5P is inversely related to the occurrence of diabetes (OR <1) and has significance (P < 0.05).

As can be seen from Table 8, the Body Mass Index (BMI), Total Cholesterol (TC), Low Density Lipoprotein (LDLC) and the occurrence of hyperlipidemia are positively correlated (OR >1) and significant (P < 0.05). The serum content of High Density Lipoprotein (HDLC) and miR-10a-5P is inversely related to the occurrence of hyperlipidemia (OR <1), and has significance (P < 0.05).

Furthermore, although the effect relationship of each risk factor and circulating miRNA content in the nested case study group on the occurrence of diseases when the risk factors and circulating miRNA content exist independently is obtained by single-factor logistic analysis, some risk factors and circulating miRNA may have internal connection, and therefore, multi-factor analysis of circulating miRNA and risk factors on the occurrence of diseases is performed next.

The disease-occurrence-related factors in the monogenic logistic analysis in the three nestle case study groups were pooled together, and the influence of these factors on the disease occurrence when they act together was analyzed using SAS9.4 using the multifactorial logistic model, with the results shown in tables 9, 10 and 11.

TABLE 9 correlation of circulating miRNAs with hypertension onset in multifactorial logistic analysis

TABLE 10 correlation of circulating miRNAs with diabetes onset in multifactorial logistic analysis

TABLE 11 correlation of circulating miRNA in multifactorial logistic analysis with hyperlipidemia onset

In a multi-factor logistic model, some factors which are obviously related to the occurrence of the disease when acting alone are found to have no correlation with the occurrence of the disease, which indicates that the influence of the factors on the occurrence of the disease is greatly interfered by other indexes; and circulating miRNA has strong correlation with the occurrence of diseases after traditional risk factors such as age, smoking, drinking, total cholesterol, blood sugar and the like are balanced. As shown in tables 9, 10 and 11, miR-10a-5P is found to be negatively correlated with the occurrence of hypertension, diabetes and hyperlipidemia (OR <1) and has significance (P <0.05), which indicates that miR-10a-5P can be used as an independent influence factor to predict the occurrence of three diseases.

In the screening research of the coronary heart disease diagnosis marker in the example 3, the content of miR-10a-5p in the serum of a coronary heart disease patient is found to be reduced, and the miR-10a-5p has a protective effect on the occurrence of the coronary heart disease. This is consistent with the prediction results of hypertension, diabetes and hyperlipidemia in this example, which suggests that miR-10a-5p may be a predictive marker for atherosclerotic diseases such as coronary heart disease, hypertension, diabetes and hyperlipidemia, because the content of serum in early stage of coronary heart disease onset changes already.

In order to further analyze the prediction efficacy of the circulating miRNA on the diseases, the traditional risk factors (age, sex and the like) related to the diseases are put into an equation to establish a model 1, then the risk factors related to the diseases and the circulating miRNA content are added on the basis of the model 1 to establish a model 2, and the NRI (net retrieval classification index) of the model 2 relative to the model 1 is calculated by using R language analysis. The results are shown in tables 12, 13 and 14.

TABLE 12 predictive analysis of circulating miRNA hypertension onset

TABLE 13 predictive analysis of circulating miRNA diabetes onset

TABLE 14 predictive analysis of circulating miRNA hyperlipidemia incidence

As can be seen from table 12, in the prediction model of hypertension, after miR-10a-5P is incorporated into the equation, NRI is 0.2085(P ═ 0.01658), and the predicted contribution rate is greater than traditional risk factors such as alcohol consumption and blood fat. From table 13, in the prediction model of diabetes, after miR-10a-5P is included in the equation, NRI is 0.4412(P <0.0001), and the prediction contribution rate is greater than traditional risk factors such as BMI, blood fat and blood pressure. As can be seen from table 14, in the prediction model of hyperlipidemia, after miR-10a-5P is incorporated into the equation, NRI is 0.1505(P is 0.04796), and the prediction contribution rate is greater than traditional risk factors such as BMI and blood pressure. In general, NRI represents the efficiency improvement of the latter model compared to the former model, and a larger value of NRI represents a better performance of the latter model compared to the former model. It can be seen that model 2 with the addition of circulating miRNAmiR-10a-5p has improved disease prediction efficiency, and the improvement efficiency is higher than that of the traditional risk factors. The circulating miRNA miR-10a-5p can be used as a predictive marker for atherosclerosis diseases such as hypertension, diabetes, hyperlipidemia and the like.

Sequence listing

<110> Beijing university

National center for cardiovascular diseases

<120> application of circulating nucleic acid as marker of hypertension, diabetes and hyperlipidemia

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>23

<212>RNA

<213>Homo sapiens

<400>1

uacccuguag auccgaauuu gug 23

<210>2

<211>22

<212>RNA

<213>Homo sapiens

<400>2

ucguaccgug aguaauaaug cg 22

<210>3

<211>22

<212>RNA

<213>Homo sapiens

<400>3

cugugcgugu gacagcggcu ga 22

<210>4

<211>23

<212>RNA

<213>Homo sapiens

<400>4

agcucggucu gaggccccuc agu 23

<210>5

<211>22

<212>RNA

<213>Homo sapiens

<400>5

uauugcacuu gucccggccu gu 22

<210>6

<211>55

<212>DNA

<213>Artificial Sequence

<220>

Claims (6)

1. A kit for predicting hypertension, diabetes and hyperlipidemia, comprising a circulating nucleic acid detection reagent, wherein the circulating nucleic acid comprises circulating miR-10a-5p,

preferably, the circulating nucleic acid further comprises one or more of miR-126-3p, miR-210-3p, miR-423-3p and miR-92a-3p,

preferably, the circulating nucleic acid is from a bodily fluid; more preferably, the body fluid is serum or plasma,

preferably, the kit is for predicting hypertension, diabetes and hyperlipidemia in a population over 35 years of age, under 75 years of age;

preferably, the kit further comprises reagents for detecting an internal control; more preferably, the internal reference is nuclear mini-RNARNNU 6(U6),

preferably, the kit comprises a circulating nucleic acid detection primer, and the sequence of the circulating nucleic acid detection primer is shown in any one of SEQ ID No. 6-SEQ ID No. 16.

2. The application of the circulating nucleic acid detection reagent in the preparation of the kit for predicting hypertension, diabetes and hyperlipidemia is characterized in that the circulating nucleic acid comprises circulating miR-10a-5p,

preferably, the circulating nucleic acid further comprises one or more of miR-126-3p, miR-210-3p, miR-423-3p and miR-92a-3p,

preferably, the circulating nucleic acid is from a bodily fluid; more preferably, the body fluid is serum or plasma,

preferably, the kit is for predicting hypertension, diabetes and hyperlipidemia in a population over 35 years of age, under 75 years of age;

preferably, the kit further comprises reagents for detecting an internal control; more preferably, the internal reference is nuclear mini-RNARNNU 6(U6),

preferably, the kit comprises a circulating nucleic acid detection primer, and the sequence of the circulating nucleic acid detection primer is shown in any one of SEQ ID No. 6-SEQ ID No. 16.

3. A microarray for predicting hypertension, diabetes and hyperlipidemia comprising a circulating nucleic acid detection probe, wherein the circulating nucleic acid comprises circulating miR-10a-5p,

preferably, the circulating nucleic acid further comprises one or more of miR-126-3p, miR-210-3p, miR-423-3p and miR-92a-3p,

preferably, the circulating nucleic acid is from a bodily fluid; more preferably, the body fluid is serum or plasma,

preferably, the microarray is used for predicting hypertension, diabetes and hyperlipidemia in a population over 35 years of age, under 75 years of age;

preferably, the microarray further comprises a reagent for detecting an internal control; more preferably, the internal reference is nuclear mini-RNARNNU 6(U6),

preferably, the sequence of the circulating nucleic acid detection probe is shown in any one of SEQ ID NO. 6-SEQ ID NO. 16.

4. Use of a circulating nucleic acid detection probe in the preparation of a microarray for the prediction of hypertension, diabetes and hyperlipidemia, wherein the circulating nucleic acid comprises circulating miR-10a-5p,

preferably, the circulating nucleic acid further comprises one or more of miR-126-3p, miR-210-3p, miR-423-3p and miR-92a-3p,

preferably, the circulating nucleic acid is from a bodily fluid; more preferably, the body fluid is serum or plasma,

preferably, the microarray is used for predicting hypertension, diabetes and hyperlipidemia in a population over 35 years of age, under 75 years of age;

preferably, the microarray further comprises a reagent for detecting an internal control; more preferably, the internal reference is nuclear mini-RNARNNU 6(U6),

preferably, the sequence of the circulating nucleic acid detection probe is shown in any one of SEQ ID NO. 6-SEQ ID NO. 16.

5. Use of a circulating nucleic acid for predicting hypertension, diabetes and hyperlipidemia, wherein the circulating nucleic acid comprises circulating miR-10a-5p,

preferably, the circulating nucleic acid further comprises one or more of miR-126-3p, miR-210-3p, miR-423-3p and miR-92a-3p,

preferably, the circulating nucleic acid is from a bodily fluid; more preferably, the body fluid is serum or plasma,

preferably, hypertension, diabetes and hyperlipidemia are predicted in populations over 35 years of age, under 75 years of age;

preferably, the internal reference is further detected; more preferably, the internal reference is a small nuclear RNA RNU6(U6),

preferably, the circulating nucleic acid is detected by using a circulating nucleic acid detection primer and/or a circulating nucleic acid detection probe, and the sequence of the circulating nucleic acid detection primer and/or the circulating nucleic acid detection probe is shown in any one of SEQ ID NO. 6-SEQ ID NO. 16.

6. A method for predicting hypertension, diabetes and hyperlipidemia, comprising the step of detecting circulating nucleic acids in a body fluid, wherein the circulating nucleic acids comprise circulating miR-10a-5p,

preferably, the circulating nucleic acid further comprises one or more of miR-126-3p, miR-210-3p, miR-423-3p and miR-92a-3p,

preferably, the body fluid is serum or plasma,

preferably, hypertension, diabetes and hyperlipidemia are predicted in populations over 35 years of age, under 75 years of age;

preferably, the internal reference is further detected; more preferably, the internal reference is a small nuclear RNA RNU6(U6),

preferably, the circulating nucleic acid is detected by using a circulating nucleic acid detection primer and/or a circulating nucleic acid detection probe, and the sequence of the circulating nucleic acid detection primer and/or the circulating nucleic acid detection probe is shown in any one of SEQ ID NO. 6-SEQ ID NO. 16.

Images