CN108728532B - A kind of Microrna marker and its application - Google Patents
A kind of Microrna marker and its application Download PDFInfo
- Publication number
- CN108728532B CN108728532B CN201810675996.4A CN201810675996A CN108728532B CN 108728532 B CN108728532 B CN 108728532B CN 201810675996 A CN201810675996 A CN 201810675996A CN 108728532 B CN108728532 B CN 108728532B
- Authority
- CN
- China
- Prior art keywords
- mirna
- mir
- cteph
- hsa
- pulmonary hypertension
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 239000003550 marker Substances 0.000 title claims abstract description 12
- 108091070501 miRNA Proteins 0.000 title claims abstract description 11
- 208000002815 pulmonary hypertension Diseases 0.000 claims abstract description 41
- 208000026151 Chronic thromboembolic pulmonary hypertension Diseases 0.000 claims abstract description 34
- 108091070496 Homo sapiens miR-20a stem-loop Proteins 0.000 claims abstract description 24
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 claims abstract description 20
- 239000002773 nucleotide Substances 0.000 claims description 12
- 125000003729 nucleotide group Chemical group 0.000 claims description 12
- 239000003153 chemical reaction reagent Substances 0.000 abstract description 7
- 230000001684 chronic effect Effects 0.000 abstract description 7
- 238000001514 detection method Methods 0.000 abstract description 6
- 238000013399 early diagnosis Methods 0.000 abstract 1
- 239000002679 microRNA Substances 0.000 abstract 1
- 108700011259 MicroRNAs Proteins 0.000 description 29
- 238000006243 chemical reaction Methods 0.000 description 13
- 201000010099 disease Diseases 0.000 description 12
- 238000010839 reverse transcription Methods 0.000 description 11
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 10
- 239000000523 sample Substances 0.000 description 9
- 210000004369 blood Anatomy 0.000 description 8
- 239000008280 blood Substances 0.000 description 8
- 238000003745 diagnosis Methods 0.000 description 8
- 238000000034 method Methods 0.000 description 8
- 239000000090 biomarker Substances 0.000 description 7
- 238000011161 development Methods 0.000 description 7
- 230000018109 developmental process Effects 0.000 description 7
- 108090000623 proteins and genes Proteins 0.000 description 6
- 238000011160 research Methods 0.000 description 5
- 238000011529 RT qPCR Methods 0.000 description 4
- 238000004925 denaturation Methods 0.000 description 4
- 230000036425 denaturation Effects 0.000 description 4
- 230000001105 regulatory effect Effects 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 3
- 238000013461 design Methods 0.000 description 3
- 108020004999 messenger RNA Proteins 0.000 description 3
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 3
- 230000009424 thromboembolic effect Effects 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 108700039887 Essential Genes Proteins 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 208000010378 Pulmonary Embolism Diseases 0.000 description 2
- 239000013614 RNA sample Substances 0.000 description 2
- 230000033228 biological regulation Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 230000030279 gene silencing Effects 0.000 description 2
- 230000002969 morbid Effects 0.000 description 2
- 230000002093 peripheral effect Effects 0.000 description 2
- 230000001376 precipitating effect Effects 0.000 description 2
- 230000000750 progressive effect Effects 0.000 description 2
- 210000001147 pulmonary artery Anatomy 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 230000003827 upregulation Effects 0.000 description 2
- 208000024172 Cardiovascular disease Diseases 0.000 description 1
- 238000009007 Diagnostic Kit Methods 0.000 description 1
- 241000206602 Eukaryota Species 0.000 description 1
- 206010019280 Heart failures Diseases 0.000 description 1
- 101710163270 Nuclease Proteins 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 238000002123 RNA extraction Methods 0.000 description 1
- 102000006382 Ribonucleases Human genes 0.000 description 1
- 108010083644 Ribonucleases Proteins 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 239000002253 acid Substances 0.000 description 1
- 230000001154 acute effect Effects 0.000 description 1
- 230000006907 apoptotic process Effects 0.000 description 1
- 238000013459 approach Methods 0.000 description 1
- 239000008346 aqueous phase Substances 0.000 description 1
- 210000001367 artery Anatomy 0.000 description 1
- 238000007622 bioinformatic analysis Methods 0.000 description 1
- 238000003766 bioinformatics method Methods 0.000 description 1
- 239000000872 buffer Substances 0.000 description 1
- 230000000747 cardiac effect Effects 0.000 description 1
- 230000015556 catabolic process Effects 0.000 description 1
- 230000004663 cell proliferation Effects 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000001816 cooling Methods 0.000 description 1
- 230000007123 defense Effects 0.000 description 1
- 238000006731 degradation reaction Methods 0.000 description 1
- 206010012601 diabetes mellitus Diseases 0.000 description 1
- 230000003073 embolic effect Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 235000019441 ethanol Nutrition 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000000835 fiber Substances 0.000 description 1
- 230000011132 hemopoiesis Effects 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 108091033753 let-7d stem-loop Proteins 0.000 description 1
- 210000004072 lung Anatomy 0.000 description 1
- 239000006166 lysate Substances 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 238000002844 melting Methods 0.000 description 1
- 230000008018 melting Effects 0.000 description 1
- 230000004060 metabolic process Effects 0.000 description 1
- 108091044988 miR-125a stem-loop Proteins 0.000 description 1
- 108091049513 miR-125a-1 stem-loop Proteins 0.000 description 1
- 108091040046 miR-125a-2 stem-loop Proteins 0.000 description 1
- 108091031479 miR-204 stem-loop Proteins 0.000 description 1
- 108091032382 miR-204-1 stem-loop Proteins 0.000 description 1
- 108091085803 miR-204-2 stem-loop Proteins 0.000 description 1
- 108091089766 miR-204-3 stem-loop Proteins 0.000 description 1
- 108091073500 miR-204-4 stem-loop Proteins 0.000 description 1
- 108091053626 miR-204-5 stem-loop Proteins 0.000 description 1
- 108091056721 miR-3148 stem-loop Proteins 0.000 description 1
- 108091049937 miR-759 stem-loop Proteins 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000009456 molecular mechanism Effects 0.000 description 1
- 230000000926 neurological effect Effects 0.000 description 1
- 239000002777 nucleoside Substances 0.000 description 1
- 125000003835 nucleoside group Chemical group 0.000 description 1
- 230000005305 organ development Effects 0.000 description 1
- 230000010355 oscillation Effects 0.000 description 1
- 230000008506 pathogenesis Effects 0.000 description 1
- 239000013610 patient sample Substances 0.000 description 1
- 210000005259 peripheral blood Anatomy 0.000 description 1
- 239000011886 peripheral blood Substances 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 238000004393 prognosis Methods 0.000 description 1
- 230000036593 pulmonary vascular resistance Effects 0.000 description 1
- 238000007634 remodeling Methods 0.000 description 1
- 230000029058 respiratory gaseous exchange Effects 0.000 description 1
- 230000004044 response Effects 0.000 description 1
- 239000003161 ribonuclease inhibitor Substances 0.000 description 1
- 229920002477 rna polymer Polymers 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000010008 shearing Methods 0.000 description 1
- 230000001225 therapeutic effect Effects 0.000 description 1
- 238000002560 therapeutic procedure Methods 0.000 description 1
- 230000001732 thrombotic effect Effects 0.000 description 1
- 238000013518 transcription Methods 0.000 description 1
- 230000035897 transcription Effects 0.000 description 1
- 238000013519 translation Methods 0.000 description 1
- 210000003462 vein Anatomy 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of Microrna marker and its application in product of the preparation for diagnosing chronic thromboembolia type pulmonary hypertension CTEPH disease, which is hsa-miR-20a-5p.The invention also discloses a kind of kit, which contains the reagent for measuring hsa-miR-20a-5p marker.Chronic thromboembolic pulmonary hypertension CTEPH miRNA detection kit of the invention is quick and convenient, and the early diagnosis and prediction of CTEPH may be implemented.
Description
Technical field
The invention belongs to biomedical inspection fields, are related to a kind of for diagnosing chronic thromboembolia type pulmonary hypertension
The Microrna marker of CTEPH further relates to application and relevant kit of the marker in diagnosis CTEPH.
Background technique
Chronic thromboembolic pulmonary hypertension (chronic thromboembolic pulmonary
Hypertension, CTEPH) be the performance characterized by having difficulty in breathing, out of strength and Activity Endurance lowers a kind of disease, mainly by
In pulmonary embolism with pulmonary artery remodeling, causes the raising of pulmonary vascular resistance progressive and right cardiac load to gradually increase, be one
Serious, progressive the and fatefulue disease of kind, it was reported that after acute symptomatic pulmonary embolism occurs, 2 years of CTEPH are accumulated
Disease incidence is 0.1%~9.1%.Caused by incidence generates standard difference of the reason of so huge deviation for judgement, at present still
Data without definite crowd's disease incidence, some data indicate that its disease incidence is about annual 5/1000000 population.Patient diagnoses CTEPH
Median ages be 63 years old, and have no gender differences.Under existing medical technique level, CTEPH is still that one kind is difficult to examine
Disconnected and bad prognosis disease.Therefore, there is an urgent need to find the effective ways of diagnosing and treating CTEPH.
MicroRNA (miRNA) is the endogenic non-coding with adjusting function of one kind found in eucaryote
RNA, size are about 18-25 nucleotide.Mature miRNA is by longer primary transcript by a series of nucleases
Shearing and generate, be subsequently assembled into RNA induce silencing complex (RISC), known by way of base pair complementarity
Other said target mrna, and silencing complex degradation said target mrna is instructed according to the difference of complementarity or hinders the translation of said target mrna.
MiRNA is quite conservative in spore, only in specific tissue and stage of development expression, recent studies have shown that miRNA joins
With various adjusting approach, including development, virus defense, hematopoiesis, orga- nogenesis, cell Proliferation and apoptosis, fat
Metabolism etc., the disease detections such as heart failure and diabetes have gone out relatively special miRNA, in pulmonary hypertension (pulmonary
Hypertension, PH) etc. significant difference expression in a variety of cardiovascular diseases.Some researches show that miRNA let-7d in CTEPH
Pathogenesis in play a significant role.Some researches show that the alpha fibre albumen protogenes and CTEPH neurological susceptibility of miR-759 regulation
It is related.Separately some researches show that miR-125a and miR-204, and key effect is played in PH.Inventor have found miR-3148 with
The development of CTEPH has substantial connection, and proposes possible molecular mechanism.Therefore, miRNA may be the morbidity for studying CTEPH
The important biomolecule molecule of mechanism.
The development and application of bioinformatics provide new method for the research of disease, and the present invention passes through bioinformatics
After analysis, the relevant difference miRNA of chronic thromboembolic pulmonary hypertension disease is filtered out, the biggish miRNA of otherness is taken,
It is verified in clinical blood sample by qPCR.MicroRNA (miRNA) detection is disease in gene as brand-new platform
Level provides diagnosis basis and therapy target is controlled under the premise of not changing the ethics of human inheritance's gene for specific gene
Treatment provides wide development prospect.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of diagnosing chronic thromboembolia type lungs that is used for for being easy to measure to move
The biomarker of arteries and veins high pressure CTEPH.
The invention solves another technical problem be to provide a kind of chronic thromboembolic pulmonary artery easy to operate
High pressure miRNA detection kit.
To achieve the above object, the invention adopts the following technical scheme:
During studying CTEPH disease, it was found that a kind of Microrna marker for CTEPH diagnosis,
The marker is hsa-miR-20a-5p；Its nucleotide sequence is as shown in SEQ ID No.1.
The present invention also provides above-mentioned Microrna markers to prepare the purposes in the product for diagnosing CTEPH disease.
In another embodiment of the present invention, the present invention also provides a kind of chronic thromboembolic pulmonary hypertensions
MiRNA detection kit, including the reagent for measuring hsa-miR-20a-5p marker；It uses U6 as internal reference.
In one embodiment of the invention, the chronic thromboembolic pulmonary hypertension miRNA detection examination
Agent box includes reverse transcription system, quantitative fluorescent PCR reaction system and internal reference system.
It wherein, include for the forward primer of hsa-miR-20a-5p and reversed in the quantitative fluorescent PCR reaction system
Universal primer；It include internal reference U6 and forward primer and reverse primer for U6 in the internal reference system；
The nucleotide sequence of the forward primer for hsa-miR-20a-5p is reversed logical as shown in SEQ ID No.3
With the nucleotide sequence of primer as shown in SEQ ID No.4；The nucleotide sequence of the forward primer for U6 such as SEQ ID
Shown in No.5, for U6 reverse primer nucleotide sequence as shown in SEQ ID No.6.
In one embodiment of the invention, the reagent of the quantitative fluorescent PCR reaction system includes SYBR
Green mixed liquor, forward primer, reversed universal primer and pure water.
In one embodiment of the invention, the reagent of the reverse transcription system includes reverse transcription primer, reversion
Enzyme, reverse transcription buffer, RNase inhibitor and water are recorded, wherein the nucleotide sequence of reverse transcription primer such as SEQ ID No.2 institute
Show.
The present invention has the following advantages compared with the prior art:
(1) miRNA is a kind of new biomarkers in blood, is different from traditional biological marker, stable, minimally invasive and fixed
Amount is accurate, and organized specificity and good stability will greatly improve the sensibility and specificity of medical diagnosis on disease, and such small point
The successful exploitation of sub- RNA biomarker facilitates the auxiliary diagnosis of chronic thromboembolic pulmonary hypertension, is other diseases
The development of biomarker is offered reference.
(2) it is come diagnosing human chronic thromboembolic pulmonary hypertension by the expression for the miRNA for detecting blood sources
The kit of no generation can be used for the auxiliary diagnosis of chronic thromboembolic patients with pulmonary hypertension, help to reflect Chronic Thrombotic
The morbid state of embolic patients with pulmonary hypertension, for clinician quick and precisely grasp conditions of patients, in time take it is more a
Property therapeutic scheme provide support；
(3) strict design and appraisement system are used, the present inventor's initial stage carries out miRNA using bioinformatics method
Analysis, and the method enlarged sample of application QPCR is verified；The application of above method and strategy accelerates and ensure that in blood
The application of miRNA biomarker and diagnostic kit is also the development providing method and strategy of other diseases biomarker
On reference.
Detailed description of the invention
Fig. 1 is miRNA-target prediction result regulated and control network figure；Wherein, triangle represents the miRNA of up-regulation, flechette-type generation
The miRNA that table is lowered, circle are target gene, and arrow indicates regulation direction；
Fig. 2 is that the normal group of QPCR verifying and the relative expression quantity of case group peripheral blood hsa-miR-20a-5p gene are illustrated
Figure.
Specific embodiment
Invention is further explained combined with specific embodiments below.
Experimental method used in following embodiments is conventional method unless otherwise specified.Institute in following embodiments
Material, reagent etc., are commercially available unless otherwise specified.
As known to those skilled in the art, primer sequence of the invention can be made suitable according to the sequence of Research of predicting markers
When adjustment and modification, these modified primer sequences still can be used for detecting the marker.The present invention also includes these
Equivalent technical solution.
1 design of primers of embodiment
According to the sequence of hsa-miR-20a-5p, design primer and probe sequence.Particular sequence is as follows:
The reverse transcription primer sequence SEQ ID No.2 of hsa-miR-20a-5p:
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCT；
The forward primer sequence SEQ ID No.3 of hsa-miR-20a-5p:
GCGCGCTAAAGTGCTTATAGTGC；
The reverse primer sequences SEQ ID No.4 of hsa-miR-20a-5p:
GTGCAGGGTCCGAGGT；
The forward primer sequence SEQ ID No.5:CTCGCTTCGGCAGCACA of U6；
The reverse primer sequences SEQ ID No.6:AACGCTTCACGAATTTGCGT of U6；
Above-mentioned primer is synthesized by Jin Sirui (GenScrip) Biotechnology Co., Ltd.
2 total RNA of embodiment is extracted
(1) by the blood sample fetched (hundred Tyke lysates have been added), 5min is stood on ice.
(2) 200 μ l chloroforms are added, oscillation is placed at room temperature for 2-3min after mixing.4 DEG C of 12,000g are centrifuged 15min.
(3) upper strata aqueous phase is drawn, until in another centrifuge tube.Note: intermediate interface must not be drawn.
(4) isopropanol that equivalent is added mixes, -20 DEG C of precipitatings.
(5) 4 DEG C of 12,000g are centrifuged 10min, abandon supernatant, and RNA is sunken to tube bottom.
(6) 75% ethyl alcohol of 1ml is added, suspend precipitating.
(7) 4 DEG C of 12000g are centrifuged 5min, as far as possible abandoning supernatant.
(8) 5-10min is dried or be dried in vacuo to room temperature.Note: RNA sample not dried excessively, otherwise be difficult to dissolve.
(9) with 20 μ l DEPC H2O dissolves RNA sample.
(10) measurement of RNA purity and RNA are quantitatively with DEPC H2O is control (Blank), takes 2 μ l RNA solutions in enzyme
It marks and detects concentration of specimens and quality on instrument.
The prediction of the miRNA relevant to CTEPH of embodiment 3
Using bioinformatic analysis technology, miRNA-target relationship pair is obtained by miRWalk2.0 software prediction
169, wherein 21 miRNA, 3 up-regulations miRNA, the miRNA of 18 downwards；With the miRNA-target relationship predicted above
To building regulated and control network figure, miRNA-target regulated and control network is shown in Fig. 1, shares 147 nodes, and concrete outcome is detailed in Fig. 1.Its
In, hsa-miR-20a-5p is the miRNA lowered, related to CTEPH disease.
The hsa-miR-20a-5p of 4 RT-qPCR of embodiment verifying differential expression
According to the regulated and control network figure of embodiment 2, chooses hsa-miR-20a-5p and carry out RT-qPCR verifying.
The present embodiment collects Beijing Chaoyang Hospital Attached to Capital Medical Univ.'s chronic thromboembolic pulmonary hypertension disease
Patient peripheral's blood sample detects the expression and specificity of hsa-miR-20a-5p.
RNA extraction process is with embodiment 2, and qualified sample is 16 samples after RNA is detected, and is divided into two groups, every group 8
Sample.
1) reverse transcription reaction
Firstly, carrying out the reverse transcription initial denaturation of miRNA, initial denaturation reaction solution is configured, configuration method is as shown in table 1.
1 miRNA initial denaturation reaction solution of table
| Reagent | Volume |
| RT Primer | 1μl |
| dNTP Mixture(10mM each) | 1μl |
| Template ribonucleic acid | Total RNA:5 μ g or less |
| RNase free dH2O | Up to 10μl |
It is denaturalized, it is cooling rapidly on ice after 65 DEG C of heat preservation 5min, obtain reaction solution after miRNA initial denaturation.
Wherein, the nucleotide sequence of miRNA reverse transcription primer is as shown in SEQ ID No.2.
Then, inverse transcription reaction liquid is prepared in PCR pipe, total amount is 20 μ l, as shown in table 2, is slowly mixed.
2 miRNA reverse transcription reaction system of table
The reaction condition of reverse transcription are as follows:
42℃ 60min
95℃ 5min
2) fluorescent quantitative PCR
For gene hsa-miR-20a-5p and house-keeping gene U6 that needs measure, cDNA template is selected to carry out fluorescent quantitation
Pcr amplification reaction, reaction system and response parameter are as shown in table 3.
3 fluorescent quantitative PCR reaction system of table
| Reagent | Volume |
| SYBR Premix EX Taq(2x) | 10μl |
| Forward primer,10μM | 1μl |
| Reverse primer,10μM | 1μl |
| CDNA (is diluted with water into consistent level) | 8μl |
Reaction condition:
50.0℃ for 3min
95.0℃ for 3min
60 DEG C of to of melting curve, 95 DEG C: Increment 0.5 DEG C of for 10s Plate Read
Wherein, Forward primer is the forward primer for hsa-miR-20a-5p, nucleotide sequence such as SEQ
Shown in ID No.3；Reverse primer is reversed universal primer, and nucleotide sequence is as shown in SEQ ID No.4.
Wherein, the nucleotide sequence of the forward primer of house-keeping gene U6 is as shown in SEQ ID No.5, the nucleosides of reverse primer
Acid sequence is as shown in SEQ ID No.6.
3) it statisticallys analyze
All results are presented in the form of mean value ± SD value, and table is made.The software that data statistic analysis uses is
SPSS22.0, mapping software are Graphpad prism 5 (Graphpad Software, San Diego, CA), P < 0.05 and P
< 0.01 is the screening criteria of significant difference and extremely significant sex differernce.
As a result as shown in Figure 2, verifying through RT-qPCR proves, compared with the control group, the table of experimental group hsa-miR-20a-5p
It is lowered up to amount is significant.
Embodiment 5 analyzes the diagnosis that hsa-miR-20a-5p falls ill to CTEPH
The present embodiment collects Beijing Chaoyang Hospital Attached to Capital Medical Univ.'s chronic thromboembolic pulmonary hypertension disease
Patient peripheral's blood sample 30, normal human sample 30 detects the expression and specificity of hsa-miR-20a-5p.
As a result, it has been found that the expression of hsa-miR-20a-5p is significantly lower than Normal group, difference tool in Patient Sample A
Statistically significant (P < 0.01), hsa-miR-20a-5p are 70% as the specificity of chronic thromboembolic pulmonary hypertension
More than.These results suggest that the expression of hsa-miR-20a-5p can be used for chronic thromboembolic pulmonary hypertension in blood
The auxiliary diagnosis of patient facilitates the morbid state for reflecting chronic thromboembolic patients with pulmonary hypertension.
Obviously, the above embodiment of the present invention be only to clearly illustrate example of the present invention, and not be pair
The restriction of embodiments of the present invention.For those of ordinary skill in the art, may be used also on the basis of the above description
To make other variations or changes in different ways.Here all embodiments can not be exhaustive.It is all to belong to this hair
The obvious changes or variations that bright technical solution is extended out are still in the scope of protection of the present invention.
Claims (1)
1. a kind of Microrna marker is preparing the purposes in the product for diagnosing CTEPH disease, wherein the Microrna
Marker is hsa-miR-20a-5p, and nucleotide sequence is as shown in SEQ ID No.1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810675996.4A CN108728532B (en) | 2018-06-27 | 2018-06-27 | A kind of Microrna marker and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810675996.4A CN108728532B (en) | 2018-06-27 | 2018-06-27 | A kind of Microrna marker and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108728532A CN108728532A (en) | 2018-11-02 |
| CN108728532B true CN108728532B (en) | 2019-05-17 |
Family
ID=63931047
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810675996.4A Active CN108728532B (en) | 2018-06-27 | 2018-06-27 | A kind of Microrna marker and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108728532B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021175846A1 (en) * | 2020-03-02 | 2021-09-10 | Fundació Institut De Recerca De L'hospital De La Santa Creu I Sant Pau | Micrornas markers of thrombosis conditions |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113512583B (en) * | 2021-04-27 | 2022-03-08 | 江汉大学 | Application of exosome cyclic RNA 0109315 as target point in prevention and treatment of benign prostatic hyperplasia |
| ES2976721A1 (en) * | 2022-12-22 | 2024-08-07 | Servicio Andaluz De Salud | Panel of miRNAs for the diagnosis of chronic thromboembolic pulmonary hypertension (Machine-translation by Google Translate, not legally binding) |
-
2018
- 2018-06-27 CN CN201810675996.4A patent/CN108728532B/en active Active
Non-Patent Citations (9)
| Title |
|---|
| AntagomiR directed against miR-20a restores functional BMPR2 signalling and prevents vascular remodelling in hypoxia-induced pulmonary hypertension;Matthias Brock 等;《European Heart Journal》;20120326;第35卷;第3203页摘要、Supplementary material第2页倒数第2-3段、第9页表S2 * |
| Circulating microRNA signature and its novel involvement in pathogenesis of chronic thromboembolic pulmonary hypertension;Lijuan Guo 等;《European Respiratory Society Annual Congress 2012》;20121213;第P1496页 * |
| Differentially Expressed Plasma MicroRNAs and the Potential Regulatory Function of Let-7b in Chronic Thromboembolic Pulmonary Hypertension;Lijuan Guo 等;《Plos One》;20140630;第9卷(第6期);第1页摘要、第2页材料与方法 * |
| Microarray Analysis and Detection of MicroRNAs Associated with Chronic Thromboembolic Pulmonary Hypertension;Ran Miao 等;《BioMed Research International》;20170821;第2017卷;第1页摘要、第2-3页材料与方法 * |
| Microarray expression profile of circular RNAs in chronic thromboembolic pulmonary hypertension;Ran Miao 等;《Medicine》;20171231;第96卷;第2页方法 * |
| MicroRNA expression profile of pulmonary artery smooth muscle cells and the effect of let-7d in chronic thromboembolic pulmonary hypertension;Lei Wang 等;《Pulmonary Circulation》;20130930;第3卷(第3期);第654页摘要、第655-656页材料与方法 * |
| Stem-loop sequence hsa-mir-20a;Accession MI0000076;《miRBase》;20160327;第2页 * |
| 循环microRNA在CTEPH诊断及发病机制中的作用研究;郭丽娟 等;《中华医学会呼吸病学年会-2011（第十二次全国呼吸病学学术会议）论文汇编》;20111231;第101页倒数第1-2段、第102页第2段 * |
| 慢性血栓栓塞性肺动脉高压显著相关的微RNA;缪冉 等;《中华医学杂志》;20180515;第98卷(第18期);第1397页摘要、第1398页材料与方法 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021175846A1 (en) * | 2020-03-02 | 2021-09-10 | Fundació Institut De Recerca De L'hospital De La Santa Creu I Sant Pau | Micrornas markers of thrombosis conditions |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108728532A (en) | 2018-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107385035B (en) | Serum/plasma miRNA marker related to type 2 diabetes retinopathy and application thereof | |
| CN109295218B (en) | Circular RNA marker hsa _ circ _0001788 and application thereof | |
| CN108728532B (en) | A kind of Microrna marker and its application | |
| CN107338324B (en) | Serum lncRNA marker for diagnosing recurrent abortion caused by unknown reasons, primer set, application and kit | |
| CN111518883B (en) | Plasma miRNA marker for coronary heart disease diagnosis and application thereof | |
| CN103382503A (en) | Detection kit and detection method for 19 deletion mutations of EGFR gene exon 19 | |
| CN105176983A (en) | Kit for detecting esophageal squamous carcinoma associated serum miRNAs genes | |
| CN107519193A (en) | Esophageal squamous cell carcinoma early molecule diagnosis marker and its application | |
| TWI758670B (en) | Health risk assessment method | |
| CN109536612B (en) | Plasma miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN109593852B (en) | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN115418397B (en) | Biomarker for auxiliary diagnosis of dilated cardiomyopathy and application thereof | |
| CN114015767B (en) | Serum circRNA marker for identifying craniosynostosis and application thereof | |
| CN116103387A (en) | Biomarker for detecting advanced myopia complicated choroidal neovascularization, detection kit and application | |
| CN108220423A (en) | Acute myocardial infarction fast diagnosis reagent based on blood plasma miRNA and its application in diagnostic kit, appraisal procedure | |
| CN111286532B (en) | Application of circulating nucleic acid as marker of hypertension and coronary heart disease | |
| CN114410795A (en) | Liver cancer early detection based on miRNA (micro ribonucleic acid) feature marker | |
| CN101921863A (en) | MiRNA expression model for diagnosing hepatic diseases independently | |
| CN113718028A (en) | micro-RNA based preeclampsia diagnostic application and composition | |
| CN111286531B (en) | Application of circulating nucleic acid as marker of hypertension, diabetes and hyperlipidemia | |
| RU2742413C1 (en) | Method for diagnosing glial brain tumors of high degree of malignancy | |
| CN117402966A (en) | Gastric cancer marker, primer, kit and application | |
| CN117402964A (en) | Esophageal cancer marker, primer, kit and application | |
| CN117402967A (en) | Lung cancer marker, primer, kit and application | |
| CN106399473A (en) | MiRNA markers for detecting and evaluating effect of strength training or combination thereof and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |