CN111285935B

CN111285935B - Antibody for specifically detecting BRAF gene mutation and application thereof in preparation of cancer detection kit

Info

Publication number: CN111285935B
Application number: CN202010399617.0A
Authority: CN
Inventors: 刘欢; 侯冬雪
Original assignee: Fonda Medical Technology Shanghai Co ltd
Current assignee: Fonda Medical Technology (Shanghai) Co.,Ltd.
Priority date: 2020-05-13
Filing date: 2020-05-13
Publication date: 2020-09-11
Anticipated expiration: 2040-05-13
Also published as: CN111285935A

Abstract

The invention relates to an antibody for specifically detecting BRAF gene mutation and application thereof in cancer detection. The invention adopts the 600E polypeptide to prepare the monoclonal antibody, and finally obtains the monoclonal antibody of specificity aiming at the 600E mutant polypeptide by taking the V600 as the anti-sieve protein, and after the monoclonal antibody is coupled by magnetic beads, the cell capable of specifically detecting the 600E mutation has better specificity and accuracy and better application prospect.

Description

Antibody for specifically detecting BRAF gene mutation and application thereof in preparation of cancer detection kit

Technical Field

The invention relates to the field of antibodies, in particular to an antibody for specifically detecting BRAF gene mutation and application thereof in preparing a cancer detection kit.

Background

The RAF gene is one of the most important protooncogenes widely present in mammals, and there are 3 subtypes ARAF, BRAF, and CRAF. The BRAF has the strongest kinase activity, consists of 18 exons and encodes protein of about 94kDa, and because single base of the 15 th exon generates missense mutation of thymine (T) and adenine (A), valine at the 600 th codon of the translated protein is replaced by glutamic acid to generate protein sequence change, namely V600E mutation. In addition to the V600E mutation, many unique and rare non-hot point mutations were detected in exon 15 of the BRAF gene, such as T599I, T599dup, K601E. Mutation of BRAF gene V600E causes abnormal KRAS/BRAF/MAPK pathway conduction, causes excessive cell proliferation and differentiation to induce tumor, and plays an important role in tumor proliferation, invasion and metastasis.

Research shows that the mutation of BRAF gene V600E in colon adenocarcinoma improves ERK and NF kB activity and mouse embryo NIH3T3 cell transformation capacity, and research adopts RNA interference (RNAi) technology to inhibit the expression of BRAF gene V600E, can effectively reduce MAPK activity, thereby inhibiting cell growth and promoting apoptosis, and defines that the BRAF gene has regulation and control effect on cells. The existing clinical evidence indicates that the BRAF gene V600E mutation has definite prognostic value for colon cancer, and poor clinical results are often caused by high malignancy degree and high lymph node metastasis rate of BRAF gene V600E mutant colon cancer. Ahn et al report that 5-year survival rate of BRAF gene V600E mutant patients is obviously reduced, and the BRAF gene V600E mutant is not related to clinical pathological characteristics of colon cancer, but may be one of important factors of poor prognosis. Research shows that BRAF gene wild type colon cancer patients can benefit from anti-EGFR monoclonal antibody treatment, and the progression-free survival time and the total survival time are obviously superior to those of mutant type.

The mutation of BRAF V600E can promote the methylation of a promoter of a thyrotropin receptor (TSHR) gene, so that TSHR is silenced or the expression is remarkably reduced, the feedback of Thyrotropin (TSH) is increased, and the growth of tumor cells is promoted. The BRAF V600E gene mutation and telomerase reverse transcriptase (TERT) promoter mutation play an important role in the generation of PTC, the proportion of the two in PTC is 7-8%, the possible mechanism is that the BRAFV600E-MAPKFOS-GABP-TERT signal transduction pathway is abnormally activated, and Fructooligosaccharide (FOS) phosphorylated by BRAF V600E kinase plays an important role in the pathway. In addition, the BRAF V600E mutation also promoted PTC by up-regulating TERT expression by the oncogene MYC in a non-TERT promoter mutation-dependent manner. Xing et al found that carrying both BRAF and TERT mutations resulted in a sharp increase in the risk of relapse and death in PTC patients. The research shows that the mutation of BRAF V600E is an important molecular change in the process of PTC formation and progression, and provides a theoretical basis for diagnosis and targeted therapy of PTC.

Based on the relationship between the BRAF gene mutation and the tumor, the detection method for researching the melanoma BRAF gene mutation becomes more important. Sequencing is the most direct method for detecting mutation of BRAF gene. The first generation sequencing methods, also known as direct sequencing methods, include Sanger sequencing and pyrosequencing. The second generation sequencing method (NGS) is abbreviated as NGS, and high-throughput sequencing is realized by technologies such as fragmented DNA and fluorescence labeling PCR. NGS has high requirements on the content and quality of sample DNA. Larsen et al found that DNA degradation due to too long storage time of formalin-fixed paraffin-embedded sections (FFPE) affected the PCR process in mutation detection of melanoma. Excessive melanin deposition in tissues can also affect the PCR process. In addition, in NGS detection, V600E cross-reacts with V600K, and also cross-reacts with other mutations such as V600R.

The V600E mutant amino acid sequence is synthesized by Capper et al according to the constitution of 11 amino acids at the 596-606 th site of BRAF gene, and the mouse is immunized to form hybridoma cell line, thus obtaining the murine monoclonal antibody VE 1. VE1 can show the existence of tumor heterogeneity, shows a small amount of positive tumor cells in a small amount of biopsy specimens, and confirms the proportion of mutant cells in the tumor, thereby playing a complementary role in screening targeted therapy population. VE1 is used as a monoclonal antibody for detecting the mutation of V600E, and has little cross reaction with other sites of BRAF. The V600K mutation accounts for about 20% of the BRAF gene point mutation, and is the second largest class of mutation next to the V600E mutation. Studies in Kakavand et al and Tetzlaff et al showed cross-reactivity of VE1 with V600K of 2% and 0%, respectively. Therefore, the immunohistochemistry method can specifically detect the V600E mutant protein of BRAF gene, but cannot simultaneously detect other types of mutant proteins such as V600K. However, the research does not provide a specific structural form of the antibody, and researchers cannot obtain the corresponding monoclonal antibody.

Based on the above defects, the provision of domestic monoclonal antibodies capable of specifically binding to BRAF V600E protein becomes an urgent need.

Disclosure of Invention

The invention provides an immune polypeptide, BRAF V600E protein: gdfglateksrw;

the invention further provides an immune polypeptide, BRAF V600 protein: gdfglatvksrw;

the invention also provides a preparation method of the monoclonal antibody specifically aiming at the BRAF V600E protein, which is characterized in that the monoclonal antibody is prepared by taking the BRAFV600E protein as immunogen, and meanwhile, the BRAF V600 protein is taken as a back screen, so that nonspecific antibodies are removed, and the specific antibodies are obtained.

The present invention provides a monoclonal antibody: the light chain variable region sequence is shown as SEQ ID NO: 1, the heavy chain variable region sequence is shown as SEQ ID NO: 2.

the invention also provides a method for detecting the BRAF V600E protein mutant cell, which adopts the monoclonal antibody of the invention to detect.

The invention also couples the monoclonal antibody by using magnetic beads, and is used for detecting BRAF V600E protein mutant cells.

Specifically, the magnetic bead coupling method of the invention comprises the following steps: 1) activation of carboxyl magnetic beads: mixing the carboxyl magnetic beads with an MES solution, magnetically separating, standing, discarding the supernatant, re-suspending in the MES solution, ultrasonically performing magnetic separation, discarding the supernatant, washing, re-suspending in the MES solution, and then adding an EDC solution according to the mass ratio of the carboxyl magnetic beads to the EDC solution of 5:5 for activation to obtain activated carboxyl magnetic beads;

2) coupling of the antibody: magnetically separating the activated carboxyl magnetic beads obtained in the step 1), re-suspending in a MEST solution, performing covalent coupling according to the mass ratio of the carboxyl magnetic beads to a 600E-7 monoclonal antibody solution of 1: 2, washing with a PBST solution, and re-suspending in a PBS solution to obtain immunomagnetic beads; the covalent coupling was performed in MES solution containing 0.05% (v/v) Tween-20 and pH 6. And preparing the corresponding immunomagnetic bead monoclonal antibody.

The antibodies of the invention may also be Fab fragments. Magnetic bead coupling may also be performed using other methods commonly used in the present invention.

Advantageous effects

According to the invention, the BRAF V600E protein is adopted to prepare the monoclonal antibody, the BRAF V600 protein is taken as the anti-screening protein to finally obtain the monoclonal antibody of the polypeptide specifically aiming at the mutation of the BRAF V600E protein, and after the monoclonal antibody is coupled by magnetic beads, the cell capable of specifically detecting the mutation of the BRAF V600E protein has better specificity and accuracy.

Drawings

Fig. 1 BRAF V600 protein and BRAF V600E protein expression profiles.

FIG. 2 is an SDS-PAGE image of the antibody.

FIG. 3 is a graph of cell capture.

Detailed Description

The following describes in further detail embodiments of the present invention. The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

EXAMPLE 1 preparation of immunogen

According to the preparation requirement of the monoclonal antibody with the V600 specificity of the target site, the optimized immune polypeptide site is selected by analysis according to the structural characteristics of the BRAF protein, and is respectively the BRAF V600E protein: gdfglateksrw and BRAF V600 proteins: gdfglatvksrw; 4-fold repeated units are respectively used as immunogens to strengthen subsequent immunological activities. According to the expression characteristics of Escherichia coli, corresponding coding sequences are respectively obtained:

BRAF V600E protein coding sequence:

1 GGTGACTTTG GTCTGGCGAC CGAGAAAAGC CGTTGGGGTG ATTTTGGCCT GGCAACCGAGAAATCTCGTT

71 GGGGCGACTT CGGCCTGGCT ACCGAAAAAT CCCGTTGGGG CGACTTTGGC CTGGCAACGGAAAAATCCCG

141 CTGG

BRAF V600 protein coding sequence:

1 GGTGACTTTG GTCTGGCAAC CGTAAAATCT CGTTGGGGCG ACTTCGGTCT GGCGACGGTTAAATCCCGTT

71 GGGGTGATTT CGGCCTGGCG ACTGTCAAAA GCCGCTGGGG TGACTTCGGC CTGGCTACTGTTAAATCTCG

141 CTGG

NdeI restriction site and EcoRI restriction site are respectively added at two ends of the gene, and the gene is synthesized by Shanghai Biotechnology Limited company.

The synthesized gene product was ligated into the vector pMD-18T, JM109 was transformed, positive clones were selected, after correct sequencing the plasmids pMD-18T/V600 and pMD-18T/600E and pET28a (+) vector were double digested with NdeI and EcoRI, ligated overnight at 16 ℃ and the recombinant plasmid was transformed into BL21 (DE 3). Positive clones were selected on 0.1g/L kanamycin-resistant plates and protein expression was induced with IPTG at a final concentration of 1 mM. The induced cells were disrupted, purified by Ni column, and the purified protein was subjected to SDS-PAGE, and the results are shown in FIG. 1. 600E of the target protein is produced at the 5.4kD position in lane 1, the blank plasmid controls in

lanes

2 and 3 are void of the target protein, and V600 at the 5.3kD position in lane 4. And the gene amplification effect of the target protein producing strain is verified through PCR, a target fragment is successfully amplified, and the target protein is successfully obtained through two aspects of gene and protein.

EXAMPLE 2 preparation of monoclonal antibodies

The method comprises the steps of emulsifying a Freund complete adjuvant with an equal volume of antigen (100 mg/mL of the polypeptide protein in example 1) for the first time, injecting 30 ug/mouse subcutaneously and inguinal injection, emulsifying the Freund incomplete adjuvant and the equal volume of antigen every 14 days, immunizing the mouse alternately by abdominal cavity and subcutaneous injection by 30 ug/mouse, immunizing for 4 times, collecting blood by tail vein, and determining the titer of the anti-antibody in serum of the immunized mouse by an indirect ELISA method, wherein the total number of the antibodies is 12.

The titer of anti-BRAF V600E protein antibody in immune serum is determined by tail vein blood collection. The steps are briefly described as follows, a BRAF V600E protein 1ug/ml, 100 ul/well coating polystyrene ELISA plate, 4 ℃ coating for 16 h, 0.25% casein blocking liquid 300 ul/well and 4 ℃ blocking for 24 h. Respectively adding diluted mouse immune serum with multiple times ratio and 100 ul/hole into an ELISA plate, taking normal mouse serum with the same dilution as a negative control, incubating for 1h at 37 ℃, washing for 5 times by using 0.1% PBS-T, adding marked HRP goat anti-mouse IgG diluted with 1:1000, incubating for 30 min at 37 ℃, washing for 8 times as above, adding TMB developing solution and 100w 1/hole, keeping the room temperature away from light for 10min, stopping the reaction by using 1M H2SO 4100 ul/hole, and reading the A450 value by using an ELISA reader. The serum of a normal mouse is used as a negative control, and the maximum dilution with the ratio of the measured value to the negative control value being more than or equal to 2.1 is used as the titer of the serum antibody of the immunized mouse. The results are shown in Table 1.

TABLE 1 Indirect ELISA determination of serum antibody titers in immunized mice

Selecting No. 9 mouse with highest antibody titer, performing intravenous booster immunization for 1 time, wherein the antigen amount is 10 ug/mouse, and taking splenocytes after 3 days to prepare hybridoma. Specifically, after the mouse eyeballs are exsanguinated, cervical dislocation is killed, the mouse spleen is sterilized by 75% alcohol, the mouse spleen is taken out in a biological safety cabinet through aseptic operation, the mouse spleen is ground on a copper net to prepare cell suspension, the cell suspension is washed three times by PBS, supernatant is removed through centrifugation, 36m1 1640 culture solution containing 15% FBS is used for re-suspending cells, the cell suspension is evenly distributed into 6 pieces of cell culture plates with holes, the cell culture plates are about 60 ul/hole, the cell suspension is cultured for standby use in a 5% CO2 incubator at 37 ℃, immune mouse spleen cell suspension is prepared, mouse myeloma NS-1 cells and spleen cells in logarithmic growth phase are evenly mixed according to the proportion of 1:4, the cell suspension is centrifuged for 5min at the room temperature of 1000rpm, the supernatant is discarded,

slowly adding 1ml PEG 1450 in water bath at 37 deg.C within 1min, gently shaking while adding, stopping fusion in 1min, 2 min, 3 min, 4 min, and 5min respectively with 1ml, 2ml, 3 ml, 4ml, and 5ml RPMI 1640, adding 10 ml of FBS-containing 1640 culture medium, centrifuging at 1000rpm for 5min at room temperature, discarding supernatant, re-suspending the fused cells with 36 ml of the above culture medium, uniformly distributing into 96-well plate containing feeder cells, standing at 37 deg.C and 5% CO at 60 ul/well₂The culture was carried out overnight in an incubator.

2X HAT selection medium was added to 96-well plates at 120 ul/well, and then the medium was changed every 2 days with 1X HAT selection medium. When the fused cell clone grows to 1/10 of the culture hole area, the culture supernatant is selected by BRAF V600E protein for screening, the positive cell strain is subjected to reverse screening by the BRAF V600 protein to remove the cell which reacts with the specificity of the BRAF V600 protein, after 5 times of cell fusion, the hybridoma cell strain 8 strain which is specifically combined with the BRAF V600E protein antibody is obtained by screening finally, wherein the strongest strain is named as 600E-7, and the strongest strain is cloned, established and stored.

EXAMPLE 3 preparation of monoclonal antibodies

(1) Preparation of monoclonal antibody ascites 600E-7 hybridoma cell strain is cultured to logarithmic growth phase, centrifuged to collect cells, washed with precooled PBS for 2 times, resuspended in appropriate amount of precooled 1640 medium, and suspended according to 3X10⁶-6X10⁶Intraperitoneal injection of each mouse (mice are injected with Freund's incomplete adjuvant 0 in an umbrella-shaped manner in the abdominal cavity before 1 week5 ml), ascites was collected after about 2 weeks, ascites supernatant was collected after centrifugation, and sodium azide was immediately added to a final concentration of 0.1% and stored at 4 ℃ for further use.

(2) Purification of the monoclonal antibody adopts an octanoic acid-ammonium sulfate precipitation method to purify ascites prepared by hybridoma cells. The procedure is briefly described as follows, 20M1 sodium acetate buffer (0.06M, pH 4.4) is added to l0ml monoclonal anti-ascites, stirred at room temperature and octanoic acid is slowly added, left to stand in ice bath for 2 hours, centrifuged to collect the supernatant, and added

Adding O.1M PBS to final concentration of 0.01M, adjusting pH to 7.4 with NaOH, stirring in ice bath, and slowly adding

Adding sulfuric acid to a final concentration of 45%, standing at 4 deg.C overnight, centrifuging at 12000 rpm at 4 deg.C to remove supernatant, precipitating

Dissolving in 0.01M PBS containing 0.2 mM EDTA, dialyzing at 4 deg.C to remove ammonium sulfate, determining antibody protein concentration with Nanodrop 2000 ultramicro spectrophotometer, determining antibody purity by 10% SDS-PAGE gel electrophoresis, adding 50% glycerol, and freezing at-80 deg.C. As shown in FIG. 2, the antibody protein was decomposed into 2 identical heavy chains by heating with mercaptoethanol, and the purity was 90% or more at a position of 25kD relative to a molecular weight of 50kD and 2 identical light chains.

Example 4 detection of antibody Properties

The Ig subclass is identified by a rapid qualitative test paper method, and the specific operation is carried out according to an instruction book. Preparation of monoclonal antibody the monoclonal antibody was prepared as in example 3. And (3) measuring the titer of the purified antibody by using an indirect immunofluorescence labeling method. The identification of the 600E-7 monoclonal antibody by a rapid qualitative test paper method shows that the heavy chain is IgGl and the light chain is kappa. The ascites inducing method is adopted to produce the monoclonal antibody, and the protein content of the monoclonal antibody after ascites purification is about 20 mg/ml. The result of the immunofluorescence analysis shows that the titer of the purified monoclonal antibody is more than 1: 130000.

Example 5 identification of antibody binding characteristics

Antibody binding and dissociation constants were determined using Fortibio. The affinity of the anti-600E-7 mAb was determined using an OctetRED (Fortebio, USA) instrument. The concentration of PBS diluted antibody is 10 mug/mL, and an AHC sensor is coated; PBS is used as a control, the concentration of the diluted 600E-7 monoclonal antibody is 0.0001. mu.g/mL, 0.001. mu.g/mL, 0.01. mu.g/mL, 0.1. mu.g/mL, 1. mu.g/mL, 3. mu.g/mL and 10. mu.g/mL, and the binding and dissociation curve of the interaction of the 600E-7 antibody and the BRAF V600E protein is determined; and (5) calculating the dissociation constant of the interaction of the two by using a GlobeFitting fitting curve. As a result, the dissociation constant of the monoclonal antibody obtained by the invention reaches 0.04 nM. In addition, the antibody had an IC50 of 42nM against a375 cells using assays commonly used in the art.

EXAMPLE 6 determination of antibody sequences

Total RNA was extracted from the cultured mouse 600E-7 monoclonal cell line using Trizol reagent. The procedure is briefly described below, centrifugation 5X10⁶The cells were transferred to a 1.5ml centrifuge tube and the supernatant was blotted dry. 1ml of Trizol reagent was added and repeatedly blown several times and then left at room temperature for 5 minutes for cell lysis. Subsequently, 0.2ml of chloroform solution was added to each tube, and the tube was vigorously shaken for 15 seconds and then left at room temperature for 3 minutes. Then, the centrifuge tube was centrifuged at 12000g at 4 ℃ for 10 minutes, the tube was removed, the upper aqueous phase solution was aspirated into a new 1.5ml centrifuge tube, and 0.4ml of isopropanol was added to precipitate RNA from the aqueous phase. After mixing the EP tube by hand and leaving at room temperature for 10min, centrifuge at 12000g at 4 ℃ for 10min and discard the supernatant. 1ml of 75% ethanol was added, and the mixture was centrifuged again at 4 ℃ and 7500rpm for 5min, and the supernatant was discarded. After the bottom RNA pellet was dried at room temperature for 10 minutes, 30 to 50ul of sterile DEPC-treated water was added to dissolve the RNA sample.

Total RNA was converted to cDNA using a reverse transcription cDNA kit. The assay was prepared as follows, 5. mu.l total RNA + 0.5. mu.l Oligo (dT) + 8.5. mu.l RNase-free water (total 14ul) were pre-denatured at 65 ℃ for 5min and then placed on ice for 2 min. Further, 4. mu.l of 5 Xbuffer solution + 1. mu.l of dNTP mixture + 0.5. mu.l of RNase inhibitor + 1. mu.l of reverse transcriptase (20.5 ul system in total) were added thereto, and after preparation, they were mixed well, and run for 40 ℃ for 50 minutes and 70 ℃ for 10 minutes using a PCR instrument, thereby completing cDNA synthesis.

The cDNA was further added with Poly G at the 3' end, and the reaction system was prepared as follows: mu.l of cDNA sample + 33.5. mu.l of ddH₂O + 5. mu.l of 10XTdT buffer + 5. mu.l of CoCl₂+ 1. mu.l dGTP + 0.5. mu.l terminal deoxynucleotidyl transferase (total volume 50ul), mixed well, run using PCR instrument at 37 ℃ for 30 minutes, 70 ℃ for 10min,poly G tailing was completed.

Further, gene amplification of the antibody variable region was carried out using the tailed cDNA as a template. For the sequence of the heavy chain variable region of the amplified antibody, a PCR reaction system is prepared: 10 XTaq enzyme buffer 5. mu.l + Universal poly C primer (forward primer) 0.5. mu.l + mouse IgG1 reverse primer 0.5. mu.l + dNTP 1. mu.l + Taq polymerase 1. mu.l + cDNA 1. mu.l + ddH2O 41. mu.l. For the sequence of the amplified antibody light chain variable region, a PCR reaction system is prepared: 10 × Taq enzyme buffer 5. mu.l + Universal poly C primer (forward primer) 0.5. mu.l + mouse IgG kappa chain reverse primer 0.5. mu.l + dNTP 1. mu.l + Taq polymerase 1. mu.l + cDNA 1. mu.l + ddH2O 41. mu.l. The temperature cycles for PCR amplification of the antibody heavy and light chain variable regions were as follows (with steps 2 to 4, repeated for 25 cycles):

1-pre-denaturation at 95 ℃ for 5min.

2-denaturation at 95 ℃ for 20sec.

3-anneal 56 deg.C, 20sec.

4-extension 72 ℃ 30sec.

5-storing at 25 ℃ for 60 min;

the PCR products were analyzed by 1% agarose gel electrophoresis, bands of DNA segments of corresponding size were excised, and DNA was extracted using Qiagen's gel DNA recovery kit. Briefly described as follows: the gel was weighed, added with 3 gel volumes of QG buffer, and then incubated at 50 degrees for 10 minutes until the gel was completely dissolved. After adding isopropanol of 1 gel volume and mixing, the sample was transferred to a QIA purification column and centrifuged at 13000rpm for 1 minute. 750ul of PE buffer was added to the column, followed by centrifugation at 13000rpm for 1 minute. And centrifuged again at 13000rpm for 1 minute to remove the liquid residue from the column. Adding 30ul of water to the elution column, centrifuging for 1 minute to obtain a prepared DNA sample, and sequencing the purified PCR product to obtain the variable region sequence of the antibody. The results show that the light chain variable region sequence is shown as SEQ ID NO: 1, the heavy chain variable region sequence is shown as SEQ ID NO: 2, respectively.

Example 7 preparation of immunomagnetic bead antibody

1) Activation of carboxyl magnetic beads: mixing the carboxyl magnetic beads with an MES solution, magnetically separating, standing, discarding the supernatant, re-suspending in the MES solution, ultrasonically performing magnetic separation, discarding the supernatant, washing, re-suspending in the MES solution, and then adding an EDC solution according to the mass ratio of the carboxyl magnetic beads to the EDC solution of 5:5 for activation to obtain activated carboxyl magnetic beads;

Example 8 cell assay

A cryopreservation tube of 1mL cell suspension of BRAF V600E B-Raf mutated A375 melanoma cells and HEK 293T cells is taken and rapidly shaken in a water bath at 37 ℃ for thawing, and 5mL culture medium is added and uniformly mixed. Centrifuging at 1000RPM for 5min, discarding supernatant, adding 4-6mL complete culture medium, and blowing well. All cell suspensions were then added to the flask and incubated overnight (or cell suspensions added to 6cm dishes). The next day the fluid was changed and cell density was checked. If the cell density reaches 80-90%, subculture can be carried out. And collecting the cells for later use after cell passage.

The cell concentration was adjusted to 10 and 10, respectively²、10³、10⁴cfu/mL, adding 50ul of prepared immunomagnetic bead suspension into each concentration of cell suspension, and gently mixing at 37 ℃; after 1 hour, taking out the centrifuge tube, placing the centrifuge tube on a magnetic separation frame, standing for 1 minute, suspending the centrifuge tube in 400 ul PBS, and placing the centrifuge tube on the magnetic separation frame again; repeatedly washing for 3-5 times to remove cells which are not specifically combined with the immunomagnetic beads; finally, the cells were resuspended in 100. mu.l of PBS buffer, and the amount of captured immunomagnetic beads was measured by plate counting. The results are shown in FIG. 3. The antibody of the invention has better binding property and detection specificity, the mutant cell can be basically recognized by the antibody of the invention, but the antibody of the invention can not recognize 293T cell, which shows that the BRAF V600E gene mutation does not exist in the 293T cell, and further verifies the specificity of the antibody of the invention.

Sequence listing

<110> Beijing Guangdong Biotechnology Ltd

<120> antibody for specifically detecting BRAF gene mutation and application thereof in preparation of cancer detection kit

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>108

<212>PRT

<213>2 Ambystoma laterale x Ambystoma jeffersonianum

<400>1

Asp Ile Val Ile Thr Gln Ser Pro Ala Leu Met Ala Ala Ser Pro Tyr

1 5 10 15

Glu Lys Arg Thr Ile Thr Cys Pro Ser Ala Asp Asp Ile Ala Ser Ser

20 25 30

Tyr Phe Cys Trp Tyr Gln Gln Lys Ser Gly Ile Ser Pro Lys Pro Trp

35 40 45

Ile Tyr Tyr Cys Ser Asn Ser Ser Asp Gly Val Pro Ala Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Thr Ser Met Glu

65 70 75 80

Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Ala Tyr Trp Asp Leu Ala Ser

85 90 95

Gln Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys

100 105

<210>2

<211>116

<212>PRT

<213>2 Ambystoma laterale x Ambystoma jeffersonianum

<400>2

Glu Val Gln Leu Glu Glu Ser Gly Thr Glu Leu Ala Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Glu Ser Cys Lys Ala Ser Gly Tyr Ile Phe Ser Val Ile

20 25 30

Trp Ser Gly Trp Ile Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Arg Ala Tyr Pro Ser Phe Ile Asp Thr Gln Tyr Thr Gln Thr Gly

50 55 60

Ser Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Ala Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Gly Arg Ser Cys Ala Cys Phe Ala Trp Gly Leu Gly Thr Thr Leu

100 105 110

Ala Val Ser Ser

115

Claims

1. A monoclonal antibody that specifically binds to BRAF V600E protein, wherein the amino acid sequence of the variable region of the light chain of said antibody is as set forth in SEQ ID NO: 1, the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO: 2, respectively.

2. A test kit comprising the monoclonal antibody of claim 1.

3. Use of the monoclonal antibody of claim 1 in the preparation of a kit for detecting cancer cells mutated in the BRAF gene V600E.

4. Immunomagnetic beads, characterized in that the monoclonal antibody of claim 1 is coupled to magnetic beads.

5. The immunomagnetic bead of claim 4, prepared by the following steps: 1) activation of carboxyl magnetic beads: mixing the carboxyl magnetic beads with an MES solution, magnetically separating, standing, discarding the supernatant, re-suspending in the MES solution, ultrasonically performing magnetic separation, discarding the supernatant, washing, re-suspending in the MES solution, and then adding an EDC solution according to the mass ratio of the carboxyl magnetic beads to the EDC solution of 5:5 for activation to obtain activated carboxyl magnetic beads;

2) coupling of the antibody: magnetically separating the activated carboxyl magnetic beads obtained in the step 1), re-suspending in a MEST solution, performing covalent coupling according to the mass ratio of the carboxyl magnetic beads to a BRAF V600E protein monoclonal antibody solution of 1: 2, washing with a PBST solution, and re-suspending in a PBS solution to obtain immunomagnetic beads; the covalent coupling was performed in MES solution containing 0.05% (v/v) Tween-20 and pH 6.

6. Use of the immunomagnetic beads of claim 4 or 5 in the preparation of a kit for detecting cancer cells with mutation of BRAF gene V600E.