CN111285920A

CN111285920A - Amino acid sequence and nucleotide sequence of specific binding mycobacterium tuberculosis and application thereof

Info

Publication number: CN111285920A
Application number: CN202010162607.5A
Authority: CN
Inventors: 薛頔; 魏萌萌; 林雪; 王玉炯
Original assignee: Ningxia University
Current assignee: General Hospital of Ningxia Medical University
Priority date: 2020-03-10
Filing date: 2020-03-10
Publication date: 2020-06-16
Anticipated expiration: 2040-03-10
Also published as: CN111285920B

Abstract

The invention discloses an amino acid sequence specifically combined with mycobacterium tuberculosis or a derivative thereof, wherein the amino acid sequence or the derivative thereof contains a nucleotide sequence shown as SEQ ID NO: 1. The invention also discloses a nucleotide sequence for coding the amino acid and application of the amino acid sequence. The amino acid sequence disclosed by the invention can be specifically combined with mycobacteria, is used for diagnosing tuberculosis, improves the diagnostic sensitivity and specificity and provides a new method for tuberculosis targeted diagnosis.

Description

Amino acid sequence and nucleotide sequence of specific binding mycobacterium tuberculosis and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an amino acid sequence and a nucleotide sequence for specifically binding mycobacterium tuberculosis and application thereof.

Background

Tuberculosis (TB) caused by Mycobacterium Tuberculosis (m.tb) infection is a worldwide infectious disease that seriously threatens public health safety. In the aspect of tuberculosis treatment, although most patients can be recovered through drug treatment, a small amount of residual bacteria still exist in the bodies of the patients after recovery, and when the bodies are in an immune suppression state or low in immunity, the residual bacteria can be proliferated in a large amount, so that tuberculosis is caused again. With the recent emergence of M.tb multi-drug resistant strains, cross infection of tuberculosis pathogens, increase of population mobility, neglect of tuberculosis control and other factors, the control difficulty of tuberculosis is increased.

Macrophages are the main initial effector cells of the body against m.tb infection and are also the main host cells for latent m.tb infection. The interaction relationship between m.tb and macrophages is extremely complex, and firstly, m.tb enters into the body from the respiratory tract and is taken up into cells by macrophages through phagocytosis to stimulate the macrophages to produce cytokines and chemokines which play important roles in inducing innate immunity, acquired immunity and apoptosis. When m.tb is present in mature phagosomes, lysosomal enzymes, antimicrobial peptides, etc. in macrophages can further kill m.tb. Tb itself has multiple mechanisms to escape macrophage killing, including altering the uptake pattern of macrophages, inhibiting and counteracting acidification of phagosomes, inhibiting phagolysosome formation, inhibiting apoptosis of macrophages, etc., ultimately leading to latent infection of the body.

In 1985, Smith firstly inserted foreign genes into filamentous phage genes, and displayed the polypeptides encoded by target genes on the phage surface in the form of fusion proteins, thereby creating phage display technology, and starting a new chapter of targeted peptide research. The phage display technology takes an antigen epitope as an entry point to screen out short peptides which can be specifically combined with M.tb. Smith inserts a gene fragment of EcoRI endonuclease into coat protein gene gIII of filamentous phage by means of genetic engineering, so that the fragment of EcoRI endonuclease is expressed in fusion with coat protein PIII of phage. The technology can fuse exogenous genes and filamentous phage coat protein genes, so that exogenous proteins or polypeptides are fused and expressed at the N end of P VIII or P III in the form of fusion proteins and then displayed on the surfaces of phage particles. The displayed protein or polypeptide can maintain relatively independent spatial structure and biological activity, and does not affect the packing and replication of the phage. By biopanning, polypeptides that bind to a target molecule can be selectively obtained from phage libraries, thereby isolating phage that display proteins that specifically bind to the target protein. The application of phage display technology to imaging and treatment of diseases is an emerging disease diagnosis and treatment concept.

Early diagnosis is the primary link for treating and stopping tuberculosis, but the traditional biological techniques such as a mirror identification method and a culture method have the defects of false positive, easy pollution, long time consumption, incapability of quantification and the like, and are difficult to develop in a basic laboratory; with the continuous development of molecular diagnosis technology, full-automatic real-time fluorescence nucleic acid amplification and other technologies are derived, and the method has the defects of high cost, great technical difficulty and the like, and cannot be generally used. Generally, the existing laboratory diagnostic methods have many limitations, and it is necessary to find a rapid, accurate, economical and convenient diagnostic method.

Disclosure of Invention

The purpose of the invention is as follows: aiming at the cost, technical defects and shortcomings of detection of tuberculosis caused by mycobacterium tuberculosis, the invention aims to provide an amino acid sequence which is specifically and specifically combined with mycobacterium for diagnosing tuberculosis, improving the diagnostic sensitivity and specificity and providing a new method for targeted diagnosis of tuberculosis. The invention provides a nucleotide sequence for coding the amino acid sequence. The invention also provides application of the amino acid sequence.

The technical scheme is as follows: the invention provides an amino acid sequence or a derivative thereof specifically binding to mycobacterium tuberculosis, wherein the amino acid sequence or the derivative thereof contains a nucleotide sequence shown as SEQ ID NO: 1.

The second aspect of the invention provides a short peptide or a derivative thereof specifically binding to mycobacterium tuberculosis, wherein the sequence of the short peptide is shown as SEQ ID NO:1 is shown.

In a third aspect, the invention provides a nucleotide sequence encoding the above short peptide, wherein the nucleotide sequence is as shown in SEQ ID NO:2, respectively.

The fourth aspect of the invention provides the application of the amino acid sequence or the short peptide or the nucleotide sequence in the preparation of a kit or a product for detecting mycobacterium tuberculosis.

The fifth aspect of the invention provides a kit or a product for detecting mycobacterium tuberculosis, wherein the kit or the product contains the amino acid sequence or the short peptide or the nucleotide sequence.

The sixth aspect of the invention provides application of the short peptide or the polypeptide in preparation of a tuberculosis drug carrier.

The seventh aspect of the present invention provides a method for detecting mycobacterium tuberculosis, which comprises the step of detecting mycobacterium tuberculosis by using a probe comprising the nucleotide sequence shown as SEQ ID NO:1 or the amino acid sequence as shown in SEQ ID NO:2 to detect the mycobacterium tuberculosis.

The method for screening the short peptide comprises the following steps:

(1) coating M.tb on a flat plate, adding a phage display random heptapeptide library into the coated and sealed flat plate for affinity panning, performing cycle of adsorption, washing, elution and amplification, and determining the titer of phage after each panning through biological panning;

(2) randomly selecting a plurality of phages from a counting plate, selecting each phage to E.coli ER2738 bacterial liquid with OD0.5, culturing for 4-5h, centrifuging, taking supernatant, adding PEG-8000/NaCl to precipitate the phages, centrifuging, dissolving the obtained precipitate with a proper amount of TBS solution, and obtaining the monoclonal amplification product of each phage;

(3) adding the phage monoclonal amplification product to a plate coated with M.tb, measuring the binding strength of each phage to mycobacterium tuberculosis by phage ELISA, sequencing the phage with the strongest binding strength, and analyzing the sequencing result to obtain the short peptide.

Has the advantages that: (1) the invention carries out panning by using a phage display technology, provides an amino acid sequence, is used for diagnosing tuberculosis by the specific and specific combination of the amino acid sequence and the combined mycobacterium, improves the diagnostic sensitivity and specificity, and can be used for tuberculosis targeted diagnosis; (2) the amino acid sequence provided by the invention can also utilize the characteristic that the screened polypeptide is specifically combined with M.tb, can be used as a targeting peptide for tuberculosis treatment, plays an active targeting role in entering and delivering a tuberculosis medicament, and is specifically combined with the bacterial surface of the M.tb to achieve the effect of targeted delivery; (3) the invention provides an amino acid sequence specifically combined with mycobacterium tuberculosis and a derivative thereof, and the amino acid length is very small, so the amino acid sequence is low in toxicity, has no obvious damage effect on peripheral normal cell tissues, can be quickly eliminated at a non-target position, and cannot bring burden to an organism; (4) the heptapeptide specifically combined with mycobacterium tuberculosis provided by the invention can be optimized according to clinical requirements, and can also adjust the structure to increase the stability of protease degradation and control the half-life period in vivo. The replacement antibody is used as a detection element to detect the mycobacterium tuberculosis, so that a target is better combined; (5) the heptapeptide specifically combined with the mycobacterium tuberculosis has high stability and is easy to store and transport; (6) the heptapeptide specifically combined with mycobacterium tuberculosis and the coding gene for artificially synthesizing the heptapeptide are provided by the invention, so that the in-vitro synthesis is convenient, the preparation process is simplified, and the cost is saved.

Drawings

FIG. 1 shows the P-ELISA assay results of 20 selected phage clones, in which the abscissa of the graph is phage clone and the ordinate is OD450 value, and M.tb cfu is 5X 10 cfu⁸；

FIG. 2 shows the results of M.tb in a competition ELISA assay showing the OD values plotted against the concentration of M.tb, on the abscissa of the graph, the concentration of M.tb and on the ordinate of the graph, the OD450 value;

fig. 3 is a graph of immunohistochemistry of lungs of a mouse model of tuberculosis injected with Thanos1, in which a graph is a control group and B graph is an m.tb group.

Detailed Description

First, experimental reagent

LB culture medium: 10g of peptone, 5g of yeast extract and 5g of NaCl per liter, autoclaved and stored at room temperature.

LB/IPTG/Xgal plates: LB medium +15g/L agar powder. Autoclaving, cooling to below 70 deg.C, adding 1mL IPTG/Xgal, mixing and pouring onto a plate. The plates were stored at 4 ℃ in the dark.

Top agar layer: each liter contains 10g of peptone, 5g of yeast extract, 5g of NaCl and 7g of agar powder. Autoclaving, dividing into 50ml aliquots, storing the solid medium at room temperature, and thawing with a microwave oven.

Tetracycline stock solution: dissolved in 70% ethanol at a concentration of 20mg/mL, stored at-20 ℃ in the dark and shaken well before use.

LB-Tet plates: LB medium +15g/L agar powder. Autoclaving, cooling to below 70 deg.C, adding 1mL tetracycline stock solution, mixing, pouring onto a plate, and storing at 4 deg.C in the dark.

PEG/NaCl: 20% (w/v) PEG-8000, 2.5M NaCl, autoclaved, stored at room temperature.

IPTG/Xgal formulation 1.25g of IPTG (isoproyl β -D-thiogalactoside) and 1g of Xgal were dissolved in 25mL of dimethylformamide and stored at-20 ℃ in the dark.

TBS: 50mM Tris-HCl (pH 7.5), 150mM NaCl. Autoclaving, and storing at room temperature.

PBST solution: tween20 was added to the PBS solution in a volume ratio of 0.05%/0.02%.

Iodide buffer solution: 10mM Tris-HCl (pH 8.0), 1mM EDTA, 4M NaI. Storing at room temperature in dark.

0.2M Glycine-HCl (pH2.2), 1M Tris-HCl (pH 9.1), autoclaved, and stored at room temperature.

Phage display: the 7-Peptide Kit (7Phage Display Peptide Library Kit) was supplied by NEB.

Second, experimental results

Example 1: amplification and purification of phage libraries

Inoculating E.coli ER2738 single colony in 5-10ml LB liquid culture medium, and shaking at 37 deg.C and 200rpm to logarithmic phase (OD600 ≈ 0.5); adding 10ul bacteriophage (from NEB company), shaking at 37 deg.C and 200rpm for 4-5 hr, centrifuging at 10000g for 10min, and collecting supernatant; centrifuging at 10000g for 10min again, collecting 80% supernatant, adding 1/6 volume of PEG8000/NaCl, and standing at 4 deg.C overnight. Taking out the white precipitate as the phage in the next day. Centrifuging at 10000g for 15 min, pouring off the supernatant, centrifuging instantaneously and then sucking out the residual solution slightly; 1ml TBS solution was added to dissolve the white precipitate.

Example 2: panning and identification of m.tb binding heptapeptides

(1) Phage titer determination

Inoculating E.coli ER2738 single colony in 5-10ml LB liquid culture medium, and shaking at 37 deg.C and 250rpm to logarithmic phase (OD600 ≈ 0.5); heating and melting the top agarose culture medium by a microwave oven, dividing into 3 mL/portion, subpackaging into sterilized test tubes, and storing at 45 ℃ for each bacteriophage dilution by using one tube; pre-warming LB/IPTG/Xgal agar plates at 37 ℃, and taking one plate for standby by each phage dilution gradient; phage were serially diluted 10-fold with LB medium (dilution range: amplified phage culture supernatant: 10)⁸-10¹¹(ii) a Unamplified elutriation eluate: 10¹-10⁴) (ii) a Replacing a new suction head for each dilution, and using the suction head with the filter element to avoid cross contamination; when the colibacillus bacterial liquid reaches the middle logarithmic phase, dividing the bacterial liquid into 200 mu L, and equally dividing the bacterial liquid into microcentrifuge tubes, wherein one tube is used for each bacteriophage dilution; respectively adding 10 mu L of phage with different dilution times into each tube of escherichia coli bacterial liquid, quickly shaking and uniformly mixing, and incubating for 1-5min at room temperature; and adding the phage-infected escherichia coli liquid into a top-layer agarose culture medium tube pre-warmed at 45 ℃, quickly mixing the bacteria one tube at a time, and immediately pouring the mixture onto an LB/IPTG/Xgal agar plate pre-warmed at 37 ℃. The plate is properly inclined to spread the upper agar evenly; cooling the plate for 5min, placing in an incubator at 37 deg.C, and culturing overnight; inspecting the plate with 1 × 10 count²The number of plaques on the plate of each plaque was then multiplied by the dilution factor to give a plaque forming unit (pifu) titer per 10. mu.L phage.

(2) Enrichment of tb-specific phages

At 5X 10⁸M.tb at concentration was used to coat the immunocytes and was sealed overnight at 4 deg.C, washed 6 times with TBST, added with phage peptide library, incubated with shaking at 37 deg.C for 1h, washed 10 times with TBST to remove unbound phage, added with 0.2mol/L Glycine-HCl (pH2.2)1mL, shaken for 10min to elute specifically bound phage, added with 150. mu.L 1mol/L Tris-HCl (pH 9.1) for neutralization, 10. mu.L of eluted product was taken to count the titer of phageAnd infecting the rest of the elution products with Escherichia coli ER2738, amplifying and purifying the phage to obtain a secondary library, and determining the titer of the secondary library and then entering the next round of screening procedure.

(3) Screening of specifically binding phage

The method of step (2) was repeated for four more rounds of panning, the titer of each round was as shown in Table 1, the 1 st round washing conditions were 0.1% Tween20 by volume, the 2 nd and 3 rd rounds of Tween-20 concentrations were changed to 0.3% (v/v), and the 4 th round of Tween-20 concentration was 0.5% (v/v).

TABLE 1 Table of the first to fourth rounds of phage input-output for enrichment of specific phage

	Input titer	Yield titer
			First wheel	2×10¹¹	2.92×10¹⁰
Second wheel	2×10¹¹	2.3×10¹⁰
			Third wheel	2×10¹¹	3.1×10¹¹
Fourth wheel	2×10¹¹	------

Example 3: identification of M.tb specific phages

After the third round of screening, 20 well-separated single colonies on the plate were randomly picked up and titer-determined, and after respective culture and purification, the binding activity of each phage to M.tb was detected by phage ELISA. The method comprises the following specific steps: respectively coating enzyme label plates with M.tb and Blocking, wherein each group comprises three parallel plates, sealing at 4 ℃ overnight, washing with TBST for 6 times, adding 100 mu L of purified phage, incubating at 37 ℃ with oscillation for 1h, washing with TBST for 10 times to remove unbound phage, adding 100 mu L of mouse-resistant M13 monoclonal antibody marked with HRP, incubating at 37 ℃ with oscillation for 1h, washing with TBST for 10 times, adding TMB substrate, reacting at room temperature in a dark place for 5-10 min, terminating the reaction with 2mol/L sulfuric acid, measuring OD value at 450nm wavelength, and taking P/N not less than 2.1 as positive.

The results of P-ELISA detection of 20 selected phage clones are shown in FIG. 1, with phage clones on the abscissa and OD450 values on the ordinate, and 5X 10 cfu as the M.tb cfu⁸And the detection result shows that 15 phage display the combination to M.tb, 15 phage ssDNA is extracted, the sequencing of the bacterial liquid DNA of the positive clone is completed by Shanghai Biotechnology company, the primer is-96 g III (the sequence is 5 '-HOCCCTCATAGTTAGCGTAACC-3'), and the nucleotide sequence involved in the embodiment is as follows: tgtgagacggagactagtttc (SEQ ID NO:2)

Analysis was performed using DNAMAN and Swiss database sequences to obtain the corresponding amino acid sequences: glu Thr SerCys Arg Leu Thr (SEQ ID NO:1), designated Thanos 1.

Example 4: determination of binding Activity of sequences

Plates were coated with different amounts of M.tb and Blocking respectively and blocked overnight at 4 ℃, washed 6 times with TBST, and phage 2X 10 displaying Thanos1 sequence was added¹¹(with the same titer of irrelevant phage as control), TBST washing 10 times to remove unbound phage, adding HRP-labeled mouse anti-M13 monoclonal antibody 100 u L, 37 ℃ oscillation incubation for 1h, TBST washing 10 times; adding TMB for reaction at room temperature in a dark place for 5-10 min, and stopping reaction by 2mol/L sulfuric acidThe OD value should be determined at a wavelength of 490 nm. The results of the competition ELISA for m.tb are shown in figure 2, with the concentration of m.tb on the abscissa and the value of OD450 on the ordinate of figure 2, from which it can be seen that the phage displaying the Thanos1 sequence showed specific binding to m.tb.

Example 5: 5 ICR mice were inoculated with M.tb 40 μ L by nasal drip method at a concentration of 2.5X 10⁸CFU/mL, tuberculosis mouse model, called m.tb group; another 5 ICR mice were inoculated with the same amount of PBS solution by nasal drip as a control group for the tuberculosis mouse model. The lung tissue sections of ICR mice of different groups are respectively selected for specific phage immunohistochemical detection, and as shown in figure 3, typical yellow or brown particles appear at the lesion part of a tuberculosis mouse model, and the difference between the typical yellow or brown particles and a control group is obvious. Suggesting that Thanos1 can be applied to establish a new method for detecting tuberculosis.

Sequence listing

<110> Ningxia university

<120> amino acid sequence and nucleotide sequence specifically binding to mycobacterium tuberculosis and application thereof

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>7

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Glu Thr Ser Cys Arg Leu Thr

1 5

<210>2

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tgtgagacgg agactagttt c 21

Claims

1. An amino acid sequence or a derivative thereof that specifically binds to mycobacterium tuberculosis, wherein the amino acid sequence or derivative thereof comprises an amino acid sequence as set forth in SEQ ID NO: 1.

2. A short peptide or a derivative thereof specifically binding to Mycobacterium tuberculosis, wherein the sequence of the short peptide is shown as SEQ ID NO:1 is shown.

3. A nucleotide sequence encoding the short peptide of claim 2, wherein the nucleotide sequence is as set forth in SEQ ID NO:2, respectively.

4. Use of the amino acid sequence of claim 1 or the short peptide of claim 2 or the nucleotide sequence of claim 3 in the preparation of a kit or product for detecting mycobacterium tuberculosis.

5. A kit or product for detecting mycobacterium tuberculosis, wherein the kit or product comprises the amino acid sequence of claim 1, the short peptide of claim 2, or the nucleotide sequence of claim 3.

6. The use of the amino acid sequence according to claim 1 or the short peptide according to claim 2 for the preparation of a drug carrier for tuberculosis.

7. A method for detecting mycobacterium tuberculosis, comprising the step of using a probe comprising the nucleotide sequence set forth in SEQ ID NO:1 or the amino acid sequence as shown in SEQ ID NO:2 to detect the mycobacterium tuberculosis.