CN111269906A

CN111269906A - Process for the preparation of optically active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenylamide

Info

Publication number: CN111269906A
Application number: CN202010115296.7A
Authority: CN
Inventors: 张红夺
Original assignee: Anhui Therapy Pharma Co ltd
Current assignee: Anhui Therapy Pharma Co ltd
Priority date: 2020-02-25
Filing date: 2020-02-25
Publication date: 2020-06-12

Abstract

The invention discloses a preparation method of optically active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenyl amide, which uses a polypeptide, can hydrolyze 2- [4- (6-chloro-2-benzoxazolyl oxy) -phenoxy ] propionic acid-N-methyl-N- (2, 6-difluoro-phenyl) amide to obtain (R) -2- [4- (6-chloro-2-benzoxazolyl oxy) -phenoxy ] propionic acid-N- (2-fluorophenyl) -N-methyl amide with high optical purity and high yield, avoids using a large amount of organic solvent, reduces environmental pollution and can obtain high-activity target products. The polypeptide has the amino acid sequence shown in SEQ ID NO: 1. SEQ ID NO: 3. SEQ ID NO: 5 or SEQ ID NO: 7 has at least 80%, at least 89%, at least 91%, at least 97% or 100% sequence homology or identity.

Description

Process for the preparation of optically active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenylamide

The technical field is as follows:

the invention relates to the technical field related to biochemical raw material medicines, in particular to a preparation method of optically active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenyl amide.

Background art:

although various paddy field herbicides have been developed and used, barnyard grass is the greatest problem among paddy field weeds.

The development of herbicides capable of controlling barnyard grass is an urgent need in the agricultural field. After transplanting rice seedlings, the current developed herbicides cannot effectively control barnyard grass growth, thereby causing serious loss to yield. It was reported that when barnyard grass was grown for 1 week per square meter, it would reduce the yield by 2%, by 10 months for 5 weeks, by about 19% for 10 weeks, and by about 35% for 20 weeks.

To control barnyard grass to reduce yield loss in rice crops, various herbicides have been used. However, there is still a need for herbicides with a broader spectrum of activity, which are environmentally friendly and cost effective.

In order to provide herbicides capable of effectively controlling barnyard grass, intensive studies have been conducted by researchers, and particularly, it has been found that phenoxypropionic acid N-alkyl-N-2-fluorophenylamide has selective herbicidal activity. As a result, it was found that certain phenoxypropionic acid N-alkyl-N-2-fluorophenylamides exist in the form of (R) -or (S) -stereoisomers, and that the (R) -stereoisomers are more safe for rice crops and have better herbicidal activity than the (S) -stereoisomers or mixtures thereof, and thus CN01823753.3 discloses a herbicidally active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenylamide compound. The excellent activity of the (R) -stereoisomer distinguishes it from the prior art. Also, CN01823753.3 discloses a method for producing an optically active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenylamide compound. It is shown in the publication that they are all obtained by a chemical synthesis method to obtain the final optically active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenylamide compound. And a large amount of chemical intermediates and organic solvents are used in the chemical synthesis process, and the steps are complicated. In addition, the literature reports that chiral compounds are prepared by a chemical reduction method, a metal catalyst is a very critical factor in the reaction, the requirement on the metal catalyst is strict, the reaction needs to be completed under a high-pressure condition, the requirement on operating equipment is high, and simultaneously, a large amount of wastewater containing heavy metal ions is generated, so that the wastewater is difficult to treat and causes great pollution to the environment. In addition, the content of the chiral compound with the configuration required by metal catalytic synthesis is usually 50%, and the requirement that the content of the chiral compound is more than or equal to 99.5% cannot be met, so that the subsequent resolution and refining are required, half of products are wasted, the production efficiency is reduced, a large amount of waste organic solvent is generated, and the pressure of environmental protection treatment is increased.

The invention content is as follows:

in order to solve the defects of the prior art, the invention provides a preparation method of optically active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenyl amide, which uses a polypeptide, can hydrolyze 2- [4- (6-chloro-2-benzoxazolyl oxy) -phenoxy ] propionic acid-N-methyl-N- (2, 6-difluoro-phenyl) amide to obtain (R) -2- [4- (6-chloro-2-benzoxazolyl oxy) -phenoxy ] propionic acid-N- (2-fluorophenyl) -N-methyl amide with high optical purity and high yield, avoids using a large amount of organic solvents, reduces environmental pollution, the target product with high activity can be obtained.

In order to achieve the above object, the present invention provides the following technical solutions:

a polypeptide which is any one of the amino acid sequences shown in (II), (III) and (IV):

(II) has the sequence of SEQ ID NO: 3;

(iii) has SEQ ID NO: 5;

(iv) has the sequence of SEQ ID NO: 7.

Preferably, they are each identical to SEQ ID NO: 3. SEQ ID NO: 5 or SEQ ID NO: 7 has at least 80%, at least 89%, at least 91%, at least 97% or 100% sequence homology or identity.

Use of a polypeptide which is any one of the amino acid sequences shown in (i), (v):

(I) has the sequence of SEQ ID NO: 1;

(v) has SEQ ID NO: 1, at least 80%, at least 89%, at least 91%, at least 97% or 100% sequence homology or identity;

a DNA molecule encoding the polypeptide of SEQ ID NO: 1. SEQ ID NO: 3. SEQ ID NO: 5 or SEQ ID NO: 7.

A DNA molecule having the sequence of SEQ ID NO: 2. SEQ ID NO: 4. SEQ ID NO: 6 or SEQ ID NO: 8.

A recombinant vector comprising any one of the DNA molecules described above, or a DNA molecule capable of expressing any one of the polypeptides described above.

A transformant obtained by introducing the recombinant vector into a host cell.

Preferably, the host cell is E.coli.

A process for preparing optically active (R) -2- [4- (6-chloro-2-benzoxazolyloxy) -phenoxy ] propionic acid-N- (2-fluorophenyl) -N-methylamide by reacting a polypeptide or a mixture of the above-mentioned transformants with an enantiomer of 2- [4- (6-chloro-2-benzoxazolyloxy) -phenoxy ] propionic acid-N-methyl-N- (2, 6-difluoro-phenyl) amide to form (R) -2- [4- (6-chloro-2-benzoxazolyloxy) -phenoxy ] propionic acid-N- (2-fluorophenyl) -N-methylamide.

Wherein the ratio of the polypeptide or transformant to the enantiomeric mixture of 2- [4- (6-chloro-2-benzoxazolyloxy) -phenoxy ] propanoic acid-N-methyl-N- (2, 6-difluoro-phenyl) amide is 2-5: 1.

An optically active (R) -2- [4- (6-chloro-2-benzoxazolyloxy) -phenoxy ] propionic acid-N- (2-fluorophenyl) -N-methylamide, prepared by any one of the above preparation methods.

The preparation method of the (R) -2- [4- (6-chloro-2-benzoxazolyl-oxy) -phenoxy ] propionic acid-N- (2-fluorophenyl) -N-methylamide has the advantages and beneficial effects that:

the polypeptide can hydrolyze 3-isobutyl glutarimide to obtain (R) -2- [4- (6-chloro-2-benzoxazolyl-oxy) -phenoxy ] propionic acid-N- (2-fluorophenyl) -N-methylamide with high optical purity, high yield and high activity; the method for preparing the target active substance can reduce environmental pollution.

The specific implementation mode is as follows:

the technical solutions in the embodiments of the present invention are clearly and completely described below with reference to specific embodiments. It should be understood that the described embodiments are part of the present invention, and are intended to be illustrative only and not limiting in scope. Further, it should be understood that various changes or modifications of the present invention may be made by those skilled in the art after reading the teaching of the present invention, and such equivalents may fall within the scope of the present invention as defined in the appended claims.

In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to understand, the invention is further described with the specific embodiments.

Example 1 Strain construction of recombinant transformants with hydantoinase

The hydantoinase sequences from Jannaschia CCS1 strain, Jannaschia sp.EhC01 strain, Jannaschia aquimarina strain, Litoreibacter ponti strain, Ralstonia pickettii strain and Arthrobacter aurescens strain were searched for on NCBI, and then codon-optimized in an Escherichia coli expression system (optimized using a conventional online website http:// www.jcat.de) in sequence, respectively, and the optimized genes were completely synthesized. A BamHI restriction site is added at the N end of each gene, an XhoI restriction site is added at the C end of each gene, the genes are restricted and connected into BamHI and XhoI restriction sites of a plasmid pET-28a, and the N end of each gene is provided with a His label. The process is as follows:

the enzyme digestion system is as follows:

target gene/plasmid 1ug

BamHI 1ul

XhoI 1ul

10×buffer 3ul

ddH₂Supplementing O to 30ul

The reaction was carried out at 37 ℃ overnight, and the desired gene and plasmid were recovered by agarose gel electrophoresis.

The linking system is as follows:

vector Large fragment 100ng

83ng of target gene

10Xbuffer 2ul

T4 ligase 1ul

ddH₂O is complemented to 20ul

The ligation was performed overnight at 16 ℃ after the ligation product was transformed into DH5 α competent cells, which were spread on kanamycin LB plates (kanamycin LB plates: yeast extract 0.5%, peptone 1%, sodium chloride 1%, agar 1.5%, pH 7.0).

After 12 hours of incubation at 37 ℃ in an incubator, monoclonal extracted plasmids were picked for validation. Verification PCR was performed using universal primers for the T7 promoter and terminator and subsequent experiments were performed on positive plasmids. The PCR system and procedure were as follows:

template plasmid 0.2ul

Forward primer (10uM) 0.4ul

Reverse primer (10uM) 0.4ul

10xTransTaq-T Buffer 1ul

2.5mM dNTPs 0.8ul

TransTaq-T pcr enzyme 0.2ul

ddH₂O 7ul

Total 10ul

The PCR procedure was as follows:

pre-denaturation at 94 ℃ for 5min

Denaturation at 94 ℃ for 30s

60 ℃ annealing for 60s 30 cycles

Extension at 72 deg.C for 1-2min

Fully extending at 72 ℃ for 5min

The reaction was terminated at 4 ℃ for 30min

The positive recombinant vectors which are verified to be correct are respectively named as: RD01, RD02, RD03, RD04, RD05, RD 06.

Coli BL21(DE) was transformed with these positive recombinant vectors₃Competent cells (manufactured by Invitrogen) were obtained as e.coli RD01, e.coli RD02, e.coli RD03, e.coli RD04, e.coli RD05, and e.coli rd06, in this order.

TABLE 1 correspondences between strain sources, recombinant vectors and transformants

Origin of origin	Recombinant vector name	Name of transformant
			Jannaschia CCS1 strain	RD01	E.coliRD01
Jannaschiasp. EhC01 strain	RD02	E.coliRD02
			Jannachi aquimarina strain	RD03	E.coliRD03
Litoreibactericepnti strain	RD04	E.coliRD04
			Ralstoniapackettii strain	RD05	E.coliRD05
Arthrobacteraurens strain	RD06	E.coliRD06

Example 2

Catalytic thallus and protein preparation

The E.coli RD01 transformant was inoculated into 50ml/250ml LB medium (yeast extract 0.5%, peptone 1%, sodium chloride 1%, pH7.0) containing 50. mu.g/ml kanamycin, cultured with shaking at 37 ℃ and 220rpm, and induced by adding 0.5mM IPTG when grown to an OD600 of 0.6-0.8 under 20 ℃ and 200rpm conditions. The cells were collected by centrifugation and suspended in 50mM phosphate buffer (pH 7.0).

The cells were sonicated and centrifuged, and the supernatant was passed through pre-filled and equilibrated Ni-NTA (available from Solambio. RTM. P2010), to collect the proteins in the supernatant. Impurities were eluted with 20mM imidazole and protein was eluted with 250mM imidazole. Then, a protein concentration tube with 30KDa is used for concentration, and the protein is concentrated to 2mg/mL to obtain a protein concentrated solution.

Similarly, the transformants of e.coli RD02, e.coli RD03, e.coli RD04, e.coli RD05 and e.coli RD06 were prepared to obtain the corresponding protein concentrates, respectively, according to the method of example 2.

Sequencing the protein concentrates, the amino acid sequences and corresponding nucleic acid sequences are shown in Table 2 below

TABLE 2

Example 3

Stereoselective hydrolysis of 2- [4- (6-chloro-2-benzoxazolyloxy) -phenoxy ] propanoic acid-N-methyl-N- (2, 6-difluoro-phenyl) amide

After culturing the e.coli RD01 transformant, 10mL of the protein concentrate obtained by separation and purification was taken, 5mg of substrate 2- [4- (6-chloro-2-benzoxazolyloxy) -phenoxy ] propionic acid-N-methyl-N- (2, 6-difluoro-phenyl) amide was added, and the ratio of protein to substrate in the protein concentrate was 4: 1, shaking the mixture at 30 ℃ for 48 hours to obtain a hydrolysate. After the reaction is finished, centrifuging and collecting supernatant, taking a proper amount of supernatant for sample injection, analyzing by high performance liquid chromatography, and calculating the conversion rate (%).

Derivatizing the hydrolysate with 2-bromobenzophenone at a molar ratio of product to derivatizing agent of 1: dissolving 1.5, 2-bromobenzophenone in acetonitrile, and carrying out derivatization reaction at 30 ℃ for 30 minutes. After the reaction, a proper amount of the derivatization reaction solution was sampled and analyzed for optical purity (% ee).

Similarly, after culturing the transformants of e.coli RD02, e.coli RD03, e.coli RD04, e.coli RD05 and e.coli RD06, the respective protein concentrates obtained by separation and purification were also treated as described in example 3, and the conversion (%) and the optical purity (% ee) were calculated, respectively. The results are given in table 3 below:

TABLE 3

Conversion (%) - (initial weight of substrate-weight of substrate remaining in reaction)/initial weight of substrate

Take e.coli RD01 as an example to calculate the conversion rate calculation process:

coli RD01 reaction was completed to yield 1.4mg of hydrolysate, and when 5mg of substrate was initially charged, the conversion rate was 1.4/5 × 100%

Optical purity (% ee) (a-B)/(a + B) × 100(a and B represent the amounts of the respective isomers, a > B)

Take e.coli RD01 as an example to calculate the optical purity ee value:

optical purity (% ee) (99.919-0.081)/(99.919+0.081) × 100

Example 4

Similarly, after culturing the transformants of e.coli RD02, e.coli RD03, e.coli RD04, e.coli RD05 and e.coli RD06, the respective protein concentrates obtained by separation and purification were also treated as described in example 4, and the conversion (%) and the optical purity (% ee) were calculated, respectively. The results are given in table 4 below:

table 4:

microorganisms	Conversion (%)	Optical purity (% ee)	Absolute configuration
				E.coliRD01	43	99.4	R
E.coliRD02	38	99.1	R
				E.coliRD03	57	99.8	R
E.coliRD04	25	92.2	R
				E.coliRD05	36	30.0	S
E.coliRD06	15	22.0	S

In this example, e.coli RD05 and e.coli RD06 catalyzed hydrolysis, the S configuration predominated in the hydrolysate.

The foregoing shows and describes the general principles and broad features of the present invention and advantages thereof. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Sequence listing

<110> Anhui Sailapu pharmaceutical Co., Ltd

<120> process for producing optically active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenylamide

<130>2020.02.25

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>487

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>1

Met Ser Lys Val Ile Lys Gly Gly Thr Ile Val Thr Ala Asp Arg Gln

1 5 10 15

Trp Gln Ala Asp Val Leu Ile Glu Gly Glu Lys Ile Ala Glu Ile Gly

20 25 30

Glu Asn Leu Arg Gly Asp Glu Val Ile Asp Ala Glu Gly Ala Tyr Val

35 40 45

Ile Pro Gly Gly Ile Asp Pro His Thr His Leu Glu Met Pro Phe Met

50 55 60

Gly Thr Thr Ala Ala Glu Thr Phe Glu Thr Gly Thr Phe Ala Ala Ala

65 70 75 80

Ala Gly Gly Thr Thr Met Leu Val Asp Phe Cys Leu Pro Gly Glu Asp

85 90 95

Gly Ser Leu Leu Ser Ala Ile Asp Ala Trp Asp Ala Lys Ser Lys Asp

100 105 110

Gln Ile Cys Val Asp Ile Ser Tyr His Met Ala Ile Thr Gly Trp Ser

115 120 125

Glu Ser Ile Phe Asn Glu Met Ala Asp Val Val Asn Val Arg Gly Ile

130 135 140

Asn Thr Phe Lys His Phe Met Ala Tyr Lys Gly Ala Leu Met Ile Glu

145 150155 160

Asp Asp Glu Met Phe Ser Ser Phe Lys Arg Cys Ala Glu Leu Gly Ala

165 170 175

Leu Pro Leu Val His Ala Glu Asn Gly Asp Ile Val Gln Glu Leu Gln

180 185 190

Gln Lys Tyr Met Ala Met Gly Val Thr Gly Pro Glu Gly His Ala Tyr

195 200 205

Ser Arg Pro Pro Glu Val Glu Gly Glu Ala Ala Asn Arg Ala Ile Met

210 215 220

Ile Ala Asp Ala Ala Gly Thr Pro Leu Tyr Ile Val His Val Ser Cys

225 230 235 240

Glu Gln Ala His Glu Ala Ile Arg Arg Ala Arg Gln Lys Gly Met Arg

245 250 255

Val Phe Gly Glu Pro Leu Ile Gln His Leu Thr Leu Asp Glu Ser Glu

260 265 270

Tyr Phe Asn Lys Asp Trp Gln Tyr Ala Ala Arg Arg Val Met Ser Pro

275 280 285

Pro Phe Arg Asn Lys Glu His Gln Asp Gly Leu Trp Ala Gly Leu Ala

290 295 300

Ala Gly Ser Leu Gln Val Val Ala Thr Asp His Ala Ala Phe Thr Asp

305 310315 320

Glu Gln Lys Arg Met Gly Val Asp Asn Phe Gly Met Ile Pro Asn Gly

325 330 335

Thr Gly Gly Leu Glu Glu Arg Met Ala Met Leu Trp Thr Arg Gly Val

340 345 350

Glu Thr Gly Arg Leu Thr Pro Glu Glu Phe Val Ala Val Thr Ser Ser

355 360 365

Asn Ile Ala Lys Ile Leu Asn Ile Tyr Pro Met Lys Gly Gly Ile Asn

370 375 380

Val Gly Gly Asp Ala Asp Ile Val Val Trp Asp Pro Lys Leu Gly Arg

385 390 395 400

Thr Ile Thr Thr Ala Thr Ala Lys Ser Ile Leu Asp Tyr Asn Val Phe

405 410 415

Glu Gly Met Glu Val Ser Ala Ser Pro Arg Tyr Thr Leu Ser Arg Gly

420 425 430

Asp Val Val Trp Ala Ala Gly Gln Asn Ser Gln Pro Gln Pro Gly Arg

435 440 445

Gly Lys Phe Val Lys Arg Pro Pro Ala Ala Ser Ala Ser Gln Ala Leu

450 455 460

Ser Lys Trp Lys Ala Leu Asn Thr Pro Arg Lys Ile Glu Arg Asp Pro

465 470 475480

Met Asn Ile Pro Ala Gly Val

485

<210>2

<211>1461

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>2

atgagcaaag ttattaaggg tggcaccatt gttaccgcgg accgtcagtg gcaggcggat 60

gttctgattg agggcgaaaa gattgcggaa attggcgaga acctgcgtgg cgacgaagtg 120

atcgatgcgg agggtgcgta cgttattccg ggtggcattg acccgcacac ccacctggaa 180

atgccgttta tgggcaccac cgcggcggaa acctttgaaa ccggtacctt tgcggcggcg 240

gcgggtggca ccaccatgct ggttgacttc tgcctgccgg gcgaggatgg cagcctgctg 300

agcgcgattg acgcgtggga tgcgaagagc aaagaccaaa tttgcgtgga tatcagctac 360

cacatggcga ttaccggttg gagcgaaagc atctttaacg agatggcgga tgtggttaac 420

gttcgtggca ttaacacctt caagcacttt atggcgtata aaggtgcgct gatgatcgaa 480

gacgatgaga tgttcagcag ctttaagcgt tgcgcggaac tgggtgcgct gccgctggtg 540

cacgcggaaa acggtgacat cgttcaggag ctgcagcaaa aatatatggc gatgggtgtg 600

accggtccgg agggtcatgc gtatagccgt ccgccggaag tggaaggtga agcggcgaac 660

cgtgcgatca tgattgcgga tgcggcgggt accccgctgt acattgtgca cgttagctgc 720

gagcaagcgc atgaggcgat ccgtcgtgcg cgtcaaaagg gtatgcgtgt gttcggcgaa 780

ccgctgattc aacacctgac cctggacgaa agcgagtact ttaacaagga ttggcagtat 840

gcggcgcgtc gtgttatgag cccgccgttc cgtaacaaag aacaccaaga tggcctgtgg 900

gcgggtctgg cggcgggcag cctgcaagtg gttgcgaccg accacgcggc gttcaccgat 960

gagcagaaac gtatgggtgt ggataacttt ggcatgatcc cgaacggtac cggtggcctg 1020

gaggaacgta tggcgatgct gtggacccgt ggtgttgaaa ccggccgtct gaccccggag 1080

gaattcgtgg cggttaccag cagcaacatc gcgaagattc tgaacatcta tccgatgaaa 1140

ggtggcatta acgtgggtgg cgacgcggat atcgtggttt gggacccgaa gctgggccgt 1200

accattacca ccgcgaccgc gaaaagcatc ctggattaca acgtgtttga gggtatggaa 1260

gtgagcgcga gcccgcgtta taccctgagc cgtggcgacg tggtttgggc ggcgggtcaa 1320

aacagccagc cgcaaccggg tcgtggcaag ttcgttaaac gtccgccggc ggcgagcgcg 1380

agccaggcgc tgagcaagtg gaaggcgctg aacaccccgc gtaagattga acgtgatccg 1440

atgaacattc cggcgggcgt g 1461

<210>3

<211>487

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>3

Met Ser Lys Val Ile Lys Gly Gly Thr Ile Val Thr Ala Asp Arg Gln

1 5 10 15

Trp Gln Ala Asp Val Leu Ile Glu Gly Glu Lys Ile Ala Glu Ile Gly

20 25 30

Glu Asn Leu Arg Gly Asp Glu Val Ile Asp Ala Glu Gly Ala Tyr Val

35 40 45

Ile Pro Gly Gly Ile Asp Pro His Thr His Leu Glu Met Pro Phe Met

50 55 60

Gly Thr Thr Ala Ala Glu Thr Phe Glu Thr Gly Thr Phe Ala Ala Ala

65 70 75 80

Ala Gly Gly Thr Thr Met Leu Val Asp Phe Cys Leu Pro Gly Glu Asp

85 90 95

Gly Ser Leu Leu Asn Ala Ile Asp Ala Trp Asp Lys Lys Ser Lys Asp

100 105 110

Gln Ile Cys Val Asp Ile Ser Tyr His Met Ala Ile Thr Gly Trp Asn

115 120 125

Glu Asp Ile Phe Asn Glu Met Asp Ala Val Val Asn Gln Arg Gly Ile

130 135 140

Asn Thr Phe Lys His Phe Met Ala Tyr Lys Gly Ala Leu Met Ile Glu

145 150 155 160

Asp Asp Glu Met Phe Ala Ser Phe Lys Arg Cys Ala Glu Leu Gly Ala

165 170 175

Leu Pro Leu Val His Ala Glu Asn Gly Asp Ile Val Gln Glu Leu Gln

180 185 190

Gln Lys Tyr Met Ala Met Gly Val Thr Gly Pro Glu Gly His Ala Tyr

195 200 205

Ser Arg Pro Pro Glu Val Glu Gly Glu Ala Ala Asn Arg Ala Ile Met

210 215 220

Ile Ala Asp Ala Ala Gly Thr Pro Leu Tyr Ile Val His Val Ser Cys

225 230 235 240

Glu Gln Ala His Glu Ala Ile Arg Arg Ala Arg Gln Lys Gly Met Arg

245 250 255

Val Phe Gly Glu Pro Leu Ile Gln His Leu Thr Leu Asp Glu Ser Glu

260 265 270

Tyr Phe Asn Lys Asp Trp Gln Tyr Ala Ala Arg Arg Val Met Ser Pro

275 280 285

Pro Phe Arg Ser Lys Asp His Gln Asp Gly Leu Trp Ala Gly Leu Ala

290 295 300

Ala Gly Ser Leu Gln Val Val Ala Thr Asp His Ala Ala Phe Thr Asp

305 310 315 320

Glu Gln Lys Arg Met Gly Val Gly Asn Phe Gly Met Ile Pro Asn Gly

325 330 335

Thr Gly Gly Leu Glu Glu Arg Met Ala Met Leu Trp Thr Asn Gly Val

340 345 350

Glu Thr Gly Arg Leu Thr Pro Glu Glu Phe Val Ala Val Thr Ser Ser

355 360 365

Asn Ile Ala Lys Ile Leu Asn Ile Tyr Pro Met Lys Gly Gly Ile Asn

370 375 380

Val Gly Gly Asp Ala Asp Val Val Val Trp Asp Pro Lys Leu Gly Arg

385 390 395 400

Thr Ile Thr Thr Ala Thr Ala Lys Ser Ile Leu Asp Tyr Asn Val Phe

405 410 415

Glu Gly Met Glu Val Ser Ala Ser Pro Arg Tyr Thr Leu Ser Arg Gly

420 425 430

Asp Val Val Trp Ala Ala Gly Gln Asn Ser Gln Pro Thr Pro Gly Arg

435 440 445

Gly Arg Phe Val Lys Arg Pro Pro Ala Ala Ser Ala Ser Gln Ala Leu

450 455 460

Ser Lys Trp Lys Ala Leu Asn Thr Pro Arg Lys Ile Glu Arg Asp Pro

465 470 475 480

Met Asn Ile Pro Ala Gly Val

485

<210>4

<211>1461

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

atgagcaagg ttattaaagg tggcaccatc gtgaccgcgg accgtcagtg gcaagcggat 60

gttctgattg agggtgaaaa gatcgcggaa attggcgaga acctgcgtgg cgacgaagtt 120

atcgatgcgg agggtgcgta cgtgattccg ggtggcattg acccgcacac ccacctggaa 180

atgccgttta tgggtaccac cgcggcggaa acctttgaga ccggtacctt tgcggcggcg 240

gcgggtggca ccaccatgct ggttgacttc tgcctgccgg gcgaggatgg cagcctgctg 300

aacgcgatcg acgcgtggga taagaaaagc aaagaccaaa tttgcgtgga tatcagctac 360

cacatggcga ttaccggttg gaacgaagac atctttaacg agatggatgc ggtggttaac 420

cagcgtggta ttaacacctt caagcacttt atggcgtata aaggcgcgct gatgatcgaa 480

gacgatgaga tgttcgcgag ctttaaacgt tgcgcggaac tgggtgcgct gccgctggtt 540

cacgcggaaa acggcgacat tgtgcaagag ctgcagcaaa aatacatggc gatgggtgtt 600

accggtccgg agggtcatgc gtacagccgt ccgccggaag tggaaggcga ggcggcgaac 660

cgtgcgatca tgattgcgga tgcggcgggc accccgctgt acattgttca cgtgagctgc 720

gagcaagcgc atgaggcgat ccgtcgtgcg cgtcaaaagg gtatgcgtgt tttcggcgaa 780

ccgctgatcc aacacctgac cctggacgaa agcgagtact ttaacaagga ttggcagtat 840

gcggcgcgtc gtgtgatgag cccgccgttc cgtagcaaag accaccagga tggtctgtgg 900

gcgggtctgg cggcgggtag cctgcaagtg gttgcgaccg accacgcggc gttcaccgat 960

gaacagaaac gtatgggtgt tggcaacttt ggtatgattc cgaacggcac cggtggcctg 1020

gaggaacgta tggcgatgct gtggaccaac ggtgtggaga ccggccgtct gaccccggag 1080

gaattcgttg cggtgaccag cagcaacatc gcgaagattc tgaacatcta tccgatgaaa 1140

ggtggcatca acgtgggtgg cgacgcggat gtggttgtgt gggacccgaa gctgggtcgt 1200

accattacca ccgcgaccgc gaaaagcatc ctggattaca acgtttttga aggcatggaa 1260

gtgagcgcga gcccgcgtta taccctgagc cgtggtgacg ttgtttgggc ggcgggtcaa 1320

aacagccagc cgaccccggg tcgtggccgt ttcgttaaac gtccgccggc ggcgagcgcg 1380

agccaggcgc tgagcaagtg gaaagcgctg aacaccccgc gtaaaattga gcgtgatccg 1440

atgaacatcc cggcgggtgt g 1461

<210>5

<211>487

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>5

Met Ser Lys Val Ile Lys Asn Gly Thr Ile Val Thr Ala Asp Arg Gln

1 5 10 15

Trp Lys Ala Asp Val Leu Ile Glu Gly Glu His Ile Ala Glu Ile Gly

20 25 30

Glu Asn Leu Lys Gly Asp Glu Thr Ile Asp Ala Ser Asp Ala Tyr Val

35 40 45

Ile Pro Gly Gly Ile Asp Pro His Thr His Leu Glu Met Pro Phe Met

50 55 60

Gly Thr Thr Ala Ala Glu Thr Phe Glu Ser Gly Thr Phe Ala Ala Val

65 70 75 80

Ala Gly Gly Thr Thr Met Leu Val Asp Phe Cys Leu Pro Gly Glu Asp

85 90 95

Gly Ser Leu Leu Asn Ala Ile Asp Glu Trp Asp Arg Lys Ser Arg Asp

100 105 110

Gln Ile Cys Cys Asp Ile Ser Tyr His Met Ala Ile Thr Gly Trp Ser

115 120 125

Glu Ser Ile Phe Asp Glu Met Glu Ala Val Val Lys Glu Arg Gly Ile

130 135 140

Asn Thr Phe Lys His Phe Met Ala Tyr Lys Gly Ala Leu Met Val Glu

145 150 155 160

Asp Asp Glu Met Phe Ala Ser Phe Lys Arg Cys Ala Glu Leu Gly Ala

165 170 175

Leu Pro Leu Val His Ala Glu Asn Gly Asp Ile Val Ala Glu Leu Gln

180 185 190

Gln Lys Tyr Leu Ala Glu Gly Ile Thr Gly Pro Glu Gly His Ala Tyr

195 200 205

Ser Arg Pro Pro Glu Val Glu Gly Glu Ala Ala Asn Arg Ala Ile Met

210 215 220

Ile Ala Asp Ala Ala Gly Thr Pro Leu Tyr Ile Val His Val Ser Cys

225 230 235 240

Glu Gln Ala His Glu Ala Ile Arg Arg Ala Arg Gln Lys Gly Met Arg

245 250 255

Val Tyr Gly Glu Pro Leu Ile Gln His Leu Thr Leu Asp Glu Ser Glu

260 265 270

Tyr Phe Asp Lys Asp Trp Gln Tyr Ala Ala Arg Arg Val Met Ser Pro

275 280 285

Pro Phe Arg Ser Lys Asp His Gln Asp Gly Leu Trp Asn Gly Leu Ala

290 295 300

Ala Gly Ser Leu Gln Val Val Ala Thr Asp His Ala Ala Phe Thr Asp

305 310 315 320

Glu Gln Lys Arg Met Gly Val Asp Asn Phe Ala Met Ile Pro Asn Gly

325 330 335

Thr Gly Gly Leu Glu Glu Arg Met Gly Met Leu Trp Thr Lys Gly Val

340 345 350

Glu Thr Gly Arg Leu Thr Pro Glu Glu Phe Val Ala Val Thr Ser Thr

355 360 365

Asn Ile Ala Lys Ile Leu Asn Ile Tyr Pro Met Lys Gly Gly Ile Ala

370 375 380

Val Gly Gly His Ala Asp Val Val Val Trp Asp Pro Thr Leu Gly Arg

385 390 395 400

Thr Ile Thr Thr Ala Thr Ala Lys Ser Ile Leu Asp Tyr Asn Val Phe

405 410 415

Glu Gly Ile Glu Val Ser Ala Ser Pro Arg Tyr Thr Leu Ser Arg Gly

420 425 430

Asp Val Val Trp Ala Ala Gly Gln Asn Ser Gln Pro Gln Pro Gly Arg

435 440 445

Gly Lys Phe Val Lys Arg Ser Pro Tyr Ala Ser Ala Ser Lys Ala Leu

450 455 460

Ser Lys Trp Lys Ala Leu Asn Thr Pro Arg Lys Ile Glu Arg Asp Pro

465 470 475 480

Met Asn Ile Pro Ala Gly Val

485

<210>6

<211>1461

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>6

atgagcaagg ttattaaaaa cggtaccatc gtgaccgcgg accgtcaatg gaaggcggat 60

gttctgattg agggcgaaca catcgcggaa attggcgaga acctgaaagg cgacgaaacc 120

atcgacgcga gcgatgcgta cgtgattccg ggtggcatcg atccgcacac ccacctggag 180

atgccgttca tgggtaccac cgcggcggaa acctttgaaa gcggtacctt tgcggcggtt 240

gcgggtggca ccaccatgct ggttgacttt tgcctgccgg gtgaagatgg cagcctgctg 300

aacgcgattg acgagtggga tcgtaagagc cgtgaccaga tttgctgcga tatcagctac 360

cacatggcga ttaccggttg gagcgaaagc atcttcgacg agatggaagc ggtggttaaa 420

gagcgtggta tcaacacctt caagcacttt atggcgtata aaggcgcgct gatggttgaa 480

gacgatgaga tgttcgcgag ctttaaacgt tgcgcggaac tgggtgcgct gccgctggtt 540

cacgcggaaa acggcgacat tgtggcggag ctgcagcaaa aatatctggc ggaaggtatt 600

accggtccgg agggtcatgc gtacagccgt ccgccggaag tggaaggcga ggcggcgaac 660

cgtgcgatca tgattgcgga tgcggcgggc accccgctgt acattgttca cgtgagctgc 720

gagcaagcgc atgaggcgat ccgtcgtgcg cgtcaaaagg gtatgcgtgt ttatggcgag 780

ccgctgatcc aacacctgac cctggacgaa agcgagtact tcgacaagga ttggcagtat 840

gcggcgcgtc gtgtgatgag cccgccgttt cgtagcaaag accaccaaga tggtctgtgg 900

aacggtctgg cggcgggtag cctgcaagtg gttgcgaccg accacgcggc gttcaccgat 960

gaacagaagc gtatgggtgt tgataacttt gcgatgatcc cgaacggtac cggtggcctg 1020

gaggaacgta tgggcatgct gtggaccaaa ggtgtggaga ccggccgtct gaccccggag 1080

gaatttgttg cggtgaccag caccaacatc gcgaagattc tgaacatcta cccgatgaaa 1140

ggtggcattg cggttggtgg ccacgcggac gtggttgtgt gggatccgac cctgggtcgt 1200

accattacca ccgcgaccgc gaaaagcatc ctggactaca acgtttttga aggtattgaa 1260

gtgagcgcga gcccgcgtta taccctgagc cgtggtgatg ttgtttgggc ggcgggtcaa 1320

aacagccagc cgcaaccggg tcgtggcaag tttgttaaac gtagcccgta tgcgagcgcg 1380

agcaaggcgc tgagcaagtg gaaagcgctg aacaccccgc gtaaaattga acgtgacccg 1440

atgaacatcc cggcgggtgt g 1461

<210>7

<211>487

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>7

Met Ser Lys Val Ile Lys Gly Gly Thr Ile Val Thr Ala Asp Arg Ser

1 5 10 15

Trp Thr Ala Asp Val Leu Ile Glu Gly Glu Lys Ile Ala Glu Ile Gly

20 25 30

Glu Asn Leu Lys Gly Asp Glu Val Ile Asp Ala Glu Gly Ala Tyr Val

35 40 45

Ile Pro Gly Gly Ile Asp Pro His Thr His Leu Glu Met Pro Phe Met

50 55 60

Gly Thr Thr Ala Ala Glu Thr Phe Glu Ser Gly Thr Phe Ala Ala Ala

65 70 75 80

Ala Gly Gly Thr Thr Met Leu Val Asp Phe Cys Leu Pro Gly Glu Asp

85 90 95

Gly Ser Leu Leu Ser Ala Ile Asp Asp Trp Asp Arg Lys Ser Lys Asp

100 105 110

Gln Ile Cys Cys Asp Ile Ser Tyr His Met Ala Ile Thr Gly Trp Asn

115 120 125

Glu Asn Ile Phe Asn Glu Met Glu Asp Val Val Asn Lys Arg Gly Ile

130 135 140

Asn Thr Phe Lys His Phe Met Ala Tyr Lys Gly Ala Leu Met Val Glu

145 150 155 160

Asp Asp Glu Met Phe Ala Ser Phe Lys Arg Cys Ala Glu Leu Gly Ala

165 170 175

Leu Pro Leu Val His Ala Glu Asn Gly Asp Ile Val Gln Glu Leu Gln

180 185 190

Gln Lys Tyr Met Ala Glu Gly Ile Thr Gly Pro Glu Gly His Ala Tyr

195 200 205

Ser Arg Pro Pro Glu Val Glu Gly Glu Ala Ala Asn Arg Ala Ile Met

210 215 220

Ile Ala Asp Ala Ala Gly Thr Pro Leu Tyr Ile Val His Val Ser Cys

225 230 235 240

Glu Gln Ala His Glu Ala Ile Arg Arg Ala Arg Gln Lys Gly Met Arg

245 250 255

Val Tyr Gly Glu Pro Leu Ile Gln His Leu Thr Leu Asp Glu Ser Glu

260 265 270

Tyr Phe Asn Lys Asp Trp Gln Tyr Ala Ala Arg Arg Val Met Ser Pro

275 280 285

Pro Phe Arg Ser Lys Asp His Gln Ala Ser Leu Trp Ala Gly Leu Ala

290 295 300

Ala Gly Ser Leu Gln Val Val Ala Thr Asp His Ala Ala Phe Thr Asp

305 310 315 320

Lys Gln Lys Gln Met Gly Leu Asp Asn Phe Thr Ser Ile Pro Asn Gly

325 330 335

Thr Gly Gly Leu Glu Glu Arg Met Ala Met Leu Trp Thr Thr Gly Val

340 345 350

Glu Thr Gly Arg Leu Thr Pro Glu Glu Phe Val Ala Ala Thr Ser Thr

355 360 365

Asn Ile Ala Lys Ile Leu Asn Ile Tyr Pro Leu Lys Gly Gly Ile Asn

370 375 380

Val Gly Gly Asp Ala Asp Val Val Val Trp Asp Pro Thr Ile Ser Arg

385 390 395 400

Glu Ile Ala Val Ser Thr Gln Lys Ser Ile Ile Asp Tyr Asn Val Phe

405 410 415

Glu Gly Met Thr Val Thr Ala Gln Pro Arg Tyr Thr Leu Ser Arg Gly

420 425 430

Glu Val Ile Trp Ala Tyr Gly Gln Asn Ser Gln Pro Gln Pro Gly Arg

435 440 445

Gly Lys Phe Val Arg Arg Pro Ala Phe Ala Ser Ala Ser Lys Ala Leu

450 455 460

Ser Arg Trp Lys Ser Leu Asn Thr Pro Arg Lys Ile Glu Arg Asp Pro

465 470 475 480

Leu Asn Ile Pro Ser Gly Val

485

<210>8

<211>1461

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>8

atgagcaagg ttattaaagg tggcaccatc gtgaccgcgg atcgtagctg gaccgcggac 60

gttctgattg agggcgaaaa gatcgcggaa attggcgaga acctgaaagg tgacgaagtt 120

atcgatgcgg agggtgcgta cgtgattccg ggtggcatcg atccgcacac ccacctggag 180

atgccgttca tgggcaccac cgcggcggaa accttcgaga gcggtacctt tgcggcggcg 240

gcgggtggca ccaccatgct ggttgacttt tgcctgccgg gcgaggatgg tagcctgctg 300

agcgcgattg acgattggga ccgtaagagc aaagatcaga tttgctgcga catcagctac 360

cacatggcga ttaccggttg gaacgaaaac atcttcaacg agatggaaga cgtggttaac 420

aagcgtggca tcaacacctt caagcacttt atggcgtata aaggtgcgct gatggttgaa 480

gacgatgaga tgttcgcgag ctttaaacgt tgcgcggagc tgggtgcgct gccgctggtt 540

cacgcggaaa acggtgatat tgtgcaagag ctgcagcaaa aatacatggc ggaaggtatt 600

accggtccgg agggtcatgc gtacagccgt ccgccggaag tggaaggtga agcggcgaac 660

cgtgcgatca tgattgcgga cgcggcgggt accccgctgt acattgttca cgtgagctgc 720

gagcaagcgc atgaggcgat ccgtcgtgcg cgtcaaaaag gcatgcgtgt ttatggtgaa 780

ccgctgatcc agcacctgac cctggatgaa agcgagtact tcaacaagga ctggcaatat 840

gcggcgcgtc gtgtgatgag cccgccgttt cgtagcaaag atcaccaagc gagcctgtgg 900

gcgggtctgg cggcgggtag cctgcaagtg gttgcgaccg atcacgcggc gttcaccgac 960

aagcagaaac aaatgggcct ggacaacttt accagcattc cgaacggtac cggtggcctg 1020

gaggaacgta tggcgatgct gtggaccacc ggcgttgaga ccggtcgtct gaccccggag 1080

gaattcgtgg cggcgaccag caccaacatc gcgaagattc tgaacatcta cccgctgaaa 1140

ggtggcatca acgttggtgg cgacgcggat gtggttgtgt gggatccgac cattagccgt 1200

gaaatcgctg tgagcaccca gaagagcatc attgactata acgtttttga gggtatgacc 1260

gttaccgcgc agccgcgtta caccctgagc cgtggcgaag ttatctgggc gtatggtcaa 1320

aacagccagc cgcaaccggg tcgtggcaag tttgtgcgtc gtccggcgtt tgcgagcgcg 1380

agcaaggcgc tgagccgttg gaaaagcctg aacaccccgc gtaaaattga acgtgacccg 1440

ctgaacatcc cgagcggtgt t 1461

<210>9

<211>457

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>9

Met Asp Ile Ile Ile Lys Asn Gly Thr Ile Val Thr Ala Asp Gly Ile

1 5 10 15

Ser Arg Ala Asp Leu Gly IleLys Asp Gly Lys Ile Thr Gln Ile Gly

20 25 30

Gly Ala Leu Gly Pro Ala Glu Arg Thr Ile Asp Ala Ala Gly Arg Tyr

35 40 45

Val Phe Pro Gly Gly Ile Asp Val His Thr His Val Glu Thr Val Ser

50 55 60

Phe Asn Thr Gln Ser Ala Asp Thr Phe Ala Thr Ala Thr Val Ala Ala

65 70 75 80

Ala Cys Gly Gly Thr Thr Thr Ile Val Asp Phe Cys Gln Gln Asp Arg

85 90 95

Gly His Ser Leu Ala Glu Ala Val Ala Lys Trp Asp Gly Met Ala Gly

100 105 110

Gly Lys Ser Ala Ile Asp Tyr Gly Tyr His Ile Ile Val Leu Asp Pro

115 120 125

Thr Asp Ser Val Ile Glu Glu Leu Glu Val Leu Pro Asp Leu Gly Ile

130 135 140

Thr Ser Phe Lys Val Phe Met Ala Tyr Arg Gly Met Asn Met Ile Asp

145 150 155 160

Asp Val Thr Leu Leu Lys Thr Leu Asp Lys Ala Val Lys Thr Gly Ser

165 170 175

Leu Val Met Val His Ala Glu Asn Gly Asp Ala Ala Asp Tyr Leu Arg

180 185 190

Asp Lys Phe Val Ala Glu Gly Lys Thr Ala Pro Ile Tyr His Ala Leu

195 200 205

Ser Arg Pro Pro Arg Val Glu Ala Glu Ala Thr Ala Arg Ala Leu Ala

210 215 220

Leu Ala Glu Ile Val Asn Ala Pro Ile Tyr Ile Val His Val Thr Cys

225 230 235 240

Glu Glu Ser Leu Glu Glu Val Met Arg Ala Lys Ser Arg Gly Val Arg

245 250 255

Ala Leu Ala Glu Thr Cys Thr His Tyr Leu Tyr Leu Thr Lys Glu Asp

260 265 270

Leu Glu Arg Pro Asp Phe Glu Gly Ala Lys Tyr Val Phe Thr Pro Pro

275 280 285

Ala Arg Ala Lys Lys Asp His Asp Val Leu Trp Asn Ala Leu Arg Asn

290 295 300

Gly Val Phe Glu Thr Val Ser Ser Asp His Cys Ser Trp Leu Phe Lys

305 310 315 320

Gly His Lys Asp Arg Gly Arg Asn Asp Phe Arg Ala Ile Pro Asn Gly

325 330 335

Ala Pro Gly Val Glu Glu Arg Leu Met Met Val Tyr Gln Gly Val Asn

340 345 350

Glu Gly Arg Ile Ser Leu Thr Gln Phe Val Glu Leu Val Ala Thr Arg

355 360 365

Pro Ala Lys Val Phe Gly Met Phe Pro Gln Lys Gly Thr Ile Ala Val

370 375 380

Gly Ser Asp Ala Asp Ile Val Leu Trp Asp Pro Glu Ala Glu Met Val

385 390 395 400

Ile Glu Gln Thr Ala Met His Asn Ala Met Asp Tyr Ser Ser Tyr Glu

405 410 415

Gly His Lys Val Lys Gly Val Pro Lys Thr Val Leu Leu Arg Gly Lys

420 425 430

Val Ile Val Asp Glu Gly Ser Tyr Val Gly Glu Pro Thr Asp Gly Lys

435 440 445

Phe Leu Lys Arg Arg Lys Tyr Lys Gln

450 455

<210>10

<211>1374

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>10

atggacatca ttatcaagaa cggtaccatt gtgaccgcgg atggtatcag ccgtgcggac 60

ctgggtatca aggatggcaa aattacccaa atcggtggcg cgctgggtcc ggcggagcgt 120

accattgatg cggcgggccg ttacgtgttc ccgggtggca tcgatgttca cacccacgtg 180

gaaaccgtta gcttcaacac ccaaagcgcg gacacctttg cgaccgcgac cgtggcggcg 240

gcgtgcggtg gcaccaccac cattgttgac ttttgccagc aagatcgtgg tcatagcctg 300

gcggaagcgg tggcgaagtg ggatggtatg gcgggtggca aaagcgcgat cgattacggc 360

tatcacatta tcgttctgga cccgaccgat agcgtgattg aggaactgga agttctgccg 420

gatctgggta tcaccagctt caaggtgttt atggcgtatc gtggcatgaa catgatcgac 480

gatgtgaccc tgctgaaaac cctggacaag gcggttaaaa ccggtagcct ggtgatggtt 540

catgcggaga acggtgatgc ggcggattac ctgcgtgata agttcgttgc ggaaggtaaa 600

accgcgccga tttatcacgc gctgagccgt ccgccgcgtg tggaggcgga agcgaccgcg 660

cgtgcgctgg cgctggcgga gatcgttaac gcgccgattt acatcgtgca cgttacctgc 720

gaggaaagcc tggaggaagt gatgcgtgcg aaaagccgtg gcgttcgtgc gctggcggag 780

acctgcaccc actacctgta tctgaccaaa gaggacctgg aacgtccgga tttcgaaggt 840

gcgaaatatg tgtttacccc gccggcgcgt gcgaagaaag accacgatgt tctgtggaac 900

gcgctgcgta acggcgtgtt cgaaaccgtt agcagcgacc actgcagctg gctgttcaag 960

ggtcacaaag accgtggccg taacgatttt cgtgcgattc cgaacggtgc gccgggcgtt 1020

gaggaacgtc tgatgatggt gtaccagggt gttaacgagg gccgtatcag cctgacccag 1080

tttgtggaac tggttgcgac ccgtccggcg aaggtgttcg gcatgtttcc gcagaaaggt 1140

accattgcgg tgggcagcga cgcggatatc gttctgtggg acccggaggc ggaaatggtt 1200

attgagcaaaccgcgatgca caacgcgatg gattacagca gctatgaagg tcacaaggtg 1260

aaaggcgttc cgaagaccgt gctgctgcgt ggtaaagtga tcgttgacga gggtagctac 1320

gttggcgaac cgaccgatgg caagtttctg aaacgtcgta agtataaaca gtga 1374

<210>11

<211>458

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>11

Met Phe Asp Val Ile Val Lys Asn Cys Arg Leu Val Ser Ser Asp Gly

1 5 10 15

Ile Thr Glu Ala Asp Ile Leu Val Lys Asp Gly Lys Val Ala Ala Ile

20 25 30

Ser Ala Asp Thr Ser Asp Val Glu Ala Ser Arg Thr Ile Asp Ala Gly

35 40 45

Gly Lys Phe Val Met Pro Gly Val Val Asp Glu His Val His Ile Ile

50 55 60

Asp Met Asp Leu Lys Asn Arg Tyr Gly Arg Phe Glu Leu Asp Ser Glu

65 70 75 80

Ser Ala Ala Val Gly Gly Ile Thr Thr Ile Ile Glu Met Pro Ile Thr

85 90 95

Phe Pro Pro Thr Thr Thr Leu Asp Ala Phe Leu Glu Lys Lys Lys Gln

100 105 110

Ala Gly Gln Arg Leu Lys Val Asp Phe Ala Leu Tyr Gly Gly Gly Val

115 120 125

Pro Gly Asn Leu Pro Glu Ile Arg Lys Met His Asp Ala Gly Ala Val

130 135 140

Gly Phe Lys Ser Met Met Ala Ala Ser Val Pro Gly Met Phe Asp Ala

145 150 155 160

Val Ser Asp Gly Glu Leu Phe Glu Ile Phe Gln Glu Ile Ala Ala Cys

165 170 175

Gly Ser Val Ile Val Val His Ala Glu Asn Glu Thr Ile Ile Gln Ala

180 185 190

Leu Gln Lys Gln Ile Lys Ala Ala Gly Gly Lys Asp Met Ala Ala Tyr

195 200 205

Glu Ala Ser Gln Pro Val Phe Gln Glu Asn Glu Ala Ile Gln Arg Ala

210 215 220

Leu Leu Leu Gln Lys Glu Ala Gly Cys Arg Leu Ile Val Leu His Val

225 230 235 240

Ser Asn Pro Asp Gly Val Glu Leu Ile His Gln Ala Gln Ser Glu Gly

245 250 255

Gln Asp Val His Cys Glu Ser Gly Pro Gln Tyr Leu Asn Ile Thr Thr

260 265 270

Asp Asp Ala Glu Arg Ile Gly Pro Tyr Met Lys Val Ala Pro Pro Val

275 280 285

Arg Ser Ala Glu Met Asn Ile Arg Leu Trp Glu Gln Leu Glu Asn Gly

290 295 300

Leu Ile Asp Thr Leu Gly Ser Asp His Gly Gly His Pro Val Glu Asp

305 310 315 320

Lys Glu Pro Gly Trp Lys Asp Val Trp Lys Ala Gly Asn Gly Ala Leu

325 330 335

Gly Leu Glu Thr Ser Leu Pro Met Met Leu Thr Asn Gly Val Asn Lys

340 345 350

Gly Arg Leu Ser Leu Glu Arg Leu Val Glu Val Met Cys Glu Lys Pro

355 360 365

Ala Lys Leu Phe Gly Ile Tyr Pro Gln Lys Gly Thr Leu Gln Val Gly

370 375 380

Ser Asp Ala Asp Leu Leu Ile Leu Asp Leu Asp Ile Asp Thr Lys Val

385 390 395 400

Asp Ala Ser Gln Phe Arg Ser Leu His Lys Tyr Ser Pro Phe Asp Gly

405 410 415

Met Pro Val Thr Gly Ala Pro Val Leu Thr Met Val Arg Gly Thr Val

420 425 430

Val Ala Glu Lys Gly Glu Val Leu Val Glu Gln Gly Phe Gly Gln Phe

435 440 445

Val Thr Arg Arg Asn Tyr Glu Ala Ser Lys

450 455

<210>12

<211>1377

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>12

atgttcgatg tgatcgttaa aaactgccgt ctggttagca gcgacggcat caccgaagcg 60

gatattctgg tgaaagacgg caaggttgcg gcgatcagcg cggataccag cgacgttgaa 120

gcgagccgta ccattgatgc gggtggcaaa ttcgtgatgc cgggcgtggt tgacgagcac 180

gttcacatca ttgacatgga tctgaagaac cgttacggtc gttttgagct ggatagcgaa 240

agcgcggcgg ttggtggcat caccaccatc attgaaatgc cgattacctt cccgccgacc 300

accaccctgg atgcgtttct ggagaagaaa aagcaggcgg gccaacgtct gaaggtggac 360

ttcgcgctgt atggtggcgg tgttccgggt aacctgccgg agatccgtaa aatgcacgac 420

gcgggcgcgg tgggtttcaa gagcatgatg gcggcgagcg tgccgggcat gtttgatgcg 480

gttagcgacg gcgagctgtt cgaaatcttt caggaaattg cggcgtgcgg tagcgttatc 540

gtggttcacg cggagaacga aaccatcatt caagcgctgc agaaacaaat taaggcggcg 600

ggcggtaaag atatggcggc gtatgaggcg agccagccgg tgtttcaaga gaacgaagcg 660

attcagcgtg cgctgctgct gcaaaaggaa gcgggctgcc gtctgatcgt gctgcacgtt 720

agcaacccgg atggtgtgga gctgattcac caggcgcaaa gcgaaggcca ggacgttcac 780

tgcgagagcg gtccgcaata cctgaacatc accaccgacg atgcggaacg tattggtccg 840

tatatgaaag tggctccgcc ggttcgtagc gcggagatga acatccgtct gtgggagcag 900

ctggaaaacg gcctgattga taccctgggt agcgaccatg gcggtcaccc ggtggaggat 960

aaggaaccgg gctggaaaga cgtttggaaa gcgggtaacg gtgcgctggg tctggaaacc 1020

agcctgccga tgatgctgac caacggcgtg aacaaaggtc gtctgagcct ggagcgtctg 1080

gtggaagtta tgtgcgagaa accggcgaag ctgtttggta tctacccgca gaagggcacc 1140

ctgcaagtgg gtagcgacgc ggatctgctg atcctggacc tggatattga caccaaagtt 1200

gatgcgagcc agttccgtag cctgcacaag tatagcccgt ttgatggtat gccggtgacc 1260

ggtgcgccgg tgctgaccat ggttcgtggc accgtggttg cggagaaagg tgaagtgctg 1320

gttgaacagg gcttcggtca atttgttacc cgtcgtaact atgaggcgag caagtga 1377

Claims

1. A process for the preparation of optically active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenylamide, characterized in that: has the sequence shown in SEQ ID NO: 1. SEQ ID NO: 3. SEQ ID NO: 5 or SEQ ID NO: 7 with an enantiomeric mixture of 2- [4- (6-chloro-2-benzoxazolyloxy) -phenoxy ] propionic acid-N-methyl-N- (2, 6-difluoro-phenyl) amide to produce (R) -2- [4- (6-chloro-2-benzoxazolyloxy) -phenoxy ] propionic acid-N- (2-fluorophenyl) -N-methylamide.

2. The process for the preparation of optically active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenylamide according to claim 1, characterized in that the ratio of the above-mentioned polypeptide or transformant to the enantiomeric mixture of 2- [4- (6-chloro-2-benzoxazolyloxy) -phenoxy ] propionic acid-N-methyl-N- (2, 6-difluoro-phenyl) amide is 2-5: 1.

3. The process for the preparation of optically active (R) -phenoxypropionic acid-N-methyl-N-2-fluorophenylamide according to any one of claims 1 or 2, characterized in that: the transformant is obtained by introducing a recombinant vector into a host cell, wherein the recombinant vector contains a nucleotide sequence shown in SEQ ID NO: 2. SEQ ID NO: 4. SEQ ID NO: 6 or SEQ ID NO: 8 or a DNA molecule comprising a polypeptide according to any one of the preceding claims.

4. An optically active (R) -2- [4- (6-chloro-2-benzoxazolyloxy) -phenoxy ] propionic acid-N- (2-fluorophenyl) -N-methylamide, characterized in that: is prepared by any one of the preparation methods.