CN111269857A - Application of Rv0253 protein in separation of mycobacterium tuberculosis - Google Patents
Application of Rv0253 protein in separation of mycobacterium tuberculosis Download PDFInfo
- Publication number
- CN111269857A CN111269857A CN202010101857.8A CN202010101857A CN111269857A CN 111269857 A CN111269857 A CN 111269857A CN 202010101857 A CN202010101857 A CN 202010101857A CN 111269857 A CN111269857 A CN 111269857A
- Authority
- CN
- China
- Prior art keywords
- protein
- mycobacterium tuberculosis
- ala
- seq
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/5695—Mycobacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/35—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Mycobacteriaceae (F)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Computational Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses an application of Rv0253 protein in separation of mycobacterium tuberculosis. The inventor of the invention is based on
Description
Technical Field
The invention belongs to the field of biomedicine, and particularly relates to application of Rv0253 protein in separation of mycobacterium tuberculosis.
Background
Tuberculosis is a chronic infectious disease caused by the intracellular bacterial pathogen mycobacterium tuberculosis. The prevalence of tuberculosis is on the rise again due to the unique pathogenic characteristics and prevalence and transmission mode of mycobacterium tuberculosis, especially the generation of drug-resistant mycobacterium tuberculosis and the cross infection with Human Immunodeficiency Virus (HIV) in recent years. Mycobacterium tuberculosis, an intracellular infectious bacterium, is one of the most successful pathogens, and various strategies have evolved to adapt to host cells and evade immune surveillance. After entering human body through respiratory tract, mycobacterium tuberculosis is mainly parasitized in macrophage, and evades the immune killing effect of host cell by adopting various strategies, and can survive for a long time and proliferate slowly in macrophage. When host immunity is low, dormant mycobacterium tuberculosis can be reactivated, resulting in the development of active tuberculosis. The long-term latent or persistent infection of the pathogen in the host after infection with Mycobacterium tuberculosis poses a great obstacle to the treatment and prevention of the disease. In addition, the difficulty in treating tuberculosis at present is multi-drug resistant and widely drug resistant tuberculosis. The shortage of new drugs for tuberculosis and the shortage of relevant basic research of mycobacterium tuberculosis are the main reasons of low cure rate of drug-resistant tuberculosis. Therefore, a new drug target is urgently needed to be searched, and a new anti-tuberculosis drug is developed to treat tuberculosis.
Tuberculosis proteins Rv0577, Rv0236A, Rv2462c and Rv1576c are inherent proteins of mycobacterium tuberculosis, and the existence of pathogenic bacteria-mycobacterium tuberculosis can be identified by detecting any one of the tuberculosis proteins in a sample to be detected, so that the rapid diagnosis of tuberculosis infection or tuberculosis can be realized. Furthermore, transposon mutagenesis experiments have shown that the Rv1576c protein is essential for the growth of Mycobacterium tuberculosis in vitro, and disruption of the gene encoding the Rv1576c protein results in a growth defect of H37Rv in vitro (DeJesus M A, Gerrick E R, Xu W, Park S W, et al. comprehensive efficacy Analysis of the Mycobacterium tuberculosis Genome harvesting transduction mutation Mutagenesis. MBio.2017Jan 17; 8(1) pi: E02133-16.). The Rv1576c protein can be used as a new anti-tuberculosis drug target to develop a new anti-tuberculosis drug for treating tuberculosis.
The research on the interaction between the proteins of the mycobacterium tuberculosis can more deeply characterize the survival of bacteria in a host and the molecular mechanism of tuberculosis pathogenesis, and is also helpful for finding out a new anti-tuberculosis drug target.
Disclosure of Invention
The object of the present invention is to detect Mycobacterium tuberculosis.
The invention firstly protects the application of Rv0253 protein in preparing at least one of a mycobacterium tuberculosis separation reagent, a mycobacterium tuberculosis enrichment reagent, a mycobacterium tuberculosis detection reagent, a tuberculosis vaccine and an antituberculosis drug.
In the application, the mycobacterium tuberculosis separating reagent, the mycobacterium tuberculosis enriching reagent and the mycobacterium tuberculosis detecting reagent can be realized by combining Rv0253 protein and inherent protein of mycobacterium tuberculosis. The inherent protein of the mycobacterium tuberculosis can be at least one of Rv1576c protein, Rv0577 protein, Rv0236A protein and Rv2462c protein.
The invention also protects the application of the nucleic acid molecule for coding the Rv0253 protein in preparing at least one of a mycobacterium tuberculosis separation reagent, a mycobacterium tuberculosis enrichment reagent, a mycobacterium tuberculosis detection reagent, a tuberculosis vaccine and an antituberculosis drug.
The application of the Rv0253 protein or the nucleic acid molecule for coding the Rv0253 protein in the separation of the mycobacterium tuberculosis and/or the enrichment of the mycobacterium tuberculosis and/or the detection of the mycobacterium tuberculosis also belongs to the protection scope of the invention.
In the application, the separation of the mycobacterium tuberculosis and/or the enrichment of the mycobacterium tuberculosis and/or the detection of the mycobacterium tuberculosis can be realized by combining the Rv0253 protein and the inherent protein of the mycobacterium tuberculosis; the inherent protein of the mycobacterium tuberculosis can be at least one of Rv1576c protein, Rv0577 protein, Rv0236A protein and Rv2462c protein.
The invention also protects a reagent which can comprise at least one of b1) -b 3):
b1) rv0253 protein;
b2) a nucleic acid molecule encoding an Rv0253 protein;
b3) recombinant bacteria comprising a nucleic acid molecule encoding an Rv0253 protein;
the reagent is used for separating the mycobacterium tuberculosis and/or enriching the mycobacterium tuberculosis or detecting the mycobacterium tuberculosis.
The reagent may in particular consist of at least one of b1) -b 3);
b1) rv0253 protein;
b2) a nucleic acid molecule encoding an Rv0253 protein;
b3) a recombinant bacterium comprising a nucleic acid molecule encoding an Rv0253 protein.
The invention also provides a method for separating and/or enriching the mycobacterium tuberculosis, which is realized by combining the Rv0253 protein and the inherent protein of the mycobacterium tuberculosis; the inherent protein of the mycobacterium tuberculosis can be at least one of Rv1576c protein, Rv0577 protein, Rv0236A protein and Rv2462c protein.
The invention also provides a method for detecting whether the mycobacterium tuberculosis exists in the sample to be detected, which comprises the following steps:
(1) taking total protein of a sample to be detected, and separating and/or enriching by adopting Rv0253 protein;
(2) after the step (1) is completed, the following judgment is carried out: if the separated and/or enriched product contains the target protein, the mycobacterium tuberculosis exists in the sample to be detected; if the separated and/or enriched product does not contain the target protein, the sample to be tested does not contain the mycobacterium tuberculosis;
the target protein may be at least one of Rv1576c protein, Rv0577 protein, Rv0236A protein and Rv2462c protein.
Any one of the Rv0253 proteins described above can be a1) or a2) or a3) or a 4):
a1) SEQ ID NO: 2, and 2, or a pharmaceutically acceptable salt thereof;
a2) SEQ ID NO: 8, and a protein consisting of the amino acid sequence shown in the specification;
a3) in SEQ ID NO: 2 or SEQ ID NO: 8, the N end or/and the C end of the protein shown in 8 is connected with a label to obtain a fusion protein;
a4) converting SEQ ID NO: 2 or SEQ ID NO: 8 by substitution and/or deletion and/or addition of one or more amino acid residues, and has the same function as the protein of a 1).
Any one of the nucleic acid molecules encoding the Rv0253 protein can be a DNA molecule shown as c1), c2), c3), c4) or c 5):
c1) the coding region is SEQ ID NO: 1;
c2) the nucleotide sequence is SEQ ID NO: 1;
c3) the nucleotide sequence is SEQ ID NO: 7;
c4) a DNA molecule having 75% or more 75% identity to a nucleotide sequence defined by c1) or c2) or c3), derived from Mycobacterium tuberculosis and encoding any of the above-mentioned Rv0253 proteins;
c5) a DNA molecule which is derived from Mycobacterium tuberculosis and encodes any of the Rv0253 proteins described above, and hybridizes with the nucleotide sequence defined by c1) or c2) or c3) under stringent conditions.
Any of the Rv0236A proteins described above may be SEQ ID NO: 3, and 3, or a pharmaceutically acceptable salt thereof.
Any of the above Rv0577 proteins may be SEQ ID NO: 4, and 4.
Any of the Rv2462c proteins described above may be SEQ ID NO: 5 in sequence.
Any of the Rv1576c proteins described above may be SEQ ID NO: 6 in sequence.
The inventor of the invention is based on
Protein-protein interaction experiment screening and identification of mycobacterium tuberculosis proteome chip tuberculosis protein interacting with Rv0253 protein. The results show that the Rv0253 protein can be combined with any one of the Rv1576c protein, the Rv0577 protein, the Rv0236A protein and the Rv2462c protein, namely the Rv0253 protein can interact with any one of the Rv1576c protein, the Rv0577 protein, the Rv0236A protein and the Rv2462c protein, and can be combined with or captured by any one of the proteins. The Rv1576c protein, the Rv0577 protein, the Rv0236A protein and the Rv2462c protein are all the inherent proteins of the mycobacterium tuberculosis. Therefore, the Rv0253 protein can isolate and/or enrich and/or detect Mycobacterium tuberculosis. The invention has important application value.
Drawings
FIG. 1 shows the result of detecting the protein concentration of a sample of recombinant protein Rv 0253.
FIG. 2 is a schematic flow chart of a chip experiment.
FIG. 3 shows the scanning result of a portion of the chip.
Fig. 4 is a scan of Rv0577 protein, Rv0236A protein, Rv2462c protein and Rv1576c protein.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention.
The experimental procedures in the following examples are conventional unless otherwise specified.
The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.
The quantitative tests in the following examples, all set up three replicates and the results averaged.
The pET32a vector is the product of Merck Michibo Novagen, Catalogue No. 69030.
Example 1 expression and purification of recombinant protein Rv0253
Construction of recombinant plasmid pET32a-Rv0253
The amino acid sequence of the Rv0253 protein is shown as SEQ ID NO: 2, respectively. The nucleotide sequence of the gene for coding the Rv0253 protein (namely the Rv0253 gene) is shown as SEQ ID NO: 1 is shown.
The DNA fragment between restriction enzymes ecori and Xho i of the pET32a vector was replaced with SEQ ID NO: 1 to obtain a recombinant plasmid pET32a-Rv 0253.
In the recombinant plasmid pET32a-Rv0253, SEQ ID NO: 1 with the coding sequence of His-tag (consisting of 6 histidine residues) on the vector backbone to form the amino acid sequence of SEQ ID NO: 7, expressing the fusion gene shown in SEQ ID NO: 8, a fusion protein with His-tag label, namely recombinant protein Rv 0253.
Expression of recombinant protein Rv0253
1. The recombinant plasmid pET32a-Rv0253 is introduced into escherichia coli BL21 to obtain a recombinant bacterium, and the recombinant bacterium is named as BL21/pET32a-Rv 0253.
2. BL21/pET32a-Rv0253 was inoculated to 5mL of LB liquid medium as a single clone, and cultured overnight at 37 ℃ with shaking at 200rpm to obtain a culture broth 1.
3. 1-2. mu.L of the culture broth 1 was inoculated into 10mL of LB liquid medium and cultured overnight at 37 ℃ with shaking at 200rpm to obtain a culture broth 2.
4. Inoculating the culture bacterial liquid 2 to 500mL LB liquid culture medium at a volume ratio of 1:50, performing shaking culture at 37 deg.C and 200rpm to OD600nmThe value is 0.6 to 0.8; then IPTG was added thereto so that the concentration thereof in the system was 0.5mM, and the mixture was cultured at 37 ℃ with shaking at 200rpm until OD was reached600nmCentrifuging at 4 deg.C and 6000rpm for 5min to obtain precipitate (i.e. precipitate)Bacterial cells).
Thirdly, purification of the recombinant protein Rv0253
1. And taking the precipitate collected in the step two 4, and carrying out heavy suspension by using 10mM Tris-HCl buffer solution with the pH value of 8.0 (adding 20-30mL Tris-HCl buffer solution with the pH value of 8.0 and the mM of 10mM per 300mL of the precipitate collected in the culture system) to obtain a heavy suspension.
2. Taking the heavy suspension obtained in the step 1, carrying out ultrasonic crushing (ultrasonic power 500W, cycle program: crushing for 10s, stopping for 15s, total 60 times), then centrifuging for 10min at 4 ℃ and 10000rpm, and collecting the precipitate.
3. Taking the precipitate collected in the step 2, using 20-30mLpH8.0, 10mM Tris-HCl buffer solution to resuspend, standing for 10min, then centrifuging at 12000rpm for 10min, and collecting the precipitate 1.
4. Taking the precipitate 1 collected in the step 3, using 20-30mLpH8.0, 10mM Tris-HCl buffer solution to resuspend, standing for 10min, then centrifuging at 12000rpm for 10min, and collecting the precipitate 2.
5. The pellet 2 collected in step 4 was resuspended in a small amount of 10mM Tris-HCl buffer, pH8.0, and then 5-10mL of 8M urea in 10mM Tris-HCl buffer, pH8.0, was used to solubilize the proteins.
6. After completion of step 5, centrifugation was carried out at 12000rpm for 10min, and the supernatant was collected. The supernatant is the solution of recombinant protein Rv 0253.
Example 2 protein-protein interaction assay based on MTB M M.tuberculosis proteome chips tuberculosis proteins interacting with Rv0253 protein were screened and identified
The experiment was repeated three times, each repetition of the steps as follows:
1. preliminary detection of protein concentration and purity of recombinant protein Rv0253 solution by SDS-PAGE
(1) A solution of the recombinant protein Rv0253 prepared in step 6 of example 1 was taken, centrifuged, and subjected to SDS-PAGE.
(2) BSA standard solutions of different concentrations were taken and subjected to SDS-PAGE (loading volume was the same as that of the recombinant protein Rv0253 solution in step (1)).
The results show that the protein concentration of the recombinant protein Rv0253 solution is about 30 ng/. mu.L (roughly estimated by grey values), and the purity is more than 90%.
2. Protein labeling and detection of labeling efficiency
(1) The solution of the recombinant protein Rv0253 prepared in step three 6 of example 1 was desalted by dialysis.
(2) After completion of step (1), fluorescent Cy3(CyDye Protein LabellingCY3 MONO 5-PACK, GE, PA23001) was labeled.
(3) After the step (2) is completed, dialysis is carried out (in order to remove free glycine and other components), and a recombinant protein Rv0253 sample is obtained.
(4) After the step (3) is completed, the recombinant protein Rv0253 sample, Cy3-BSA (as a positive control) and BSA (as a negative control) which are diluted in a gradient manner are respectively spotted on an NC membrane, and the fluorescence labeling efficiency is qualitatively evaluated by Dot blot.
The results show that the sensitivity of the recombinant protein Rv0253 sample is less than 1 ng. Therefore, the protein labeling efficiency is better.
3. Detecting the protein concentration of a recombinant protein Rv0253 sample
(1) Taking a recombinant protein Rv0253 sample, and performing SDS-PAGE.
(2) BSA standard solutions of different concentrations were taken and subjected to SDS-PAGE (loading volume was the same as that of the sample of recombinant protein Rv0253 in step (1)).
The detection result is shown in figure 1(M is a protein Marker, and Rv0253 is a recombinant protein Rv0253 sample). The results show that the protein concentration of the recombinant protein Rv0253 sample is about 30 ng/. mu.L (roughly estimated by grey values).
4. Chip experiment
The blocking solution was prepared by mixing 3mL of 10% (m/v) BSA aqueous solution and 7mL of 1 XPBS buffer.
The incubation was mixed with 1mL of 10% (m/v) BSA aqueous solution and 9mL of 1 XPBST buffer.
The wash solution was 1 XPBST buffer.
The flow chart of the chip experiment is shown in FIG. 2.
(1) Taking an incubation box, and adding 5mL of confining liquid; then taking out the chip from-80 ℃, and placing the chip in an incubation box with the front face upward (the chip is completely immersed in the sealing liquid); then transversely placing on a side shaking table, sealing at 4 ℃ and 50-60rpm for 3 h.
(2) After the step (1) is completed, the blocking solution is discarded, 3mL of the incubation solution containing the recombinant protein Rv0253 is rapidly added, and the mixture is placed in a side-swing shaker and incubated overnight at the temperature of 4 ℃ and at the speed of 20-30 rpm.
The incubation solution containing the recombinant protein Rv0253 is obtained by dissolving a sample of the recombinant protein Rv0253 in the incubation solution. In the incubation liquid containing the recombinant protein Rv0253, the protein concentration of the recombinant protein Rv0253 is 4 mug/mL.
(3) After the step (2) is finished, the chip is cleaned for 4 times in a dark place, and the cleaning step each time is as follows: placing the chip in a chip cleaning box filled with cleaning solution, placing in a horizontal shaking table, and oscillating at 60-70rpm for 5 min.
(4) After the step (3) is completed, the chip is processed by ddH2Washing with dark for 5min for 2 times.
(5) And (4) after the step (4) is finished, placing the chip in a chip dryer, and centrifugally drying.
(6) After completion of step (5), chip scanning was performed at 532nm excitation wavelength using an Innoscan 900 chip scanner (Cy3 shows red light at 532nm excitation), and the scan pictures were saved to obtain chip data.
The partial scan results are shown in figure 3.
(7) After the step (6) is completed, the chip data is analyzed as follows:
(7-1) to eliminate the signal nonuniformity caused by the background value nonuniformity between different protein spots in the same chip, the background normalization method was used. The implementation is that the ratio of the foreground value (i.e. F532Median) to the background value (i.e. B532 Median) of each protein, i.e. F/B, and the SNR (signal to noise ratio), i.e. the mean of the F/B of the two repeated proteins, is defined on this basis.
(7-2) for different chips, in order to eliminate systematic errors caused by samples and experimental operations, Z-score standardization processing is performed on SNR before data comparison.
(7-3) setting a positive cutoff threshold value for the normalized data, and respectively calculating the number of positive points on the chip through the threshold value; define cutoff to 2, mean +2SD after normalization (this value is set according to the chip result, not the standard value). Under this criterion, potential positive proteins were screened.
The important parameters are explained as follows:
block, column, and Row refer to the number, i.e., location, of the array, column, and Row, in that order.
Name and ID refer to the protein Name and gene Name, in that order.
F532 media: the median value of the foreground value of the signal in the 532nm channel refers to the intensity median value of all the pixel points corresponding to each signal point, and is used for representing the signal intensity.
B532 media: the median value of the background value under the 532nm channel refers to the intensity median value of the pixel points in a certain range of the background around each signal point, and is used for representing the background value.
Some of the results are shown in FIG. 4 and Table 1. The results show that the number of positive proteins is 4, and the positive proteins are Rv0577 protein, Rv0236A protein, Rv2462c protein and Rv1576c protein.
TABLE 1
| SNR | |
| Rv0577 protein | 5.97 |
| Rv0236A protein | 3.35 |
| Rv2462c protein | 3.12 |
| Rv1576c protein | 2.72 |
The above results indicate that the recombinant protein Rv0253 can bind to any one of Rv0577 protein, Rv0236A protein, Rv2462c protein and Rv1576c protein, i.e. the recombinant protein Rv0253 can interact with any one of Rv0577 protein, Rv0236A protein, Rv2462c protein and Rv1576c protein, and can bind to or capture any one of them.
<110> research institute of tuberculosis and breast tumor in Beijing, the department of thoracic medicine of Beijing, affiliated to the university of capital medical science
Application of <120> Rv0253 protein in separation of mycobacterium tuberculosis
<160>8
<170>PatentIn version 3.5
<210>1
<211>357
<212>DNA
<213>Artificial sequence
<400>1
gtgacgcttc tcaacgacat tcaggtatgg accaccgcct gcgcatacga ccatctcatt 60
ccgggacgtg gtgtcggggt gttactcgat gacggtagtc aggtggcact gttccggctc 120
gacgacggct cggtgcacgc ggtcggtaac gtcgacccgt tctccggtgc tgcggtgatg 180
tcccgcggca tcgtcggtga tcgcggaggt cgcgccatgg tgcaatcgcc gatcctgaag 240
caggctttcg cgctcgacga tggctcgtgc ctcgacgatc cgcgcgtttc ggtgccggtg 300
tatccggcgc gcgtcacacc cgaaggccgc attcaggtcg cgcgggtagc ggtctag 357
<210>2
<211>118
<212>PRT
<213>Artificial sequence
<400>2
Val Thr Leu Leu Asn Asp Ile Gln Val Trp Thr Thr Ala Cys Ala Tyr
1 5 10 15
Asp His Leu Ile Pro Gly Arg Gly Val Gly Val Leu Leu Asp Asp Gly
20 25 30
Ser Gln Val Ala Leu Phe Arg Leu Asp Asp Gly Ser Val His Ala Val
35 40 45
Gly Asn Val Asp Pro Phe Ser Gly Ala Ala Val Met Ser Arg Gly Ile
50 55 60
Val Gly Asp Arg Gly Gly Arg Ala Met Val Gln Ser Pro Ile Leu Lys
65 70 75 80
Gln Ala Phe Ala Leu Asp Asp Gly Ser Cys Leu Asp Asp Pro Arg Val
85 90 95
Ser Val Pro Val Tyr Pro Ala Arg Val Thr Pro Glu Gly Arg Ile Gln
100 105 110
Val Ala Arg Val Ala Val
115
<210>3
<211>57
<212>PRT
<213>Artificial sequence
<400>3
Met Asn Arg Ile Val Ala Pro Ala Ala Ala Ser Val Val Val Gly Leu
1 5 10 15
Leu Leu Gly Ala Ala Ala Ile Phe Gly Val Thr Leu Met Val Gln Gln
20 25 30
Asp Lys Lys Pro Pro Leu Pro Gly Gly Asp Pro Ser Ser Ser Val Leu
35 40 45
Asn Arg Val Glu Tyr Gly Asn Arg Ser
50 55
<210>4
<211>261
<212>PRT
<213>Artificial sequence
<400>4
Met Pro Lys Arg Ser Glu Tyr Arg Gln Gly Thr Pro Asn Trp Val Asp
1 5 10 15
Leu Gln Thr Thr Asp Gln Ser Ala Ala Lys Lys Phe Tyr Thr Ser Leu
20 25 30
Phe Gly Trp Gly Tyr Asp Asp Asn Pro Val Pro Gly Gly Gly Gly Val
35 40 45
Tyr Ser Met Ala Thr Leu Asn Gly Glu Ala Val Ala Ala Ile Ala Pro
50 55 60
Met Pro Pro Gly Ala Pro Glu Gly Met Pro Pro Ile Trp Asn Thr Tyr
65 70 75 80
Ile Ala Val Asp Asp Val Asp Ala Val Val Asp Lys Val Val Pro Gly
85 90 95
Gly Gly Gln Val Met Met Pro Ala Phe Asp Ile Gly Asp Ala Gly Arg
100 105 110
Met Ser Phe Ile Thr Asp Pro Thr Gly Ala Ala Val Gly Leu Trp Gln
115 120 125
Ala Asn Arg His Ile Gly Ala Thr Leu Val Asn Glu Thr Gly Thr Leu
130 135 140
Ile Trp Asn Glu Leu Leu Thr Asp Lys Pro Asp Leu Ala Leu Ala Phe
145 150 155 160
Tyr Glu Ala Val Val Gly Leu Thr His Ser Ser Met Glu Ile Ala Ala
165 170 175
Gly Gln Asn Tyr Arg Val Leu Lys Ala Gly Asp Ala Glu Val Gly Gly
180 185 190
Cys Met Glu Pro Pro Met Pro Gly Val Pro Asn His Trp His Val Tyr
195 200 205
Phe Ala Val Asp Asp Ala Asp Ala Thr Ala Ala Lys Ala Ala Ala Ala
210 215 220
Gly Gly Gln Val Ile Ala Glu Pro Ala Asp Ile Pro Ser Val Gly Arg
225 230 235 240
Phe Ala Val Leu Ser Asp Pro Gln Gly Ala Ile Phe Ser Val Leu Lys
245 250 255
Pro Ala Pro Gln Gln
260
<210>5
<211>466
<212>PRT
<213>Artificial sequence
<400>5
Val Lys Ser Thr Val Glu Gln Leu Ser Pro Thr Arg Val Arg Ile Asn
1 5 10 15
Val Glu Val Pro Phe Ala Glu Leu Glu Pro Asp Phe Gln Arg Ala Tyr
20 25 30
Lys Glu Leu Ala Lys Gln Val Arg Leu Pro Gly Phe Arg Pro Gly Lys
35 40 45
Ala Pro Ala Lys Leu Leu Glu Ala Arg Ile Gly Arg Glu Ala Met Leu
50 55 60
Asp Gln Ile Val Asn Asp Ala Leu Pro Ser Arg Tyr Gly Gln Ala Val
65 70 75 80
Ala Glu Ser Asp Val Gln Pro Leu Gly Arg Pro Asn Ile Glu Val Thr
85 90 95
Lys Lys Glu Tyr Gly Gln Asp Leu Gln Phe Thr Ala Glu Val Asp Ile
100 105 110
Arg Pro Lys Ile Ser Pro Pro Asp Leu Ser Ala Leu Thr Val Ser Val
115 120 125
Asp Pro Ile Glu Ile Gly Glu Asp Asp Val Asp Ala Glu Leu Gln Ser
130 135 140
Leu Arg Thr Arg Phe Gly Thr Leu Thr Ala Val Asp Arg Pro Val Ala
145 150 155 160
Val Gly Asp Val Val Ser Ile Asp Leu Ser Ala Thr Val Asp Gly Glu
165 170 175
Asp Ile Pro Asn Ala Ala Ala Glu Gly Leu Ser His Glu Val Gly Ser
180 185 190
Gly Arg Leu Ile Ala Gly Leu Asp Asp Ala Val Val Gly Leu Ser Ala
195 200 205
Asp Glu Ser Arg Val Phe Thr Ala Lys Leu Ala Ala Gly Glu His Ala
210 215 220
Gly Gln Glu Ala Gln Val Thr Val Thr Val Arg Ser Val Lys Glu Arg
225 230 235 240
Glu Leu Pro Glu Pro Asp Asp Glu Phe Ala Gln Leu Ala Ser Glu Phe
245 250 255
Asp Ser Ile Asp Glu Leu Arg Ala Ser Leu Ser Asp Gln Val Arg Gln
260 265 270
Ala Lys Arg Ala Gln Gln Ala Glu Gln Ile Arg Asn Ala Thr Ile Asp
275 280 285
Ala Leu Leu Glu Gln Val Asp Val Pro Leu Pro Glu Ser Tyr Val Gln
290 295 300
Ala Gln Phe Asp Ser Val Leu His Ser Ala Leu Ser Gly Leu Asn His
305 310 315 320
Asp Glu Ala Arg Phe Asn Glu Leu Leu Val Glu Gln Gly Ser Ser Arg
325 330 335
Ala Ala Phe Asp Ala Glu Ala Arg Thr Ala Ser Glu Lys Asp Val Lys
340 345 350
Arg Gln Leu Leu Leu Asp Ala Leu Ala Asp Glu Leu Gln Val Gln Val
355 360 365
Gly Gln Asp Asp Leu Thr Glu Arg Leu Val Thr Thr Ser Arg Gln Tyr
370 375 380
Gly Ile Glu Pro Gln Gln Leu Phe Gly Tyr Leu Gln Glu Arg Asn Gln
385 390 395 400
Leu Pro Thr Met Phe Ala Asp Val Arg Arg Glu Leu Ala Ile Arg Ala
405 410 415
Ala Val Glu Ala Ala Thr Val Thr Asp Ser Asp Gly Asn Thr Ile Asp
420 425 430
Thr Ser Glu Phe Phe Gly Lys Arg Val Ser Ala Gly Glu Ala Glu Glu
435 440 445
Ala Glu Pro Ala Asp Glu Gly Ala Ala Arg Ala Ala Ser Asp Glu Ala
450 455 460
Thr Thr
465
<210>6
<211>473
<212>PRT
<213>Artificial sequence
<400>6
Met Thr Glu Phe Asp Asp Ile Lys Asn Leu Ser Leu Pro Glu Thr Arg
1 5 10 15
Asp Ala Ala Lys Gln Leu Leu Asp Ser Val Ala Gly Asp Leu Thr Gly
20 25 30
Glu Ala Ala Gln Arg Phe Gln Ala Leu Thr Arg His Ala Glu Glu Leu
35 40 45
Arg Ala Glu Gln Arg Arg Arg Gly Arg Glu Ala Glu Glu Ala Leu Arg
50 55 60
Arg Tyr Arg Ala Gly Glu Leu Arg Val Val Pro Gly Ala Pro Thr Gly
65 70 75 80
Gly Asp Asp Gly Asp Ala Pro Pro Gly Asn Ser Leu Arg Asp Thr Ala
85 90 95
Phe Arg Thr Leu Asp Ser Cys Val Arg Asp Gly Leu Met Ser Ser Arg
100 105 110
Ala Ala Glu Thr Ala Glu Thr Leu Cys Arg Thr Gly Pro Pro Gln Ser
115 120 125
Thr Ser Trp Ala Gln Arg Trp Leu Ala Ala Thr Gly Ser Arg Asp Tyr
130 135 140
Leu Gly Ala Phe Val Lys Arg Val Ser Asn Pro Val Ala Gly His Thr
145 150 155 160
Val Trp Thr Asp Arg Glu Ala Ala Ala Trp Arg Glu Ala Ala Ala Val
165 170 175
Ala Ala Glu Gln Arg Ala Met Gly Leu Val Asp Thr Gln Gly Gly Phe
180 185 190
Leu Ile Pro Ala Ala Leu Asp Pro Ala Ile Leu Leu Ser Gly Asp Gly
195 200 205
Ser Thr Asn Pro Ile Arg Gln Val Ala Arg Val Val Gln Thr Thr Ser
210 215 220
Glu Ile Trp Arg Gly Val Thr Ser Glu Gly Ala Glu Ala Arg Trp Tyr
225 230 235 240
Ser Glu Ala Gln Glu Val Ser Asp Asp Ser Pro Ala Leu Ala Gln Pro
245 250 255
Ala Val Pro Asn Tyr Arg Gly Ser Cys Trp Ile Pro Phe Ser Ile Glu
260 265 270
Leu Glu Gly Asp Ala Ala Ser Phe Val Gly Glu Ile Gly Lys Ile Leu
275 280 285
Ala Asp Ser Val Glu Gln Leu Gln Ala Ala Ala Phe Val Asn Gly Ser
290 295 300
Gly Asn Gly Glu Pro Thr Gly Phe Val Ser Ala Leu Thr Gly Thr Ser
305 310 315 320
Asp Gln Val Val Val Gly Ala Gly Ser Glu Ala Ile Val Ala Ala Asp
325 330 335
Val Tyr Ala Leu Gln Ser Ala Leu Pro Pro Arg Phe Gln Ala Ser Ala
340 345 350
Ala Phe Ala Ala Asn Leu Ser Thr Ile Asn Thr Leu Arg Gln Ala Glu
355 360 365
Thr Ser Asn Gly Ala Leu Lys Phe Pro Ser Leu His Asp Ser Pro Pro
370 375 380
Met Leu Ala Gly Lys Ser Val Leu Glu Val Ser His Met Asp Thr Val
385 390 395 400
Asp Ser Ala Val Thr Ala Thr Asn His Pro Leu Val Leu Gly Asp Trp
405 410 415
Lys Gln Phe Leu Ile Gly Asp Arg Val Gly Ser Met Val Glu Leu Val
420 425 430
Pro His Leu Phe Gly Pro Asn Arg Arg Pro Thr Gly Gln Arg Gly Phe
435 440 445
Phe Ala Trp Phe Arg Val Gly Ser Asp Val Leu Val Arg Asn Ala Phe
450 455 460
Arg Val Leu Lys Val Glu Thr Thr Ala
465 470
<210>7
<211>858
<212>DNA
<213>Artificial sequence
<400>7
atgagcgata aaattattca cctgactgac gacagttttg acacggatgt actcaaagcg 60
gacggggcga tcctcgtcga tttctgggca gagtggtgcg gtccgtgcaa aatgatcgcc 120
ccgattctgg atgaaatcgc tgacgaatat cagggcaaac tgaccgttgc aaaactgaac 180
atcgatcaaa accctggcac tgcgccgaaa tatggcatcc gtggtatccc gactctgctg 240
ctgttcaaaa acggtgaagt ggcggcaacc aaagtgggtg cactgtctaa aggtcagttg 300
aaagagttcc tcgacgctaa cctggccggt tctggttctg gccatatgca ccatcatcat 360
catcattctt ctggtctggt gccacgcggt tctggtatga aagaaaccgc tgctgctaaa 420
ttcgaacgcc agcacatgga cagcccagat ctgggtaccg acgacgacga caaggccatg 480
gctgatatcg gatccgaatt cgtgacgctt ctcaacgaca ttcaggtatg gaccaccgcc 540
tgcgcatacg accatctcattccgggacgt ggtgtcgggg tgttactcga tgacggtagt 600
caggtggcac tgttccggct cgacgacggc tcggtgcacg cggtcggtaa cgtcgacccg 660
ttctccggtg ctgcggtgat gtcccgcggc atcgtcggtg atcgcggagg tcgcgccatg 720
gtgcaatcgc cgatcctgaa gcaggctttc gcgctcgacg atggctcgtg cctcgacgat 780
ccgcgcgttt cggtgccggt gtatccggcg cgcgtcacac ccgaaggccg cattcaggtc 840
gcgcgggtag cggtctag 858
<210>8
<211>285
<212>PRT
<213>Artificial sequence
<400>8
Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp Ser Phe Asp Thr Asp
1 5 10 15
Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp Phe Trp Ala Glu Trp
20 25 30
Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu Asp Glu Ile Ala Asp
35 40 45
Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu Asn Ile Asp Gln Asn
50 55 60
Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly Ile Pro Thr Leu Leu
65 70 75 80
Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys Val Gly Ala Leu Ser
8590 95
Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn Leu Ala Gly Ser Gly
100 105 110
Ser Gly His Met His His His His His His Ser Ser Gly Leu Val Pro
115 120 125
Arg Gly Ser Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln
130 135 140
His Met Asp Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met
145 150 155 160
Ala Asp Ile Gly Ser Glu Phe Val Thr Leu Leu Asn Asp Ile Gln Val
165 170 175
Trp Thr Thr Ala Cys Ala Tyr Asp His Leu Ile Pro Gly Arg Gly Val
180 185 190
Gly Val Leu Leu Asp Asp Gly Ser Gln Val Ala Leu Phe Arg Leu Asp
195 200 205
Asp Gly Ser Val His Ala Val Gly Asn Val Asp Pro Phe Ser Gly Ala
210 215 220
Ala Val Met Ser Arg Gly Ile Val Gly Asp Arg Gly Gly Arg Ala Met
225 230 235 240
Val Gln Ser Pro Ile Leu Lys Gln Ala Phe Ala Leu Asp Asp Gly Ser
245250 255
Cys Leu Asp Asp Pro Arg Val Ser Val Pro Val Tyr Pro Ala Arg Val
260 265 270
Thr Pro Glu Gly Arg Ile Gln Val Ala Arg Val Ala Val
275 280 285
Claims (10)
- Application of Rv0253 protein in preparation of at least one of a mycobacterium tuberculosis separation reagent, a mycobacterium tuberculosis enrichment reagent, a mycobacterium tuberculosis detection reagent, a tuberculosis vaccine and an anti-tuberculosis drug.
- 2. The application of the nucleic acid molecule for coding the Rv0253 protein in preparing at least one of a mycobacterium tuberculosis separation reagent, a mycobacterium tuberculosis enrichment reagent, a mycobacterium tuberculosis detection reagent, a tuberculosis vaccine and an anti-tuberculosis drug.
- Use of Rv0253 protein or a nucleic acid molecule encoding Rv0253 protein for isolating Mycobacterium tuberculosis and/or enriching Mycobacterium tuberculosis and/or detecting Mycobacterium tuberculosis.
- 4. A reagent comprising at least one of b1) -b 3):b1) rv0253 protein;b2) a nucleic acid molecule encoding an Rv0253 protein;b3) recombinant bacteria comprising a nucleic acid molecule encoding an Rv0253 protein;the reagent is used for separating the mycobacterium tuberculosis and/or enriching the mycobacterium tuberculosis or detecting the mycobacterium tuberculosis.
- 5. The use according to any one of claims 1 to 3 or the agent according to claim 4, wherein:the Rv0253 protein is a1) or a2) or a3) or a 4):a1) SEQ ID NO: 2, and 2, or a pharmaceutically acceptable salt thereof;a2) SEQ ID NO: 8, and a protein consisting of the amino acid sequence shown in the specification;a3) in SEQ ID NO: 2 or SEQ ID NO: 8, the N end or/and the C end of the protein shown in 8 is connected with a label to obtain a fusion protein;a4) converting SEQ ID NO: 2 or SEQ ID NO: 8 by substitution and/or deletion and/or addition of one or more amino acid residues, and has the same function as the protein of a 1).
- 6. The use according to any one of claims 1 to 3 or the agent according to claim 4, wherein: the nucleic acid molecule encoding the Rv0253 protein is a DNA molecule shown as c1), c2), c3), c4) or c 5):c1) the coding region is SEQ ID NO: 1;c2) the nucleotide sequence is SEQ ID NO: 1;c3) the nucleotide sequence is SEQ ID NO: 7;c4) a DNA molecule having 75% or more 75% identity to a nucleotide sequence defined by c1) or c2) or c3), derived from mycobacterium tuberculosis and encoding the Rv0253 protein of claim 5;c5) a DNA molecule derived from mycobacterium tuberculosis and encoding the Rv0253 protein of claim 5, which hybridizes under stringent conditions to a nucleotide sequence defined in c1) or c2) or c 3).
- 7. A method for separating and/or enriching mycobacterium tuberculosis is realized by combining Rv0253 protein and inherent protein of mycobacterium tuberculosis;the inherent protein of the mycobacterium tuberculosis is at least one of Rv1576c protein, Rv0577 protein, Rv0236A protein and Rv2462c protein.
- 8. A method for detecting whether a sample to be detected has mycobacterium tuberculosis comprises the following steps:(1) taking total protein of a sample to be detected, and separating and/or enriching by adopting Rv0253 protein;(2) after the step (1) is completed, the following judgment is carried out: if the separated and/or enriched product contains the target protein, the mycobacterium tuberculosis exists in the sample to be detected; if the separated and/or enriched product does not contain the target protein, the sample to be tested does not contain the mycobacterium tuberculosis;the target protein is at least one of Rv1576c protein, Rv0577 protein, Rv0236A protein and Rv2462c protein.
- 9. The method of claim 7 or 8, wherein: the Rv0253 protein is a1) or a2) or a3) or a 4):a1) SEQ ID NO: 2, and 2, or a pharmaceutically acceptable salt thereof;a2) SEQ ID NO: 8, and a protein consisting of the amino acid sequence shown in the specification;a3) in SEQ ID NO: 2 or SEQ ID NO: 8, the N end or/and the C end of the protein shown in 8 is connected with a label to obtain a fusion protein;a4) converting SEQ ID NO: 2 or SEQ ID NO: 8 by substitution and/or deletion and/or addition of one or more amino acid residues, and has the same function as the protein of a 1).
- 10. The method of claim 7 or 8, wherein:the Rv0236A protein is SEQ ID NO: 3, and the protein consists of an amino acid sequence shown in the specification;the Rv0577 protein is SEQ ID NO: 4, or a protein consisting of the amino acid sequence shown in the specification;the Rv2462c protein is SEQ ID NO: 5 in sequence of amino acids;the Rv1576c protein is SEQ ID NO: 6 in sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010101857.8A CN111269857B (en) | 2020-02-19 | 2020-02-19 | Application of Rv0253 protein in separation of mycobacterium tuberculosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010101857.8A CN111269857B (en) | 2020-02-19 | 2020-02-19 | Application of Rv0253 protein in separation of mycobacterium tuberculosis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111269857A true CN111269857A (en) | 2020-06-12 |
| CN111269857B CN111269857B (en) | 2021-12-14 |
Family
ID=70995264
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010101857.8A Active CN111269857B (en) | 2020-02-19 | 2020-02-19 | Application of Rv0253 protein in separation of mycobacterium tuberculosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111269857B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115184603A (en) * | 2022-06-30 | 2022-10-14 | 首都医科大学附属北京胸科医院 | Application of EspC protein in preparation of mycobacterium tuberculosis separation or enrichment product |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB1171783A (en) * | 1965-12-10 | 1969-11-26 | Schering Ag | Pharmaceutical Preparations Containing a Vaccine. |
| CN104404058A (en) * | 2014-11-05 | 2015-03-11 | 中国科学院遗传与发育生物学研究所 | Protein for preparing beta-picric acid, and application thereof |
| CN108004253A (en) * | 2017-12-01 | 2018-05-08 | 北京蛋白质组研究中心 | Mycobacterium tuberculosis H37Rv encoding gene and its application |
| CN110506108A (en) * | 2017-04-07 | 2019-11-26 | 成都永安制药有限公司 | It is overexpressed the recombinant BCG of phoP-phoR |
-
2020
- 2020-02-19 CN CN202010101857.8A patent/CN111269857B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB1171783A (en) * | 1965-12-10 | 1969-11-26 | Schering Ag | Pharmaceutical Preparations Containing a Vaccine. |
| CN104404058A (en) * | 2014-11-05 | 2015-03-11 | 中国科学院遗传与发育生物学研究所 | Protein for preparing beta-picric acid, and application thereof |
| CN110506108A (en) * | 2017-04-07 | 2019-11-26 | 成都永安制药有限公司 | It is overexpressed the recombinant BCG of phoP-phoR |
| CN108004253A (en) * | 2017-12-01 | 2018-05-08 | 北京蛋白质组研究中心 | Mycobacterium tuberculosis H37Rv encoding gene and its application |
Non-Patent Citations (1)
| Title |
|---|
| 曹廷明等: "结核分枝杆菌Rv1512基因的特异性和克隆表达", 《临床肺科杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115184603A (en) * | 2022-06-30 | 2022-10-14 | 首都医科大学附属北京胸科医院 | Application of EspC protein in preparation of mycobacterium tuberculosis separation or enrichment product |
| CN115184603B (en) * | 2022-06-30 | 2024-02-06 | 首都医科大学附属北京胸科医院 | Application of EspC protein in preparation of mycobacterium tuberculosis separation or enrichment product |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111269857B (en) | 2021-12-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1189186A (en) | OMP 26 antigen from haemophilus influenzae | |
| JP4755977B2 (en) | Method for producing surface antigens of swine erysipelas in Escherichia coli | |
| CN101143216A (en) | Escherichia coli TolC antibody targeting effect improving drug-resistant bacteria sensitivity to antibiotic technology | |
| CN110862435A (en) | African swine fever CTL epitope polypeptide and application thereof | |
| JP6814739B2 (en) | Marker system, especially for baculovirus-expressing subunit antigen | |
| CN111269857B (en) | Application of Rv0253 protein in separation of mycobacterium tuberculosis | |
| CN1045603A (en) | Screening system | |
| CN111269856B (en) | Method for separating and/or enriching mycobacterium tuberculosis | |
| CN111606978B (en) | Method for removing endotoxin in escherichia coli recombinant expression porcine parvovirus VP2 protein | |
| CN103788190B (en) | β-1,3-glucosan identification albumen and its preparation method and application | |
| US20030044771A1 (en) | Method for discovering new infectious particles | |
| CN108578686A (en) | A method of preparing clostridiosis of sheep genetic engineering subunit vaccine | |
| CN106834324B (en) | Recombinant expression vector capable of promoting soluble expression of protein and increasing expression quantity | |
| CN1433428A (en) | Immunological methodology for discerning human papillomavirus | |
| CN111848748A (en) | African swine fever virus truncated protein and application thereof in preparation of ELISA (enzyme-linked immunosorbent assay) detection kit | |
| CN109266666B (en) | Chimeric virus-like particle of duck tembusu virus E protein and application thereof | |
| CN106754981A (en) | A kind of method that utilization E. coli system prepares Goose Parvovirus sample particle | |
| CN106632664A (en) | Apolipoprotein II/I and preparation method, biological function and application thereof | |
| CN1294418C (en) | Method and reagent box for inspecting mycelian protein antibody of white candida | |
| Banu et al. | Rapid quantification of Escherichia coli in food and media using bacteriophage T7 amplification and liquid chromatography-multiple reaction monitoring tandem mass spectrometry | |
| CN112730829B (en) | Colloidal gold test strip for rapidly detecting oyster herpesvirus OsHV-1 and application thereof | |
| CN115340609A (en) | Foot-and-mouth disease virus multi-antigen epitope fusion protein, protein cage nanoparticle and preparation method thereof | |
| CN113564129B (en) | Fox retrovirus strain and application thereof | |
| CN114276423B (en) | S protein mutant of porcine transmissible gastroenteritis virus and application thereof | |
| CN115184603B (en) | Application of EspC protein in preparation of mycobacterium tuberculosis separation or enrichment product |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |