CN111269843A - Erythromycin degradation bacterium RJJ-2 and application thereof - Google Patents
Erythromycin degradation bacterium RJJ-2 and application thereof Download PDFInfo
- Publication number
- CN111269843A CN111269843A CN202010186808.9A CN202010186808A CN111269843A CN 111269843 A CN111269843 A CN 111269843A CN 202010186808 A CN202010186808 A CN 202010186808A CN 111269843 A CN111269843 A CN 111269843A
- Authority
- CN
- China
- Prior art keywords
- erythromycin
- rjj
- penicillium oxalicum
- degradation
- degrading
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/80—Penicillium
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
- B09C—RECLAMATION OF CONTAMINATED SOIL
- B09C1/00—Reclamation of contaminated soil
- B09C1/10—Reclamation of contaminated soil microbiologically, biologically or by using enzymes
- B09C1/105—Reclamation of contaminated soil microbiologically, biologically or by using enzymes using fungi or plants
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F3/00—Biological treatment of water, waste water, or sewage
- C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
- C02F3/347—Use of yeasts or fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Environmental & Geological Engineering (AREA)
- Biodiversity & Conservation Biology (AREA)
- Hydrology & Water Resources (AREA)
- Water Supply & Treatment (AREA)
- Molecular Biology (AREA)
- Soil Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an erythromycin-degrading bacteria RJJ-2, application thereof, a method for degrading erythromycin and an erythromycin-degrading bacteria dry powder agent. The invention has the beneficial effects that: the erythromycin-degrading bacteria and the application thereof provided by the invention are characterized in that the microbes capable of degrading erythromycin are obtained from specific environmental conditions or through modification according to the characteristics of erythromycin by a microbial technical means, and the erythromycin structure is catalytically degraded by macrocyclic lactonase, transferase, lyase and the like to obtain a pollution-free metabolite. Experiments prove that the erythromycin degradation bacterium RJJ-2 can survive in an environment with erythromycin as a unique carbon source, has high erythromycin degradation activity, and has an erythromycin degradation rate of 45-70%. The erythromycin degradation bacterium RJJ-2 provided by the invention can be applied to the degradation of erythromycin in a polluted environment, and has good application value in the aspects of water treatment and soil remediation.
Description
Technical Field
The invention relates to the technical field of microorganisms, and in particular relates to an erythromycin degrading bacterium RJJ-2 and application thereof.
Background
A large amount of fungus dregs are generated in the antibiotic production process, and the main components of the fungus dregs comprise thalli or mycelium for generating the antibiotic, a waste culture medium, metabolites generated in the fermentation process, the antibiotic and the like. The mushroom dreg waste is regarded as dangerous waste by the national department. Improper treatment methods are easy to cause environmental pollution and ecological hazards, and waste of resources is also caused. The production process of the erythromycin also generates the same problems, and the ecological toxicity is mainly reflected in the following two points that the balance of an inherent ecological system which is related to a food chain in the environment is damaged by influencing the population quantity, the population structure and the nutrition transfer mode of various organisms in the environment; secondly, a large amount of anti-erythromycins are generated in the fungus dregs, and after the anti-erythromycins are propagated and spread, the anti-erythromycins are finally harmful to human health after a series of accumulation.
The prior erythromycin mushroom residue treatment method mainly comprises incineration treatment, anaerobic digestion technical treatment, mushroom residue purification, energy treatment and the like. These treatments are costly, energy intensive and may have secondary pollution, and therefore more safe methods are urgently needed to treat antibiotic residues.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provides an erythromycin-degrading bacterium, namely Penicillium oxalicum (RJJ-2) and application thereof, a method for degrading erythromycin and an erythromycin-degrading bacterium dry powder agent.
In order to achieve the purpose, the technical scheme provided by the invention is as follows: a strain of Penicillium oxalicum (Penicillium oxalicum) RJJ-2 is preserved in China general microbiological culture Collection center (CGMCC for short, No. 3 of Beijing university Hodgy district No.1 of North Cheng-Yang, institute of microbiology, China academy of sciences) in 2019 at 23.12.s..
The second purpose of the invention is to provide the application of the Penicillium oxalicum (Penicillium oxalicum) RJJ-2 in the preparation of a preparation for degrading erythromycin.
The third purpose of the invention is to provide the application of the Penicillium oxalicum (Penicillium oxalicum) RJJ-2 in preparing a preparation for repairing the erythromycin environmental pollution.
The fourth purpose of the invention is to provide the application of the Penicillium oxalicum (Penicillium oxalicum) RJJ-2 in preparing a preparation for repairing soil polluted by erythromycin residue.
The fifth purpose of the invention is to provide the application of the Penicillium oxalicum (Penicillium oxalicum) RJJ-2 in the preparation of a preparation for repairing a water body after erythromycin residual pollution.
The sixth purpose of the invention is to provide a method for degrading erythromycin, wherein the method can be used for degrading erythromycin by inoculating the Penicillium oxalicum RJJ-2 into a system containing erythromycin for culture.
Further, in the method for degrading erythromycin, the culture temperature is 37 ℃, and the culture time is 72 hours.
The seventh purpose of the invention is to provide an erythromycin degradation bacteria dry powder agent, which contains the Penicillium oxalicum (RJJ-2).
The eighth purpose of the invention is to provide a preparation method of the dry powder agent for the erythromycin degradation bacteria, which is prepared by performing amplification culture on Penicillium oxalicum (Penicillium oxalicum) RJJ-2 and drying by a conventional method.
The invention is based on the microbiological technique, namely on the Rhodomyces rubrumThe characteristics of the elements are that the microbes capable of degrading the erythromycin are obtained from specific environmental conditions or through modification, the microbes are utilized to take the erythromycin as a carbon source and an energy source required by the growth of the microbes, the microbes are hydrolyzed into simple compounds under the action of enzymes, and finally the simple compounds are degraded into H2O and CO2And the like, and has the advantages of low cost and no secondary pollution, greatly reduces the burden of the environment, and conforms to the new idea of 'waste-free society' advocated by the state at present.
The invention has the beneficial effects that: the erythromycin-degrading bacteria and the application thereof, the method for degrading the erythromycin and the erythromycin-degrading bacteria dry powder agent provided by the invention are prepared by a microbiological technology method, namely, according to the characteristics of the erythromycin, the microorganisms capable of degrading the erythromycin are obtained from specific environmental conditions or through modification, and the erythromycin structure is destroyed by macrocyclic lactonase, transferase, lyase and the like, so that pollution-free metabolites are obtained. Experiments prove that the erythromycin degradation bacterium RJJ-2 can survive in an environment with erythromycin as a unique carbon source, has high erythromycin degradation activity, and has an erythromycin degradation rate of 45-70%. The erythromycin degradation bacterium RJJ-2 provided by the invention can be applied to the degradation of erythromycin in a polluted environment, and has good application value in the aspects of water treatment and soil remediation.
Drawings
FIG. 1 shows a single colony morphology of an erythromycin-degrading bacterium (Penicillium oxalicum) RJJ-2).
FIG. 2 shows the erythromycin degradation curve of example 2.
FIG. 3 shows the erythromycin degradation curve of example 3.
FIG. 4 shows the erythromycin degradation curve of example 4.
Detailed Description
Example 1:
a screening method of erythromycin degradation bacteria (Penicillium oxalicum) RJJ-2) comprises the following steps:
weighing a certain amount of fungus dregs, adding distilled water, and diluting by 10 times. And (3) taking 1mL of supernatant, adding 9mL of sterile water for gradient dilution, diluting to 1000 times, taking the supernatant, adding the MSM sterile culture medium containing erythromycin, and culturing for 5 days in a shaking table at 37 ℃ and 180 rpm. Uniformly coating the obtained supernatant on MSM solid culture medium containing erythromycin, culturing in 37 deg.C incubator for 3-5 days, and streaking and separating on LB plate to obtain erythromycin-degrading bacteria RJJ-2, wherein the single colony morphology is shown in FIG. 1.
Identification of strains
Obtaining erythromycin degradation bacteria RJJ-2 genome DNA by adopting an oscillation crushing method, amplifying ITS genes of strains by a PCR method and sending the amplified ITS genes to the Shanghai Czeri biological company for sequencing analysis; the upstream primer sequences used to amplify the ITS gene were: 5 'TCCGTAGGTGAACCTGCGG 3', and the downstream primer sequence is 5 'TCCTCCGCTTATTGATATGC 3'.
The PCR reaction conditions were: pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, reaction for 31 cycles, and extension at 72 ℃ for 5 min. Using the BLAST function of NCBI for sequence alignment in the GeneBank database, the classification of the analyzed strains was: penicillium oxalicum (Penicillium oxalicum).
The ITS gene sequence of the erythromycin degradation bacterium RJJ-2 is shown as a sequence 1 in a sequence table. ITS gene sequence of the strain such as GeneBank: MN 759650.
(I) main material
1. Culture medium
LB culture medium: 5g of yeast powder, 10g of peptone, 10g of sodium chloride, 15g of agar and 1000ml of ultrapure water.
MSM inorganic salt medium: NH (NH)4Cl 0.630g，K2HPO4·3H2O 1.965g，KH2PO40.500g，NaNO31.00g，MgSO40.100g of ultrapure water, 1000 ml.
The corresponding solid culture medium is prepared by adding 15g of agar powder into 1L of liquid culture medium.
2. Instrumentation and equipment
The kit comprises a FlexCycler PCR amplification instrument, a Tanon-3500 gel imaging system, an electrophoresis apparatus of six instruments factories in Beijing, a sterilization pot, an electronic balance, a UV1900 ultraviolet visible spectrophotometer, a constant temperature incubator, an eppendorf high-speed refrigerated centrifuge, a shaking table and a low-temperature refrigerator of Qingdao Haier group.
(II) erythromycin degradation assay
(1) Drawing of erythromycin standard curve
Accurately weighing 10.0mg of industrial pure erythromycin in a 100mL volumetric flask, and metering the volume to a marked line by using a mobile phase to prepare an erythromycin standard solution containing 100.0mg per milliliter. Adding mobile phase to dilute to prepare erythromycin standard solutions of 1.0, 5.0, 10.0, 20.0, 30.0, 50.0 and 80.0 mg/L.
The standard curve is that y (peak area) is 0.2031x (erythromycin concentration) -0.2785
Liquid phase conditions: a chromatographic column: c18 Filler, 260X4.6(mm)
Mobile phase: v (0.025mol/L K2HPO4Solution to V (acetonitrile) is 40: 60;
flow rate: 0.75 mL/min; the sample size was 100. mu.L.
Column temperature: 50 deg.C
Ultraviolet: 210nm
(2) Method for measuring erythromycin degradation rate
The degrading bacteria were inoculated into 100mL of liquid MSM medium containing 10mg, and 50mg of liquid MSM medium was added to 100mL of liquid MSM medium, the inoculum size was 2%, and the mixture was cultured in a shaker at 37 ℃ and pH 7. Taking the fermentation broth every 24h, storing in a refrigerator at-20 deg.C, and testing.
Diluting 1mL of fermentation liquor with 4mL of mobile phase, then taking 2mL of liquid, centrifuging at 10000rpm for 1min, passing the supernatant through a 0.22-micron filter membrane, detecting and analyzing by using a liquid phase, and then calculating the content of erythromycin according to an equation obtained by preparing a standard curve to obtain the degradation of the erythromycin in the experimental group.
Example 2:
culturing erythromycin-degrading bacteria RJJ-2 in LB liquid culture medium, centrifuging, collecting thallus, resuspending with sterile water, and diluting to OD6001, inoculating the selected strain into 1-100.0 mL of a basic liquid inorganic salt culture medium containing 100mg of erythromycin, placing the culture medium in a constant temperature shaking table for 180r/min, culturing at 37 ℃ for 72h, wherein the degradation rate is 68.2%, and the erythromycin degradation efficiency is obvious.
(FIG. 2)
Example 3
Inoculating erythromycin degradation bacteria RJJ-2 into 100g of sterilized soil according to the inoculation amount of 1%, adding 100mg of erythromycin, culturing at 37 ℃ for 72h, and determining the degradation rate as follows: 46.22 percent. (FIG. 3)
Example 4
Inoculating erythromycin-degrading bacteria RJJ-2 into 100mL of sterilized wastewater containing erythromycin according to the inoculation amount of 1%, determining the erythromycin concentration of the wastewater to be 130mg/L, culturing for 72h at 37 ℃ and 180r/min, and determining the erythromycin degradation rate to be: 53.75 percent. (FIG. 4)
Example 5
The preparation method of the dry powder of the erythromycin degradation bacteria RJJ-2 comprises the steps of carrying out amplification culture on the erythromycin degradation bacteria RJJ-2 and drying by a conventional method.
Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> university of Changzhou
Jiangsu bio Environmental Protection Technology Co.,Ltd.
HEIBEI CIXIN ENVIRONMENTAL PROTECTION AND TECHNOLOGY Co.,Ltd.
<120> erythromycin degradation bacterium RJJ-2 and application thereof
<130>2
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>523
<212>DNA
<213>Penicillium oxalicum
<400>1
attgatggtg ttcgccggcg ggcgccggcc gggcctacag agcgggtgac gaagccccat 60
acgctcgagg accggacgcg gtgccgccgc tgcctttcgg gcccgccccc cggaagcggg 120
gggcgagagc ccaacacaca agccgtgctt gagggcagca atgacgctcg gacaggcatg 180
ccccccggaa taccaggggg cgcaatgtgc gttcaaagac tcgatgattc actgaattct 240
gcaattcaca ttacttatcg catttcgctg cgttcttcat cgatgccgga accaagagat 300
ccgttgttga aagttttaac tgatttagtc aagtactcag actgcaatct tcagacaaga 360
gttcgtttgt gtgtcttcgg cgggcgcggg cccgggggcg gatgcccccc ggcggccgtg 420
aggcgggccc gccgaagcaa caaggtacga taaacacggg tgggaggttg gacccagagg 480
gccctcactc ggtaatgatc cttccgcagg ttcacctacg gaa 523
Claims (9)
1. A strain of Penicillium oxalicum is characterized in that the Penicillium oxalicum (Penicillium oxalicum) RJJ-2 has a preservation number of CGMCC NO. 19265.
2. Use of the Penicillium oxalicum (Penicillium oxalicum) RJJ-2 according to claim 1 in the preparation of a formulation for erythromycin degradation.
3. Use of Penicillium oxalicum (Penicillium oxalicum) RJJ-2 according to claim 1 in the preparation of a formulation for the remediation of erythromycin environmental contamination.
4. Use of Penicillium oxalicum (Penicillium oxalicum) RJJ-2 according to claim 1 in the preparation of a formulation for soil remediation after erythromycin residual contamination.
5. Use of the Penicillium oxalicum (Penicillium oxalicum) RJJ-2 according to claim 1 in the preparation of a formulation for water remediation after erythromycin residual contamination.
6. A method for degrading erythromycin, which comprises inoculating the Penicillium oxalicum (RJJ-2) of claim 1 into a system containing erythromycin, and culturing to obtain the final product.
7. A method according to claim 6, wherein said incubation is carried out at 37 ℃ for 72 hours.
8. An erythromycin degradation bacteria dry powder agent, characterized in that the dry powder agent contains the Penicillium oxalicum (Penicillium oxalicum) RJJ-2 of claim 1.
9. The preparation method of the erythromycin degradation dry powder agent according to claim 8, wherein the erythromycin degradation dry powder agent is prepared by performing amplification culture on Penicillium oxalicum (Penicillium oxalicum) RJJ-2, and drying by a conventional method.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010186808.9A CN111269843B (en) | 2020-03-17 | 2020-03-17 | Erythromycin degradation bacterium RJJ-2 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010186808.9A CN111269843B (en) | 2020-03-17 | 2020-03-17 | Erythromycin degradation bacterium RJJ-2 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111269843A true CN111269843A (en) | 2020-06-12 |
| CN111269843B CN111269843B (en) | 2022-05-17 |
Family
ID=70995821
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010186808.9A Active CN111269843B (en) | 2020-03-17 | 2020-03-17 | Erythromycin degradation bacterium RJJ-2 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111269843B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113462592A (en) * | 2021-06-15 | 2021-10-01 | 常州大学 | Erythromycin-degrading bacterium IURM F69 and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103266064A (en) * | 2013-01-30 | 2013-08-28 | 北京理工大学 | Penicillium oxalicum LJ302 capable of degrading chlortetracycline |
| CN104911123A (en) * | 2015-05-19 | 2015-09-16 | 孙军 | Pediococcus acidilactici P3-4, screening and identifying method thereof and application of pediococcus acidilactici P3-4 in degradation of erythromycin and roxithromycin |
| CN110819556A (en) * | 2019-09-29 | 2020-02-21 | 浙江农林大学 | Rhizobium and microbial inoculum and application thereof |
-
2020
- 2020-03-17 CN CN202010186808.9A patent/CN111269843B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103266064A (en) * | 2013-01-30 | 2013-08-28 | 北京理工大学 | Penicillium oxalicum LJ302 capable of degrading chlortetracycline |
| CN104911123A (en) * | 2015-05-19 | 2015-09-16 | 孙军 | Pediococcus acidilactici P3-4, screening and identifying method thereof and application of pediococcus acidilactici P3-4 in degradation of erythromycin and roxithromycin |
| CN110819556A (en) * | 2019-09-29 | 2020-02-21 | 浙江农林大学 | Rhizobium and microbial inoculum and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 毛菲菲等: "红霉素降解菌的筛分及其降解特性的研究", 《环境科学与技术》 * |
| 王敏奇等: "一株红霉素降解菌红圆酵母的选育及其降解特性", 《农业生物技术学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113462592A (en) * | 2021-06-15 | 2021-10-01 | 常州大学 | Erythromycin-degrading bacterium IURM F69 and application thereof |
| CN113462592B (en) * | 2021-06-15 | 2023-09-22 | 常州大学 | Erythromycin degrading bacterium IURM F69 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111269843B (en) | 2022-05-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110387339B (en) | Ochrobactrum intermedium B522 and application thereof | |
| WO2021147262A1 (en) | Method for screening bacteria capable of degrading ethylene oxide | |
| CN111235068B (en) | Erythromycin degradation bacterium RJJ-61 and application thereof | |
| US11124438B2 (en) | Alcaligenes faecalis for degrading ethylene oxide | |
| CN109097305B (en) | Rhizobium and application thereof | |
| CN111269843B (en) | Erythromycin degradation bacterium RJJ-2 and application thereof | |
| CN111304098B (en) | Erythromycin-degrading bacterium RJJ-5 and application thereof | |
| CN111235041B (en) | Erythromycin degradation bacterium RJJ-62 and application thereof | |
| CN110283759B (en) | Separation and application of grease degrading bacterium Kosakonia cowaniiuMR B67 | |
| CN111893052B (en) | Erythromycin-degrading bacterium pseudomonas aeruginosa RJJ-1 and application thereof | |
| CN101684452B (en) | Burkholderia dabaoshanensis and application thereof | |
| WO2021147260A1 (en) | Alcaligenes faecalis for degrading ethylene oxide and uses thereof | |
| US20210221720A1 (en) | Pathogenic bacteria and method for degrading ethylene oxide | |
| US11220667B2 (en) | Bacteria for degrading ethylene oxide and applications thereof | |
| US20210222117A1 (en) | Method for screening bacteria capable of degrading ethylene oxide | |
| CN108949639B (en) | Acinetobacter baumannii for degrading aureomycin and application thereof | |
| CN113462592B (en) | Erythromycin degrading bacterium IURM F69 and application thereof | |
| CN114231430B (en) | Erythromycin degrading bacterium IURM F57 and application thereof | |
| CN113416671B (en) | Erythromycin-degrading bacterium IURM E94 and application thereof | |
| CN111286470A (en) | Bacillus subtilis capable of degrading erythromycin and application thereof | |
| CN113388543A (en) | Erythromycin-degrading bacterium IURM F61 and application thereof | |
| CN110452858B (en) | Paracoccus B54 and application thereof | |
| CN112375718B (en) | Pymetrozine degrading bacterium IURM F17 and application thereof | |
| US11130939B2 (en) | Bacteria for degrading ethylene oxide and uses thereof | |
| WO2021147263A1 (en) | Pathogenic bacteria and method for degrading ethylene oxide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |