CN111239385A

CN111239385A - Screening method and application of small molecule compound for targeted inhibition of vitamin K epoxide reductase

Info

Publication number: CN111239385A
Application number: CN202010067610.9A
Authority: CN
Inventors: 沈国民; 刘浩; 沈滟; 刘红丽; 曹青; 高蒙; 李三强
Original assignee: Henan University of Science and Technology
Current assignee: Henan University of Science and Technology
Priority date: 2020-01-20
Filing date: 2020-01-20
Publication date: 2020-06-05
Anticipated expiration: 2040-01-20
Also published as: CN111239385B

Abstract

The invention discloses a screening method and application of a small molecular compound for targeted inhibition of vitamin K epoxide reductase, belonging to the technical field of molecular cell biology and biochemistry. According to the invention, a vitamin K circulating small molecule inhibitor screening system (namely a double-reporter gene cell system) is constructed, so that a drug small molecule library can be rapidly screened in a high-throughput manner, and a small molecule compound for targeted inhibition of vitamin K circulation is obtained; and further detecting the inhibition effect of the screened small molecular compound on the activity of the VKOR protein to obtain the small molecular compound for specifically inhibiting the activity of the VKOR protein. By adopting the method, compounds with structures different from coumarin derivatives and phenindione derivatives are screened for the first time, can specifically inhibit VKOR protein activity, have potential application value in development of raticide and anticoagulant drugs, and are lead compounds for development of raticide and anticoagulant drugs.

Description

Screening method and application of small molecule compound for targeted inhibition of vitamin K epoxide reductase

Technical Field

The invention relates to a screening method and application of a small molecular compound for targeted inhibition of vitamin K epoxide reductase, belonging to the technical field of molecular cell biology and biochemistry.

Background

Vitamin K plays an important role in the normal clotting of blood, mainly in the prevention of bleeding disorders in newborn infants, the prevention of internal bleeding and as an antidote for vitamin K antagonists. Vitamin K is involved in blood coagulation by modulating the post-translational modification of several coagulation factors (e.g., factor II, factor VII, factor IX) (as shown in FIG. 1). Vitamin K dependenceGamma carboxylation modification of glutamic acid residue in Gla domain of coagulation factor is a necessary condition for its function of blood coagulation. Vitamin K plays a central role in this post-translational modification process and circulates in the body in three forms, vitamin K epoxide (KO), vitamin K (K) and dihydrovitamin K (KH)₂)。

Two enzymes are currently known to play a role in the vitamin K cycle. Wherein gamma-glutamyl carboxylase (GGCX) utilizes KH₂As a cofactor, glutamic acid residues of Gla domain of vitamin K-dependent coagulation factor are gamma-carboxylated and KH is simultaneously modified₂Conversion to KO. In order for the catalytic reaction of GGCX to proceed continuously, KO must be reduced to KH₂This reaction is mainly catalyzed by vitamin K epoxide reductase (VKOR) having KO reductase activity and K reductase activity. VKOR catalyzes KO to K, and K to KH₂So that the vitamin K can be recycled. Research shows that VKOR is a specific action target of a clinical anticoagulant drug warfarin (warfarin), and by inhibiting the activity of VKOR, warfarin prevents KO from being converted into K and KH₂Thereby blocking the circulation of vitamin K, further inhibiting the gamma carboxylation modification of glutamic acid residue of the Gla structural domain of the blood coagulation factor and achieving the aim of anticoagulation. In addition, the rodenticide bromadiolone is also an inhibitor specifically targeting VKOR. Therefore, the key enzymes (VKOR and GGCX) of the vitamin K cycle are important targets for developing anticoagulant drugs (or rodenticides).

At present, small molecules for inhibiting VKOR activity are derivatives of coumarins or derivatives of phenindione, but whether other VKOR inhibitors with different chemical structures from the two compounds exist is not clear. Therefore, the development of a screening method of the VKOR-targeted small-molecule compound has great significance for obtaining the VKOR inhibitor.

Disclosure of Invention

The invention aims to provide a method for screening small molecular compounds for targeted inhibition of vitamin K epoxide reductase.

Meanwhile, the invention also provides application of the small molecular compound screened by the method as an inhibitor for preparing targeted vitamin K epoxide reductase.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

a screening method of a small molecule compound for targeted inhibition of vitamin K epoxide reductase comprises the following steps:

1) screening of small molecule compounds for targeted inhibition of vitamin K cycle

Adding the micromolecule compound to be selected into a culture solution of a double-reporter gene cell system containing vitamin K for culturing, and screening out the micromolecule compound which can inhibit the circulation of the vitamin K in a targeted manner;

the double-reporter gene cell system contains a plasmid which can simultaneously express a FIX-Gla-PC fusion gene and a reporter gene, and the nucleotide sequence of the FIX-Gla-PC fusion gene is shown as SEQ ID NO. 1;

2) screening small molecule compound for specifically inhibiting VKOR protein activity

And carrying out VKOR protein activity inhibition assay on the screened small molecular compounds for targeted vitamin K cycle inhibition, and screening the small molecular compounds for specific VKOR protein activity inhibition.

According to the invention, a vitamin K circulating small molecule inhibitor screening system (namely a double-reporter gene cell system) is constructed, so that a drug small molecule library can be rapidly screened in a high-throughput manner, and a small molecule compound for targeted inhibition of vitamin K circulation is obtained; and further detecting the inhibition effect of the screened small molecular compound on the activity of the VKOR protein to obtain the small molecular compound for specifically inhibiting the activity of the VKOR protein. By adopting the method, compounds with structures different from coumarin derivatives and phenindione derivatives are screened for the first time, can specifically inhibit VKOR protein activity, have potential application value in development of raticide and anticoagulant drugs, and are lead compounds for development of raticide and anticoagulant drugs.

In the step 1), the host cell of the double-reporter gene cell system is a human embryonic kidney cell 293Trex (invitrogen).

In the step 1), the amino acid sequence of the protein coded by the FIX-Gla-PC fusion gene (the recombinant gene of the humanized F9 and PROC gene) is shown as SEQ ID NO. 2.

In step 1), the reporter gene is a luciferase reporter gene, such as a beetle (firefly) luciferase reporter gene. The nucleotide sequence of the beetle luciferase reporter gene is shown as SEQ ID NO.3, and the amino acid sequence of the protein coded by the gene is shown as SEQ ID NO. 4.

Further preferably, in the step 1), the nucleotide sequence of the plasmid for simultaneously expressing the FIX-Gla-PC fusion gene and the reporter gene (beetle luciferase reporter gene) is shown as SEQ ID NO. 5.

In the step 1), the culture medium of the double-reporter gene cell system culture solution is a complete culture medium containing double antibodies, and the double antibodies are penicillin and streptomycin respectively. The complete medium containing the double antibody consists of: 10% FBS (fetal bovine serum, v/v), penicillin 100IU/mL, streptomycin 100. mu.g/mL, DMEM (cat # SH30243.01, Hyclone).

In the step 1), the concentration of vitamin K in the culture solution of the double-reporter gene cell system is 1-20 mu mol/L; more preferably 5. mu. mol/L.

In step 2), VKOR protein activity can be determined by conventional microsomal methods (see literature: fasco, M.J., Principe, L.M., Walsh, W.a & Friedman, P.a.Warfarin inhibition of vitamin K2, 3-epoxide reduction in rat microorganisms, biochemistry.22, 5655-60 (1983); cost, S., Freegin, A., Ivaskevicius, V., Conzelmann, E. & Hortnagel, K.parameters in VKORC1 house warfarin resistance and multiple coagulation factor determination type2.Nature.427, 537-541 (2004). Preferably, the following method is used:

mixing the screened micromolecule compound for targeted inhibition of vitamin K circulation with vitamin K epoxide working solution and VKOR protein working solution, adding the mixture into a fluorescence measurement plate, detecting fluorescence by using a fluorescence detector, setting the wavelength of exciting light to be 245-; and/or the like, and/or,

and mixing the screened micromolecule compound for targeted inhibition of vitamin K circulation with vitamin K working solution and VKOR protein working solution, adding the mixture into a fluorescence measurement plate, detecting fluorescence by using a fluorescence detector, setting the wavelength of exciting light to be 245-plus-255 nm and the wavelength of emitted light to be 420-plus-440 nm, and calculating the increment of the fluorescence value by using an end-point method to represent the activity of VKOR protein.

The detection principle of the method is to utilize the KH product₂The characteristic of fluorescence can be generated under the excitation light of 250nm, and the KH product can be detected₂The amount of the compound (A) is used to reflect the activity of VKOR protein, and the fluorescence intensity measured by an end-point method can reflect the activity of VKOR, or the fluorescence intensity measured in real time can reflect the activity of VKOR protein.

The preparation method of the vitamin K epoxide working solution comprises the following steps: respectively taking a buffer solution 1, a buffer solution 2 and a buffer solution 3, and preparing a vitamin K epoxide working solution with the GSH concentration of 60-160mmol/L and the vitamin K epoxide concentration of 30-80 mu mol/L;

the composition of buffer 1 included: Tris-HCl20-50mmol/L with pH value of 7.0-8.0, NaCl 100-150mmol/L, LMNG or GDN 0.5-5g/L, and water as solvent;

the composition of buffer 2 included: 0.4-1mol/L of GSH and water as a solvent; the pH value is 7.0-7.6;

the composition of buffer 3 included: vitamin K epoxide 1-50mmol/L and isopropanol as solvent.

The preparation method of the vitamin K working solution comprises the following steps: respectively taking a buffer solution 1, a buffer solution 2 and a buffer solution 4, and preparing a vitamin K working solution with the GSH concentration of 60-160mmol/L and the vitamin K concentration of 30-80 mu mol/L;

the compositions of the buffer solution 1 and the buffer solution 2 are the same as above;

the composition of buffer 4 included: vitamin K1-100mmol/L and isopropanol as solvent.

The preparation method of the VKOR protein working solution comprises the following steps: respectively taking VKOR protein and buffer solution 1, and preparing a VKOR protein working solution with the VKOR protein concentration of 1-5 mu mol/L;

buffer 1 was composed as above.

The buffer solution 2 further comprises an alkaline pH value regulator, such as NaOH, KOH, and the like, and the dosage of the alkaline pH value regulator is based on the regulation of the pH value of the buffer solution 2 to 7.0-7.6.

The buffer solution 1 is added with surfactant LMNG or GDN to stabilize protein, VKOR protein is transmembrane protein, and can be correctly folded and not denatured only in proper surfactant.

Further preferably, the buffer 1 has the following composition: Tris-HCl20 mmol/L, NaCl100mmol/L, LMNG1g/L or GDN 0.5g/L at pH 7.5, and water as solvent;

the buffer solution 2 comprises the following components: 0.5mol/L of GSH, a proper amount of alkaline pH value regulator and water as a solvent; the pH value is 7.5;

the buffer solution 3 comprises the following components: 1mmol/L vitamin K epoxide, and isopropanol as solvent;

the buffer solution 4 comprises the following components: vitamin K1mmol/L and isopropanol as solvent.

The vitamin K epoxide working solution needs to be balanced for more than 1 hour at room temperature after the preparation is finished.

The VKOR protein is a human VKOR protein, and specifically is a purified human VKOR protein. The preparation method of the purified human VKOR protein comprises the following steps: cloning a Gene (Gene ID: 79001) coding a human VKOR protein into a pichia pastoris expression vector pPICZ-B (invitrogen), wherein the C end of the Gene is sequentially connected with a PreScission protease cutting site and a GFP-HIS10 label; protein expression and purification were carried out according to the methods described in the kit (cat # K171001, Thermofeisher Co.) and the literature (Ren F, Logeman BL, Zhang X, Liu Y, Thiele DJ, Yuan P.X-ray structures of the high-affinity chromatography transporter Ctrr 1.Nat Commun.2019, 27; 10(1):1386.doi:10.1038/s 41467-019-09376-7.). The purified and concentrated human VKOR protein is collected with buffer solution (composition: Tris-HCl20-50mmol/L, NaCl 100-150mmol/L, LMNG or GDN 0.5-5g/L, solvent is water, pH 7.0-8.0) for later use.

Further preferably, the preparation method of the vitamin K epoxide working solution comprises the following steps: taking preparation of 1mL of working solution as an example, taking 800. mu.L of buffer solution 1, 160. mu.L of buffer solution 2 and 40. mu.L of buffer solution 3, uniformly mixing, and then balancing at room temperature for more than 1 hour to obtain the vitamin K epoxide working solution with the GSH concentration of 80mmol/L and the vitamin K epoxide concentration of 40. mu. mol/L.

Further preferably, the preparation method of the vitamin K working solution comprises the following steps: taking 1mL of prepared working solution as an example, 800. mu.L of buffer solution 1, 160. mu.L of buffer solution 2 and 40. mu.L of buffer solution 4 are uniformly mixed to obtain the vitamin K working solution with the GSH concentration of 80mmol/L and the vitamin K concentration of 40. mu. mol/L.

Further preferably, the preparation method of the VKOR protein working solution comprises the following steps: the (purified human) VKOR protein was taken and diluted with buffer 1 to a human VKOR protein concentration of 3. mu. mol/L to obtain a VKOR protein working solution.

The increment of the fluorescence value calculated by the end-point method is as follows: detecting fluorescence once every a period of time by using a fluorescence detector, wherein the total detection time is 1-2 hours; activity of VKOR protein-fluorescence value (F) at 1 hour of reaction_T1) Background fluorescence value at the beginning of the reaction (F)_T0). More preferably: setting the wavelength of exciting light to be 250nm and the wavelength of emitted light to be 430 nm; fluorescence was detected every 30 seconds for a total time of 1-2 hours.

The small molecular compound screened by the screening method of the small molecular compound for targeted inhibition of the vitamin K epoxide reductase is applied to preparation of the inhibitor for targeted inhibition of the vitamin K epoxide reductase.

The structural formula of the screened small molecule compounds is as follows (total 14 types):

the invention has the beneficial effects that:

according to the invention, compounds with structures different from coumarin derivatives and benzindenedione derivatives are screened for the first time by constructing a vitamin K circulating small-molecule inhibitor screening system and a small-molecule inhibitor screening system targeting VKOR protein, can specifically inhibit the activity of VKOR protein, have potential application values for developing rodenticides and anticoagulant drugs, and are lead compounds for developing rodenticides and anticoagulant drugs.

The existing small molecules for inhibiting VKOR activity are derivatives of coumarins or derivatives of phenindione, but the small molecule compounds screened by the invention have structural diversity, wherein HF13136-E7, HF13138-A2 and HF13144-B11 are used for determining IC for inhibiting VKOR activity in 293TRex-F9-Met cells₅₀Has better effect than the clinical anticoagulant warfarin and has potential application value for developing raticide or anticoagulant drug. And small molecular compounds HF13021-B2, HF13028-F7, HF13073-G2, HF13091-E6 and HF13106-C10 have the value of being used as lead compounds for designing novel VKOR inhibitors.

Drawings

FIG. 1 is a schematic of the vitamin K cycle;

FIG. 2 is the normalized fluorescence of the KO substrate in example 1;

FIG. 3 is the normalized fluorescence of the K substrate in example 1;

FIG. 4 is IC of small molecule compounds inhibiting VKOR activity in test cases₅₀。

Detailed Description

The following examples are intended to illustrate the invention in further detail, but are not to be construed as limiting the invention in any way.

Reagents, materials and instruments:

GSH: glutathione;

LMNG: lauryl Maltose Neopentol Glycol available from Anatarce;

GDN: glyco-diosgenin, available from Anarrace;

DDM n-Dodecyl- β -D-Maltopyranoside, available from Anarrace;

CHAPS: 3- [ (3-Cholamidopropyl) dimethylamino ] propanesulfonic acid inner salt, 3- [ (3-Cholamidothio) dimethyl lamonoi ] propanesulfonate, 3- [ (3-Cholamidothio) dimethyl lamonoi ] -1-propanesulfonate, available from Anarrace;

protein expression and purification was performed as a kit, cat # K171001, available from thermolfisher;

a black 96-well fluorescence measurement plate, which is a Corning (Corning)3915 total black fluorescence detection plate;

fluorescence detector (molecular device, spectramax M5).

The purified human VKOR protein used in the examples and experimental examples was prepared by the following method: cloning a Gene (Gene ID: 79001) coding a human VKOR protein into a pichia pastoris expression vector pPICZ-B (invitrogen), wherein the C end of the Gene is sequentially connected with a PreScission protease cutting site and a GFP-HIS10 label; protein expression and purification were carried out according to the method for expressing membrane proteins in Pichia pastoris using a kit (cat # K171001, Thermofish Co.) and literature (Ren F, Logeman BL, Zhang X, Liu Y, Thiele DJ, Yuan P.X-ray constructs of the high-affinity chip transporter Ctr1.NatCommun.2019, 27; 10(1):1386.doi:10.1038/s 41467-019-containing 09376-7). The purification steps are as follows:

1) yeast cells expressing human VKOR protein are crushed, dissolved in lysis buffer (2% DDM, 150mM NaCl, 50mM Tris-HCl pH 8.0, 10. mu.g/mL DNase I, 2mM PMSF protease inhibitor, solvent water), and extracted at 4 deg.C for 3h (3-4 h); centrifuging the mixture at 30000g at 4 deg.C for 1h, and collecting supernatant;

2) the supernatant was incubated with cobalt column packing (cat # 635503, Clontech) at 4 ℃ for 3h (3-4 h) with gentle stirring; then collecting the cobalt column packing, washing the packing with 10 column packing volume of buffer (30mM imidazole, 4mM DDM, 150mM NaCl, 20mM Tris-HCl pH 8.0, solvent is water);

3) incubating the washed cobalt column packing material with PreScission protease at 4 deg.C overnight, removing the C-terminal GFP-HIS10 marker, collecting human VKOR protein, and concentrating with 10kD concentration tube;

4) passing the concentrated protein through Superdex 200 molecular sieve with mobile phase buffer containing 0.1% LMNG, 150mM NaCl, 20mM Tris-HCl pH 7.5 and water as solvent; collecting the target protein peak, concentrating with 10kD concentration tube to a concentration of more than 30 μmol/L, and freezing at-80 deg.C.

Example 1

The screening method of the small molecule compound for targeting inhibition of vitamin K epoxide reductase in the embodiment comprises the following steps:

Adding the micromolecule compound to be selected into a culture solution of a double-reporter gene cell system containing vitamin K for culturing, and screening out the micromolecule compound which can inhibit the circulation of the vitamin K in a targeted manner, wherein the specific operation is as follows:

a. 293TRex cell line (invitrogen) (see reference 1) was transfected with a plasmid (shown in SEQ ID NO.5, synthesized by Biotech) simultaneously expressing the FIX-Gla-PC fusion gene and the reporter gene, and hygromycin was used to screen a cell line stably expressing both FIX-Gla-PC and Metridia Luciferase reporter genes, and named 293 TRex-F9-Met.

b. Small molecule compounds in a Maybridge Hit Finder small molecule compound library (14400 small molecule compounds) are respectively paved in a 96-hole cell culture plate, 150nL of small molecule drugs (the concentration is10 mmol/L) are added in each hole, and the plate is placed in a refrigerator at the temperature of minus 20 ℃ for standby.

c. Laying 293TRex-F9-Met cells in a 96-well plate paved with small molecular compounds, wherein the cell amount of each well is 30000-40000 cells, and the volume is 150 mu L; equivalent to 2-2.5X 10⁵Cell suspension at a concentration of one/mL, and the medium was a complete medium containing a diabody (composition: 10% FBS (fetal bovine serum, v/v), penicillin 100IU/mL, streptomycin 100. mu.g/mL, DMEM (cat # SH30243.01, Hyclone)), and the vitamin K concentration was 5. mu. mol/L.

d. After 24 hours of culture, the culture supernatants from the 96-well cell culture plates were collected, and the secreted amounts of the reporter gene FIX-gla-PC were measured by ELSIA (see reference 2), and the activity of the beetle luciferase (MetridiaLuciferase) was measured by the luciferase reporter gene assay (see references 3 and 4), respectively.

e. Calculating the ratio of the secretion of FIX-gla-PC to the fluorescence value of the beetle luciferase (the secretion of FIX-gla-PC/the fluorescence value of the beetle luciferase and named as R) in each hole, and dividing the ratio of the drug-added group (R drug, abbreviated as Rd) by the ratio of the drug-free group (R no drug, abbreviated as Rn) to obtain the ratio (Rd/Rn); and (3) judging the small molecular compound with the ratio Rd/Rn being less than or equal to 0.3 as a positive result, and screening 21 small molecular compounds for targeted vitamin K cycle inhibition, wherein warfarin is used as a positive control, as shown in the following table 1.

TABLE 1 screening results of Maybridge Hit Finder Small molecule Compound library

The structural formula of the 21 small molecule compounds is as follows:

Carrying out VKOR protein activity inhibition assay on the screened small molecular compounds (namely the small molecular compounds to be selected) which can inhibit the vitamin K circulation in a targeted manner, and screening out the small molecular compounds which can specifically inhibit the VKOR protein activity, wherein the specific operation is as follows:

a. preparation of materials:

respectively preparing a buffer solution 1, a buffer solution 2, a buffer solution 3, a buffer solution 4 and a small molecular compound solution to be selected;

the buffer solution 1 comprises the following components: Tris-HCl20 mmol/L, NaCl100mmol/L, LMNG1g/L and water in pH 7.5;

the buffer solution 2 comprises the following components: 0.5mol/L of GSH, a proper amount of NaOH and water as a solvent; the pH value is 7.5;

the buffer solution 4 comprises the following components: vitamin K1mmol/L and isopropanol as solvent;

the composition of the small molecule compound solution to be selected is as follows: 1mmol/L of a small molecular compound to be selected, and DMSO as a solvent.

b. Preparing a working solution:

respectively preparing vitamin K epoxide working solution, vitamin K working solution and VKOR protein working solution for later use;

the preparation method of the vitamin K epoxide working solution comprises the following steps: taking preparation of 1mL of working solution as an example, taking 800 mu L of buffer solution 1, 160 mu L of buffer solution 2 and 40 mu L of buffer solution 3, uniformly mixing, and balancing at room temperature for more than 1 hour to obtain a vitamin K epoxide working solution with GSH concentration of 80mmol/L and vitamin K epoxide concentration of 40 mu mol/L;

the preparation method of the vitamin K working solution comprises the following steps: taking preparation of 1mL of working solution as an example, taking 800. mu.L of buffer solution 1, 160. mu.L of buffer solution 2 and 40. mu.L of buffer solution 4, and uniformly mixing to obtain a vitamin K working solution with a GSH concentration of 80mmol/L and a vitamin K concentration of 40. mu. mol/L;

the preparation method of the VKOR protein working solution comprises the following steps: the purified human VKOR protein (the concentration is more than 30 mu mol/L) is taken and diluted by buffer solution 1 until the concentration of the human VKOR protein is 3 mu mol/L, and a VKOR protein working solution is obtained.

c. And (3) determining the inhibition effect of the selected small-molecule compound on VKOR protein activity:

determination of inhibitory effect of candidate small molecule compounds on catalytic KO activity of VKOR protein: adding 0.8 mu L of to-be-selected small molecule compound solution into a black 96-hole fluorescence measurement plate, then respectively taking 40 mu L of vitamin K epoxide working solution and 40 mu L of VKOR protein working solution, sequentially adding the vitamin K epoxide working solution and the VKOR protein working solution into the black 96-hole fluorescence measurement plate, uniformly mixing, detecting fluorescence in a 96-hole fluorescence detector (molecular device, SpetraMAX M5), setting the wavelength of exciting light to be 250nm, and setting the wavelength of emitted light to be 430 nm; detecting fluorescence once every 30 seconds, wherein the total detection time is 1-2 hours, and calculating the increment of the fluorescence value by using an end-point method to represent the activity of VKOR protein;

determination of inhibitory effect of candidate small molecule compounds on catalytic K activity of VKOR protein: adding 0.8 mu L of to-be-selected small molecule compound solution into a black 96-hole fluorescence measurement plate, then respectively taking 40 mu L of vitamin K working solution and VKOR protein working solution, sequentially adding the vitamin K working solution and the VKOR protein working solution into the black 96-hole fluorescence measurement plate, uniformly mixing, detecting fluorescence in a 96-hole fluorescence detector (molecular device, SpetraMAX M5), setting the wavelength of exciting light to be 250nm, and setting the wavelength of emitted light to be 430 nm; detecting fluorescence once every 30 seconds, wherein the total detection time is 1-2 hours, and calculating the increment of the fluorescence value by using an end-point method to represent the activity of VKOR protein;

activity of VKOR protein-fluorescence value (F) at 1 hour of reaction_T1) Background fluorescence value at the beginning of the reaction (F)_T0)。

Control group: adding 0.8 mu L DMSO into a black 96-hole fluorescence measurement plate, respectively taking 40 mu L vitamin K epoxide working solution (or vitamin K working solution) and VKOR protein working solution, sequentially adding into the black 96-hole fluorescence measurement plate, and uniformly mixing, wherein the rest are the same as above.

Warfarin control group: adding 0.8 mu L warfarin solution (warfarin 0.4mmol/L, solvent DMSO) into a black 96-well fluorescence measurement plate, respectively taking 40 mu L vitamin K epoxide working solution (or vitamin K working solution) and VKOR protein working solution, sequentially adding into the black 96-well fluorescence measurement plate, and uniformly mixing, wherein the rest parts are as above.

d. Determination of inhibitory Effect

The activity of the control group was noted as CF_AWarfaring control activity was designated as WF_AThe activity of the small molecule compound treatment group is marked as DF_A. Thereafter, the fluorescence value was compared with the CF of the control group_APerforming homogenization treatment, wherein the control group is1 and represents the state of non-inhibition of VKOR protein activity; the warfarin treatment group is WF_A/CF_A(normalized fluorescence value), indicating the inhibitory effect of warfarin on VKOR protein activity; activity of small molecule Compound treated group divided by Activity of control group, i.e. DF_A/CF_A(normalized fluorescence values) indicating the inhibitory effect of small molecule compounds on VKOR protein activity (as shown in FIGS. 2-3). If DF is_A/CF_AThe value is less than or equal to 1/2, which shows that the small molecular compound has better inhibition effect on VKOR protein activity; if DF is_A/CF_A≤WF_A/CF_AIt means that the inhibitory effect of the small molecule compound is equal to or better than that of warfarin; if 1/2DF_A/CF_A＞WF_A/CF_AIndicating that the inhibitory effect of the small molecule compound is not as good as that of warfarin; if 1> DF_A/CF_AThe value is greater than 1/2, which indicates that the inhibition effect of the small molecular compound is poor; if DF is_A/CF_AThe value is1 or more, indicating no inhibitory effect.

The screening results are shown in table 2 below, and it can be seen from table 2 that 14 small molecules with good VKOR inhibitory activity and 7 small molecules with poor or no VKOR inhibitory activity are screened out.

VKOR protein activity inhibition results of 221 small-molecule compounds in table

Analysis of inhibitory effect of 14 small molecule compounds on VKOR protein activity: the 14 small molecule compounds are respectively: HF13020-E7, HF13021-B2, HF13028-F7, HF13052-C5, HF13073-G2, HF13089-C5, HF13091-E6, HF13106-C10, HF13110-F4, HF13136-E7, HF13138-A2, HF13169-G5, HF13144-B11 and HF 13148-C7. Vitamin K epoxide (KO) is used as a substrate, and 14 small-molecule compounds are detected to be capable of inhibiting VKOR protein activity well. Wherein the 7 small molecular compounds have better inhibition effect than warfarin in vitro activity assay, and are respectively HF13073-G2, HF13106-C10, HF13110-F4, HF13136-E7, HF13138-A2, HF13144-B11 and HF 13148-C7.

Among the 14 small molecular compounds, vitamin K (K) is taken as a substrate, and the inhibition effect of the vitamin K (K) on the activity of VKOR protein catalysis K is detected, and 5 small molecular compounds are found to have poor inhibition effects, namely HF13052-C5, HF13073-G2, HF13089-C5, HF13091-E6 and HF 13169-G5; the inhibition effect of the 3 small molecular compounds is not as good as that of warfarin, namely HF13028-F7, HF13106-C10 and HF 13144-B11; the inhibition effect of the 6 small molecular compounds is equal to or better than that of warfarin, namely HF13020-E7, HF13021-B2, HF13110-F4, HF13136-E7, HF13138-A2 and HF 13148-C7.

From the structural formula of the compound, the 14 small molecule compounds can be roughly divided into 4 types:

1) small molecule compounds with similar structures with coumarin derivatives comprise HF13052-C5 and HF 13110-F4. Their effect on inhibiting VKOR activity is expected.

2) Small molecule compounds with similar structure to phenyl indandione include HF13020-E7, HF13089-C5, HF13148-C7 and HF 13169-G5. Their effect in inhibiting VKOR is also clear.

3) Small molecule compounds structurally similar to vitamin K include HF13021-B2 and HF 13136-E7. The ability of such compounds to inhibit VKOR protein activity has not been reported.

4) A small molecule compound different from the above structure and capable of inhibiting VKOR activity. The small molecular compounds can inhibit VKOR activity and are not reported to be HF13028-F7, HF13073-G2, HF13091-E6, HF13106-C10, HF13138-A2 and HF 13144-B11.

Example 2

In this example, 14 kinds of small molecule compounds screened in example 1 are used as inhibitors for preparing targeted vitamin K epoxide reductase, and the structural formula of the 14 kinds of small molecule compounds is as follows:

test examples

For small compounds not reported to inhibit VKOR activity, IC of small compounds for inhibiting VKOR activity was determined in 293TRex-F9-Met cells₅₀. The method comprises the following specific steps:

1) a12 concentration gradient of the small molecule compound was prepared in which the concentration of vitamin K was 5. mu. mol/L and the medium was DMEM complete medium. The concentrations of the small molecule compounds were 4. mu.M, 2. mu.M, 1. mu.M, 0.5. mu.M, 0.25. mu.M, 0.125. mu.M, 0.0625. mu.M, 0.03125. mu.M, 0.0156. mu.M, 0.0078. mu.M, 0.0039. mu.M, and 0. mu.M, respectively. This was followed by addition to a 24 well cell culture plate at 400. mu.L per well.

2) A cell suspension of 93TRex-F9-Met cells was prepared, and the cells were cultured in complete DMEM medium (composition: 10% FBS (fetal bovine serum, v/v), penicillin 100IU/mL, streptomycin 100. mu.g/mL, DMEM (cat # SH30243.01, Hyclone)) to prepare cell suspension with cell concentration of 2-2.5 × 10⁵cells/mL, 400. mu.L of cell suspension was added to the above 24-well cell culture plate containing the small molecule compound.

3) After 24 hours of culture, the culture supernatant was collected, and the secreted amount of the reporter gene FIX-gla-PC was measured by ELSIA (see reference 2), and the activity of the beetle Luciferase (Metridia Luciferase) was measured by the Luciferase reporter gene assay (see references 3 and 4), respectively.

4) Calculating IC of Small molecule Compounds₅₀: firstly, calculating the ratio of the secretion of FIX-gla-PC to the fluorescence value of the beetle luciferase (the secretion of FIX-gla-PC/the fluorescence value of the beetle luciferase, named as R) under different concentrations, carrying out homogenization treatment on the R values of the drug treatment groups with different concentrations by using the R value of the non-drug-added group, and then calculating the IC of the drug by using graphpad prism 5₅₀The results are shown in FIG. 4.

Reference documents:

document 1: wanrooij S, Goffart S,

JLO,Yasukawa T,SpelbrinkJN.Expression of catalytic mutants of the mtDNAhelicase Twinkle andpolymerase POLG causes distinct replication stalling phenotypes.Nucleic AcidsRes 2007；35:3238-51.；

document 2: tie J-K, Jin D-Y, Stright DL, Stafford DW.functional study of the vitamin K cycle in a mammarian cell.blood 2011; 2967-74, 117;

document 3: shen G, Cui W, Zhang H, Zhou F, Huang W, Liu Q, Yang Y, Li S, BowmanGR, Sadler JE, Gross ML, Li W, Guomin S, Weidong C, Hao Z, Fengbo Z, Wei H, Qian L, Yihu Y, Bowman GR, et al, surface prediction bulk registration by mapping humanmangement manual in epoxide reduction in an intermediate stage product producing electron transfer. nat Mol Biol 2016; 24: 69-76;

document 4: tie JK, Jin DY, Tie K, Stable DW. evaluation of warfarention using transformation activators-like effector cycles-mediated vitamin min K epoxide production kinase knottout HEK293 cell. J Thromb Haemost 2013; 11:1556-64..

Sequence listing

SEQUENCE LISTING

<110> university of Henan science and technology

<120> screening method and application of small molecular compound for targeted inhibition of vitamin K epoxide reductase

<170>SIPOSequenceListing 1.0

<160>5

<211>1392

<212>DNA

<213> recombination of human F9 and PROC genes

<221> FIX-Gla-PC fusion gene

<400>1

atggcatggc agctcacaag cctcctcctg ttcgtggcca cctggggaat ttccggcaca 60

ccagctcctc ttgactcagt gttctccagc agcgagcgtg cccaccaggt gctgcggatt 120

cgaaaacgtt ataattcagg taaattggaa gagtttgttc aagggaacct tgagagagaa 180

tgtatggaag aaaagtgtag ttttgaagaa gcacgagaag tttttgaaaa cacggaaaga 240

acaactgaat tttggaagca gtatgttgac ggtgaccagt gcttggtctt gcccttggag 300

cacccgtgcg ccagcctgtg ctgcgggcac ggcacgtgca tcgacggcat cggcagcttc 360

agctgcgact gccgcagcgg ctgggagggc cgcttctgcc agcgcgaggt gagcttcctc 420

aattgctctc tggacaacgg cggctgcacg cattactgcc tagaggaggt gggctggcgg 480

cgctgtagct gtgcgcctgg ctacaagctg ggggacgacc tcctgcagtg tcaccccgca 540

gtgaagttcc cttgtgggag gccctggaag cggatggaga agaagcgcag tcacctgaaa 600

cgagacacag aagaccaaga agaccaagta gatccgcggc tcattgatgg gaagatgacc 660

aggcggggag acagcccctg gcaggtggtc ctgctggact caaagaagaa gctggcctgc 720

ggggcagtgc tcatccaccc ctcctgggtg ctgacagcgg cccactgcat ggatgagtcc 780

aagaagctcc ttgtcaggct tggagagtat gacctgcggc gctgggagaa gtgggagctg 840

gacctggaca tcaaggaggt cttcgtccac cccaactaca gcaagagcac caccgacaat 900

gacatcgcac tgctgcacct ggcccagccc gccaccctct cgcagaccat agtgcccatc 960

tgcctcccgg acagcggcct tgcagagcgc gagctcaatc aggccggcca ggagaccctc 1020

gtgacgggct ggggctacca cagcagccga gagaaggagg ccaagagaaa ccgcaccttc 1080

gtcctcaact tcatcaagat tcccgtggtc ccgcacaatg agtgcagcga ggtcatgagc 1140

aacatggtgt ctgagaacat gctgtgtgcg ggcatcctcg gggaccggca ggatgcctgc 1200

gagggcgaca gtggggggcc catggtcgcc tccttccacg gcacctggtt cctggtgggc 1260

ctggtgagct ggggtgaggg ctgtgggctc cttcacaact acggcgttta caccaaagtc 1320

agccgctacc tcgactggat ccatgggcac atcagagaca aggaagcccc ccagaagagc 1380

tgggcacctt aa 1392

<211>463

<212>PRT

<213> recombination of human F9 and PROC genes

<221> protein encoded by FIX-Gla-PC fusion gene

<400>2

MAWQLTSLLL FVATWGISGT PAPLDSVFSS SERAHQVLRI RKRYNSGKLE EFVQGNLERE 60

CMEEKCSFEE AREVFENTER TTEFWKQYVD GDQCLVLPLE HPCASLCCGH GTCIDGIGSF 120

SCDCRSGWEG RFCQREVSFL NCSLDNGGCT HYCLEEVGWR RCSCAPGYKL GDDLLQCHPA 180

VKFPCGRPWK RMEKKRSHLK RDTEDQEDQV DPRLIDGKMT RRGDSPWQVV LLDSKKKLAC 240

GAVLIHPSWV LTAAHCMDES KKLLVRLGEY DLRRWEKWEL DLDIKEVFVH PNYSKSTTDN 300

DIALLHLAQP ATLSQTIVPI CLPDSGLAER ELNQAGQETL VTGWGYHSSR EKEAKRNRTF 360

VLNFIKIPVV PHNECSEVMS NMVSENMLCA GILGDRQDAC EGDSGGPMVA SFHGTWFLVG 420

LVSWGEGCGL LHNYGVYTKV SRYLDWIHGH IRDKEAPQKS WAP 463

<211>660

<212>DNA

<213> beetles

<221> beetle luciferase reporter gene

<400>3

atggacatca aggtggtgtt caccctggtg ttcagcgccc tggtgcaggc caagagcacc 60

gagttcgacc ccaacatcga catcgtgggc ctggaaggca agttcggcat caccaacctg 120

gaaaccgacc tgttcaccat ctgggagacc atggaagtga tgatcaaggc cgacatcgcc 180

gacaccgacc gggccagcaa cttcgtggcc accgagaccg acgccaaccg gggcaagatg 240

cccggcaaga agctgcccct ggccgtcatc atggaaatgg aagccaacgc cttcaaggcc 300

ggctgcaccc ggggctgcct gatctgcctg agcaagatca agtgcaccgc caagatgaag 360

gtgtacatcc ccggcaggtg ccacgactac ggcggcgaca agaaaaccgg ccaggccggc 420

atcgtgggcg ccatcgtgga catccccgag atcagcggct tcaaagaaat ggcccccatg 480

gaacagttca tcgcccaggt ggacagatgc gccagctgca ccaccggctg cctgaagggc 540

ctggccaacg tgaagtgcag cgagctgctg aagaagtggc tgcccgaccg ctgcgccagc 600

ttcgccgaca agatccagaa agaggtgcac aacatcaagg gcatggccgg cgacaggtga 660

<211>219

<212>PRT

<213> beetles

<221> protein encoded by beetle luciferase reporter gene

<400>4

MDIKVVFTLV FSALVQAKST EFDPNIDIVG LEGKFGITNL ETDLFTIWET MEVMIKADIA 60

DTDRASNFVA TETDANRGKM PGKKLPLAVI MEMEANAFKA GCTRGCLICL SKIKCTAKMK 120

VYIPGRCHDY GGDKKTGQAG IVGAIVDIPE ISGFKEMAPM EQFIAQVDRC ASCTTGCLKG 180

LANVKCSELL KKWLPDRCAS FADKIQKEVH NIKGMAGDR 219

<211>9452

<212>DNA

<213> Artificial sequence

<221> plasmid simultaneously expressing FIX-Gla-PC fusion gene and reporter gene

<400>5

ctccctgctt gtgtgttgga ggtcgctgag tagtgcgcga gcaaaattta agctacaaca 60

aggcaaggct tgaccgacaa ttgcatgaag aatctgctta gggttaggcg ttttgcgctg 120

cttcgcgatg tacgggccag atatacgcgt tgacattgat tattgactag ttattaatag 180

taatcaatta cggggtcatt agttcatagc ccatatatgg agttccgcgt tacataactt 240

acggtaaatg gcccgcctgg ctgaccgccc aacgaccccc gcccattgac gtcaataatg 300

acgtatgttc ccatagtaac gccaataggg actttccatt gacgtcaatg ggtggagtat 360

ttacggtaaa ctgcccactt ggcagtacat caagtgtatc atatgccaag tacgccccct 420

attgacgtca atgacggtaa atggcccgcc tggcattatg cccagtacat gaccttatgg 480

gactttccta cttggcagta catctacgta ttagtcatcg ctattaccat ggtgatgcgg 540

ttttggcagt acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc 600

caccccattg acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa 660

tgtcgtaaca actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc 720

tatataagca gagctctctg gctaactaga gaacccactg cttactggct tatcgaaatt 780

aatacgactc actataggga gacccaagct tgcattcctg caggtcgacg ccgccaccat 840

ggacatcaag gtggtgttca ccctggtgtt cagcgccctg gtgcaggcca agagcaccga 900

gttcgacccc aacatcgaca tcgtgggcct ggaaggcaag ttcggcatca ccaacctgga 960

aaccgacctg ttcaccatct gggagaccat ggaagtgatg atcaaggccg acatcgccga 1020

caccgaccgg gccagcaact tcgtggccac cgagaccgac gccaaccggg gcaagatgcc 1080

cggcaagaag ctgcccctgg ccgtcatcat ggaaatggaa gccaacgcct tcaaggccgg 1140

ctgcacccgg ggctgcctga tctgcctgag caagatcaag tgcaccgcca agatgaaggt 1200

gtacatcccc ggcaggtgcc acgactacgg cggcgacaag aaaaccggcc aggccggcat 1260

cgtgggcgcc atcgtggaca tccccgagat cagcggcttc aaagaaatgg cccccatgga 1320

acagttcatc gcccaggtgg acagatgcgc cagctgcacc accggctgcc tgaagggcct 1380

ggccaacgtg aagtgcagcg agctgctgaa gaagtggctg cccgaccgct gcgccagctt 1440

cgccgacaag atccagaaag aggtgcacaa catcaagggc atggccggcg acaggtgata 1500

atctagagga tccgaacaaa aactcatctc agaagaggat ctgaatatgc ataccggtca 1560

tcatcaccat caccattgag tttgatcccc gggaattcag acatgataag atacattgat 1620

gagtttggac aaaccacaac tagaatgcag tgaaaaaaat gctttatttg tgaaatttgt 1680

gatgctattg ctttatttgt aaccattata agctgcaata aacaagttgg ggtgggcgaa 1740

gaactccagc atgagatccc cgcgctggag gatcatccag ccggcgtccc ggaaaacgat 1800

tccgaagccc aacctttcat agaaggcggc ggtggaatcg aaatctcgta gcacgtgtca 1860

gtcctgctcc tcggccacga agtgcacgca gttgccggcc gggtcgcgca gggcgaactc 1920

ccgcccccac ggctgctcgc cgatctcggt catggccggc ccggaggcgt cccggaagtt 1980

cgtggacacg acctccgacc actcggcgta cagctcgtcc aggccgcgca cccacaccca 2040

ggccagggtg ttgtccggca ccacctggtc ctggaccgcg ctgatgaaca gggtcacgtc 2100

gtcccggacc acaccggcga agtcgtcctc cacgaagtcc cgggagaacc cgagccggtc 2160

ggtccagaac tcgaccgctc cggcgacgtc gcgcgcggtg agcaccggaa cggcactggt 2220

caacttggcc atggtttagt tcctcacctt gtcgtattat actatgccga tatactatgc 2280

cgatgattaa ttgtcaacac gtgctgatca gatccgaaaa tggatataca agctcccggg 2340

agctttttgc aaaagcctag gcctccaaaa aagcctcctc actacttctg gaatagctca 2400

gaggcagagg cggcctcggc ctctgcataa ataaaaaaaa ttagtcagcc atggggcgga 2460

gaatgggcgg aactgggcgg agttaggggc gggatgggcg gagttagggg cgggactatg 2520

gttgctgact aattgagatg catgctttgc atacttctgc ctgctgggga gcctggggac 2580

tttccacacc tggttgctga ctaattgaga tgcatgcttt gcatacttct gcctgctggg 2640

gagcctgggg actttccaca ccctcgtcga gctagcttcg tgaggctccg gtgcccgtca 2700

gtgggcagag cgcacatcgc ccacagtccc cgagaagttg gggggagggg tcggcaattg 2760

aaccggtgcc tagagaaggt ggcgcggggt aaactgggaa agtgatgtcg tgtactggct 2820

ccgccttttt cccgagggtg ggggagaacc gtatataagt gcagtagtcg ccgtgaacgt 2880

tctttttcgc aacgggtttg ccgccagaac acaggtaagt gccgtgtgtg gttcccgcgg 2940

gcctggcctc tttacgggtt atggcccttg cgtgccttga attacttcca cctggctcca 3000

gtacgtgatt cttgatcccg agctggagcc aggggcgggc cttgcgcttt aggagcccct 3060

tcgcctcgtg cttgagttga ggcctggcct gggcgctggg gccgccgcgt gcgaatctgg 3120

tggcaccttc gcgcctgtct cgctgctttc gataagtctc tagccattta aaatttttga 3180

tgacctgctg cgacgctttt tttctggcaa gatagtcttg taaatgcggg ccaggatctg 3240

cacactggta tttcggtttt tgggcccgcg gccggcgacg gggcccgtgc gtcccagcgc 3300

acatgttcgg cgaggcgggg cctgcgagcg cggccaccga gaatcggacg ggggtagtct 3360

caagctggcc ggcctgctct ggtgcctggc ctcgcgccgc cgtgtatcgc cccgccctgg 3420

gcggcaaggc tggcccggtc ggcaccagtt gcgtgagcgg aaagatggcc gcttcccggc 3480

cctgctccag ggggctcaaa atggaggacg cggcgctcgg gagagcgggc gggtgagtca 3540

cccacacaaa ggaaaagggc ctttccgtcc tcagccgtcg cttcatgtga ctccacggag 3600

taccgggcgc cgtccaggca cctcgattag ttctggagct tttggagtac gtcgtcttta 3660

ggttgggggg aggggtttta tgcgatggag tttccccaca ctgagtgggt ggagactgaa 3720

gttaggccag cttggcactt gatgtaattc tcgttggaat ttgccctttt tgagtttgga 3780

tcttggttca ttctcaagcc tcagacagtg gttcaaagtt tttttcttcc atttcaggtg 3840

tcgtgaacac gtggtcgcgg ccgcttcgaa ggtaccgagc tcggatccgc cgccaccatg 3900

gcatggcagc tcacaagcct cctcctgttc gtggccacct ggggaatttc cggcacacca 3960

gctcctcttg actcagtgtt ctccagcagc gagcgtgccc accaggtgct gcggattcga 4020

aaacgttata attcaggtaa attggaagag tttgttcaag ggaaccttga gagagaatgt 4080

atggaagaaa agtgtagttt tgaagaagca cgagaagttt ttgaaaacac ggaaagaaca 4140

actgaatttt ggaagcagta tgttgacggt gaccagtgct tggtcttgcc cttggagcac 4200

ccgtgcgcca gcctgtgctg cgggcacggc acgtgcatcg acggcatcgg cagcttcagc 4260

tgcgactgcc gcagcggctg ggagggccgc ttctgccagc gcgaggtgag cttcctcaat 4320

tgctctctgg acaacggcgg ctgcacgcat tactgcctag aggaggtggg ctggcggcgc 4380

tgtagctgtg cgcctggcta caagctgggg gacgacctcc tgcagtgtca ccccgcagtg 4440

aagttccctt gtgggaggcc ctggaagcgg atggagaaga agcgcagtca cctgaaacga 4500

gacacagaag accaagaaga ccaagtagat ccgcggctca ttgatgggaa gatgaccagg 4560

cggggagaca gcccctggca ggtggtcctg ctggactcaa agaagaagct ggcctgcggg 4620

gcagtgctca tccacccctc ctgggtgctg acagcggccc actgcatgga tgagtccaag 4680

aagctccttg tcaggcttgg agagtatgac ctgcggcgct gggagaagtg ggagctggac 4740

ctggacatca aggaggtctt cgtccacccc aactacagca agagcaccac cgacaatgac 4800

atcgcactgc tgcacctggc ccagcccgcc accctctcgc agaccatagt gcccatctgc 4860

ctcccggaca gcggccttgc agagcgcgag ctcaatcagg ccggccagga gaccctcgtg 4920

acgggctggg gctaccacag cagccgagag aaggaggcca agagaaaccg caccttcgtc 4980

ctcaacttca tcaagattcc cgtggtcccg cacaatgagt gcagcgaggt catgagcaac 5040

atggtgtctg agaacatgct gtgtgcgggc atcctcgggg accggcagga tgcctgcgag 5100

ggcgacagtg gggggcccat ggtcgcctcc ttccacggca cctggttcct ggtgggcctg 5160

gtgagctggg gtgagggctg tgggctcctt cacaactacg gcgtttacac caaagtcagc 5220

cgctacctcg actggatcca tgggcacatc agagacaagg aagcccccca gaagagctgg 5280

gcaccttaat ctagagggcc cgtttaaacc cgctgatcag cctcgactgt gccttctagt 5340

tgccagccat ctgttgtttg cccctccccc gtgccttcct tgaccctgga aggtgccact 5400

cccactgtcc tttcctaata aaatgaggaa attgcatcgc attgtctgag taggtgtcat 5460

tctattctgg ggggtggggt ggggcaggac agcaaggggg aggattggga agacaatagc 5520

aggcatgctg gggatgcggt gggctctatg gcttctgagg cggaaagaac cagctggggc 5580

tctagggggt atccccacgc gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt 5640

acgcgcagcg tgaccgctac acttgccagc gccctagcgc ccgctccttt cgctttcttc 5700

ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg ggggctccct 5760

ttagggttcc gatttagtgc tttacggcac ctcgacccca aaaaacttga ttagggtgat 5820

ggttcacgta cctagaagtt cctattccga agttcctatt ctctagaaag tataggaact 5880

tccttggcca aaaagcctga actcaccgcg acgtctgtcg agaagtttct gatcgaaaag 5940

ttcgacagcg tctccgacct gatgcagctc tcggagggcg aagaatctcg tgctttcagc 6000

ttcgatgtag gagggcgtgg atatgtcctg cgggtaaata gctgcgccga tggtttctac 6060

aaagatcgtt atgtttatcg gcactttgca tcggccgcgc tcccgattcc ggaagtgctt 6120

gacattgggg aattcagcga gagcctgacc tattgcatct cccgccgtgc acagggtgtc 6180

acgttgcaag acctgcctga aaccgaactg cccgctgttc tgcagccggt cgcggaggcc 6240

atggatgcga tcgctgcggc cgatcttagc cagacgagcg ggttcggccc attcggaccg 6300

caaggaatcg gtcaatacac tacatggcgt gatttcatat gcgcgattgc tgatccccat 6360

gtgtatcact ggcaaactgt gatggacgac accgtcagtg cgtccgtcgc gcaggctctc 6420

gatgagctga tgctttgggc cgaggactgc cccgaagtcc ggcacctcgt gcacgcggat 6480

ttcggctcca acaatgtcct gacggacaat ggccgcataa cagcggtcat tgactggagc 6540

gaggcgatgt tcggggattc ccaatacgag gtcgccaaca tcttcttctg gaggccgtgg 6600

ttggcttgta tggagcagca gacgcgctac ttcgagcgga ggcatccgga gcttgcagga 6660

tcgccgcggc tccgggcgta tatgctccgc attggtcttg accaactcta tcagagcttg 6720

gttgacggca atttcgatga tgcagcttgg gcgcagggtc gatgcgacgc aatcgtccga 6780

tccggagccg ggactgtcgg gcgtacacaa atcgcccgca gaagcgcggc cgtctggacc 6840

gatggctgtg tagaagtact cgccgatagt ggaaaccgac gccccagcac tcgtccgagg 6900

gcaaaggaat agcacgtact acgagatttc gattccaccg ccgccttcta tgaaaggttg 6960

ggcttcggaa tcgttttccg ggacgccggc tggatgatcc tccagcgcgg ggatctcatg 7020

ctggagttct tcgcccaccc caacttgttt attgcagctt ataatggtta caaataaagc 7080

aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg 7140

tccaaactca tcaatgtatc ttatcatgtc tgtataccgt cgacctctag ctagagcttg 7200

gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac 7260

aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gagctaactc 7320

acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg 7380

cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgct 7440

tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 7500

tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 7560

gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 7620

aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 7680

ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 7740

gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 7800

ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 7860

ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 7920

cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 7980

attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 8040

ggctacacta gaagaacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 8100

aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt 8160

gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt 8220

tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga 8280

ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc 8340

taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct 8400

atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata 8460

actacgatac gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca 8520

cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga 8580

agtggtcctg caactttatccgcctccatc cagtctatta attgttgccg ggaagctaga 8640

gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg 8700

gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga 8760

gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt 8820

gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct 8880

cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca 8940

ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat 9000

accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga 9060

aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc 9120

aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg 9180

caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc 9240

ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt 9300

gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca 9360

cctgacgtcg acggatcggg agatctcccg atcccctatg gtgcactctc agtacaatct 9420

gctctgatgc cgcatagtta agccagtatc tg 9452

Claims

1. A method for screening small molecular compounds for targeted inhibition of vitamin K epoxide reductase is characterized by comprising the following steps: the method comprises the following steps:

2. The screening method of small molecule compounds for targeted inhibition of vitamin K epoxide reductase according to claim 1, wherein: in the step 1), the host cell of the double-reporter gene cell system is a human embryonic kidney cell 293 Trex.

3. The screening method of small molecule compounds for targeted inhibition of vitamin K epoxide reductase according to claim 1, wherein: in the step 1), the reporter gene is a beetle luciferase reporter gene, the nucleotide sequence of the beetle luciferase reporter gene is shown as SEQ ID NO.3, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 4.

4. The method for screening small molecule compounds for targeted inhibition of vitamin K epoxide reductase according to claim 1, wherein the method comprises the following steps: in the step 1), the nucleotide sequence of the plasmid for simultaneously expressing the FIX-Gla-PC fusion gene and the reporter gene is shown as SEQ ID NO. 5.

5. The method for screening small molecule compounds for targeted inhibition of vitamin K epoxide reductase according to claim 1, wherein the method comprises the following steps: in the step 1), the concentration of vitamin K in the culture solution of the double-reporter gene cell system is 1-20 mu mol/L.

6. The method for screening small molecule compounds for targeted inhibition of vitamin K epoxide reductase according to claim 1, wherein the method comprises the following steps: in step 2), the method for determining the inhibition of VKOR protein activity is as follows:

mixing the screened micromolecule compound for targeted inhibition of vitamin K circulation with vitamin K epoxide working solution and VKOR protein working solution, adding the mixture into a fluorescence measurement plate, detecting fluorescence by using a fluorescence detector, setting the wavelength of exciting light to be 245-; and/or

7. The method for screening small molecule compounds for targeted inhibition of vitamin K epoxide reductase according to claim 6, wherein: the preparation method of the vitamin K epoxide working solution comprises the following steps: respectively taking a buffer solution 1, a buffer solution 2 and a buffer solution 3, and preparing a vitamin K epoxide working solution with the GSH concentration of 60-160mmol/L and the vitamin K epoxide concentration of 30-80 mu mol/L;

the composition of buffer 3 included: 1-50mmol/L of vitamin K epoxide, and isopropanol as a solvent;

8. The method for screening small molecule compounds for targeted inhibition of vitamin K epoxide reductase according to claim 6 or 7, wherein: the increment of the fluorescence value calculated by the end-point method is as follows: by fluorescenceDetecting fluorescence once every a period of time by using a detector, wherein the total detection time is 1-2 hours; activity of VKOR protein-fluorescence value F of reaction 1 hour_T1Background fluorescence value at the beginning of the reaction F_T0。

9. Use of the small molecule compound screened by the screening method of small molecule compounds for targeted inhibition of vitamin K epoxide reductase according to any one of claims 1 to 8 as an inhibitor for preparing targeted vitamin K epoxide reductase.

10. Use according to claim 9, characterized in that: the structural formula of the screened small molecule compound is as follows: