CN111235284A - AMH gene SNP molecular marker related to laying age and egg yield of chicken and application thereof - Google Patents
AMH gene SNP molecular marker related to laying age and egg yield of chicken and application thereof Download PDFInfo
- Publication number
- CN111235284A CN111235284A CN202010141720.5A CN202010141720A CN111235284A CN 111235284 A CN111235284 A CN 111235284A CN 202010141720 A CN202010141720 A CN 202010141720A CN 111235284 A CN111235284 A CN 111235284A
- Authority
- CN
- China
- Prior art keywords
- amh
- laying
- day
- chicken
- age
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241000287828 Gallus gallus Species 0.000 title claims abstract description 54
- 101150070496 Amh gene Proteins 0.000 title claims abstract description 32
- 239000003147 molecular marker Substances 0.000 title claims abstract description 23
- 235000013330 chicken meat Nutrition 0.000 claims abstract description 53
- 238000009395 breeding Methods 0.000 claims abstract description 22
- 230000001488 breeding effect Effects 0.000 claims abstract description 22
- 230000035772 mutation Effects 0.000 claims abstract description 17
- 238000000034 method Methods 0.000 claims abstract description 14
- 239000002773 nucleotide Substances 0.000 claims abstract description 7
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 7
- 238000012408 PCR amplification Methods 0.000 claims description 8
- 238000001962 electrophoresis Methods 0.000 claims description 6
- 239000003550 marker Substances 0.000 claims description 5
- 239000008280 blood Substances 0.000 claims description 4
- 210000004369 blood Anatomy 0.000 claims description 4
- 238000006243 chemical reaction Methods 0.000 claims description 4
- 238000000137 annealing Methods 0.000 claims description 3
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 238000001514 detection method Methods 0.000 claims description 3
- 238000001502 gel electrophoresis Methods 0.000 claims description 3
- 239000000203 mixture Substances 0.000 claims description 3
- 238000003752 polymerase chain reaction Methods 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 210000003462 vein Anatomy 0.000 claims description 3
- 239000012154 double-distilled water Substances 0.000 claims description 2
- 238000012214 genetic breeding Methods 0.000 claims description 2
- 235000013601 eggs Nutrition 0.000 abstract description 21
- 102100030173 Muellerian-inhibiting factor Human genes 0.000 abstract description 5
- 238000004519 manufacturing process Methods 0.000 abstract description 5
- 230000009286 beneficial effect Effects 0.000 abstract description 4
- 230000017448 oviposition Effects 0.000 abstract description 4
- 230000008569 process Effects 0.000 abstract description 3
- 244000144992 flock Species 0.000 abstract description 2
- 108020004999 messenger RNA Proteins 0.000 abstract description 2
- 108020004414 DNA Proteins 0.000 description 10
- 108090000623 proteins and genes Proteins 0.000 description 7
- 238000004458 analytical method Methods 0.000 description 6
- 230000014509 gene expression Effects 0.000 description 6
- 102000004169 proteins and genes Human genes 0.000 description 5
- 108010005853 Anti-Mullerian Hormone Proteins 0.000 description 4
- 239000000868 anti-mullerian hormone Substances 0.000 description 4
- 230000002611 ovarian Effects 0.000 description 4
- 230000007115 recruitment Effects 0.000 description 4
- 238000012163 sequencing technique Methods 0.000 description 4
- 210000004027 cell Anatomy 0.000 description 3
- 230000008859 change Effects 0.000 description 3
- 238000010219 correlation analysis Methods 0.000 description 3
- 238000001976 enzyme digestion Methods 0.000 description 3
- 230000003325 follicular Effects 0.000 description 3
- 239000000463 material Substances 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 238000009394 selective breeding Methods 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 108091026890 Coding region Proteins 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 230000036750 egg laying performance Effects 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 230000002710 gonadal effect Effects 0.000 description 2
- 210000002503 granulosa cell Anatomy 0.000 description 2
- 239000005556 hormone Substances 0.000 description 2
- 229940088597 hormone Drugs 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 210000002394 ovarian follicle Anatomy 0.000 description 2
- 244000144977 poultry Species 0.000 description 2
- 235000013594 poultry meat Nutrition 0.000 description 2
- 230000001105 regulatory effect Effects 0.000 description 2
- 230000004044 response Effects 0.000 description 2
- 108091008146 restriction endonucleases Proteins 0.000 description 2
- 238000013518 transcription Methods 0.000 description 2
- 230000035897 transcription Effects 0.000 description 2
- 229920000936 Agarose Polymers 0.000 description 1
- 108700028369 Alleles Proteins 0.000 description 1
- 102000012673 Follicle Stimulating Hormone Human genes 0.000 description 1
- 108010079345 Follicle Stimulating Hormone Proteins 0.000 description 1
- 240000004212 Madhuca longifolia Species 0.000 description 1
- 235000005058 Madhuca longifolia Nutrition 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 102000009618 Transforming Growth Factors Human genes 0.000 description 1
- 108010009583 Transforming Growth Factors Proteins 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 125000003275 alpha amino acid group Chemical group 0.000 description 1
- 239000011668 ascorbic acid Substances 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 238000010835 comparative analysis Methods 0.000 description 1
- 230000001276 controlling effect Effects 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000018109 developmental process Effects 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 210000003746 feather Anatomy 0.000 description 1
- 229940028334 follicle stimulating hormone Drugs 0.000 description 1
- 230000008217 follicular development Effects 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 210000002149 gonad Anatomy 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 230000002401 inhibitory effect Effects 0.000 description 1
- 230000000977 initiatory effect Effects 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 238000012423 maintenance Methods 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 230000005305 organ development Effects 0.000 description 1
- 238000011084 recovery Methods 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 230000028327 secretion Effects 0.000 description 1
- CDBYLPFSWZWCQE-UHFFFAOYSA-L sodium carbonate Substances [Na+].[Na+].[O-]C([O-])=O CDBYLPFSWZWCQE-UHFFFAOYSA-L 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 230000007704 transition Effects 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
An SNP molecular marker related to the growth day and the egg yield traits of chickens and application thereof belong to the technical field of genetics, the SNP molecular marker is from an AMH gene, a nucleotide sequence is shown as SEQ ID NO.1, and the base G at the 242 th site of the 5 th' end of the sequence shown as SEQ ID NO.1 is mutated into A (namely 1405(G > A) on an NCBI AMH mRNA sequence NM-205030.1). The invention discovers for the first time that 1 mutation site, namely G1405A, exists in the chicken AMH gene Exon5, the number of eggs laid by individuals with AA genotypes at the day-of-birth age and 300-day-of-age is higher than that of other genotypes, and the AA genotype individuals are selected for seed reservation, so that the overall production performance of chicken flocks can be improved. The molecular marker associated with the egg-laying traits can be detected visually, so that the method is simple, convenient and quick, and is beneficial to breeding high-yield laying hen varieties and accelerating the breeding process.
Description
Technical Field
The invention belongs to the technical field of genetics, and relates to a molecular marker method for a 1405 th site (Exon5) single mutation site of an AMH gene of a chicken and application thereof in chicken breeding, in particular to an SNP molecular marker related to the age of the chicken in the day of birth and the egg yield traits and application thereof.
Background
The study of Anti-mullerian hormone (AMH), one of the superfamily of transforming growth factors β, plays an indispensable role not only in gonadal organ development, but also in the activities of both primary follicle recruitment and follicle selection, as well as one of the important markers of gonadal function, suggests that during follicular development, the AMH gene not only regulates follicle recruitment, but also plays an important role in the dominant follicle selection phase, that the site of AMH production is the gonad, and that the site of expression is granulosa cells of ovarian follicle growth, but that the follicle undergoing expression must be a healthy follicle, whose expression is capable of maintaining the follicle in the primordial follicle pool at a level that does not prematurely consume the follicle, and that it also functions to maintain ovarian reserve, and that the maintenance of the dynamic balance of follicle recruitment, growth and atresia is also found to be affected by ovarian follicle cells in which the follicle-mullerian hormone (2003) is mainly expressed in antral cells, and that the follicle-like hormone is capable of inhibiting the follicle secretion of ovarian follicle-like protein, and that it also acts to inhibit the follicle-like growth of ovarian follicle-like cells, and that the follicle-like, the follicle-stimulating hormone expressed in response to the follicle-stimulating factor, the follicle-stimulating factor, such that it acts to inhibit the follicle-stimulating factor, and the follicle-stimulating factor, and the growth, and the follicle-stimulating factor, and the growth of ovarian.
The molecular marker assisted selective breeding utilizes the characteristic that the molecular marker is tightly linked with a gene for controlling target characters, quickly and accurately screens dominant genotypes on the DNA molecular level, shortens the breeding period, accelerates the breeding process and improves the breeding efficiency. Therefore, the research on the SNPs of the chicken AMH gene is beneficial to finding out meaningful molecular markers, lays a theoretical foundation for marker-assisted selection of the egg laying performance of the chicken, and provides a new idea for improving the breeding rate of the chicken.
Disclosure of Invention
Aiming at the prior art, the invention aims to provide a molecular marking method for a single mutation site in an Exon region of a chicken AMH gene and application thereof in chicken breeding.
The technical scheme adopted for realizing the purpose is as follows:
SNP molecular marker related to the laying day age and egg yield traits of chicken, wherein the SNP molecular marker is from AMH gene, the nucleotide sequence is shown as SEQ ID NO.1, and the 242 nd base G of the 5 th' end of the sequence shown as SEQ ID NO.1 is mutated into A (namely 1405(G > A) on NCBI AMH mRNA sequence NM-205030.1).
The SNP molecular marker related to the laying day age and the egg yield traits of the chickens, and the individual with the base A at the 1405 st locus (Exon5) of the AMH gene shows the high egg yield traits of early laying and 300 days old.
The SNP molecular marker related to the laying day age of the chicken and the egg yield traits is applied to genetic breeding of the chicken. The method is applied to breeding of high-yield laying hen varieties and/or breeding of early-onset day-old laying hens.
A PCR primer for detecting SNP molecular markers related to the laying day age and the egg yield traits of chickens adopts a marker primer P-AMH-1, and comprises the following steps:
P-AMH-1F：5’CGGTTCTGCCGCAGGACTTT 3’；
P-AMH-1R：5’GCTCCCTCACCAACTGCTCA 3’。
the primer is applied to the breeding of high-yield layer varieties in an auxiliary mode and/or early-onset day-old layer varieties.
A kit for detecting SNP molecular markers related to the age of the laying day and the egg yield traits of chickens, wherein the kit comprises the primers as claimed in claim 5.
The kit is applied to the breeding of high-yield layer varieties in an auxiliary mode and/or early-onset day-old layer varieties.
An SNP molecular marking method related to the laying day age and egg yield traits of chickens comprises the following steps:
(1) extracting genome DNA: collecting blood of wing vein, extracting genome DNA, and storing at-20 deg.C;
(2) designing a primer: adopting a labeled primer P-AMH-1, comprising the following steps:
P-AMH-1F：5'CGGTTCTGCCGCAGGACTTT 3'；
P-AMH-1R：5'GCTCCCTCACCAACTGCTCA 3'；
(3) and (3) PCR amplification:
and (3) PCR reaction system: containing 0.5. mu.L of genomic DNA template (50-100 ng/. mu.L), 2 XTaq Master Mix 10. mu. L, P-AMH-1F and P-AMH-1R primers 0.5. mu.L (10. mu.M), ddH2O 8.5μL；
PCR amplification procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 10sec, annealing at 62 ℃ for 30sec, and extension at 72 ℃ for 30sec, for 36 cycles; after circulation, incubating at 72 ℃ for 7 min;
(4) and (3) electrophoresis detection: detecting the amplification product by gel electrophoresis to obtain the corresponding genotype of the sample, detecting 1 mutation site at the 1405 st site (Exon5) of the AMH gene, wherein the G1405A mutation site is related to the laying characters of the chickens at the first laying day age and the 300 day age.
The method for breeding the early-onset day-old laying hen variety by utilizing the SNP molecular marker in an auxiliary manner comprises the following steps: in a chicken population, selecting a cock with the genotype of AA homozygous genotype and a hen with the genotype of AA homozygous to mate with each other, wherein the age of the birth date of the obtained offspring hen is obviously earlier than that of other genotypes, and the AA homozygous genotype is that the 242 th base of the 5 th end of a sequence shown in SEQ ID NO.1 is A or the 1405 th base (Exon5) of the AMH gene is A. The number of eggs laid by AA genotype at the day of laying opening and 300 days is earlier than that of other genotypes, and an AA genotype individual is selected for seed reservation, so that the overall production performance of the chicken flock can be improved.
The invention has the beneficial effects that:
(1) the invention discovers for the first time that 1 mutation site, namely G1405A, exists in the chicken AMH gene (Exon5), and the number of eggs laid by the AA genotype at the day-to-date age and 300 days is earlier than that of other genotypes. The molecular marker associated with the egg-laying traits can be detected visually, so that the method is simple, convenient and quick, and is beneficial to breeding high-yield laying hen varieties and accelerating the breeding process.
(2) The SNP molecular marker is used for assisting in selective breeding of chickens, and the obtained AA genotype chickens have the characteristics of early onset of laying and high egg yield; therefore, different chicken varieties can be bred according to requirements by utilizing the SNP molecular marker.
Drawings
FIG. 1 is the electrophoresis diagram of the fragment PCR-amplified by the P-AMH-1F/R primer.
FIG. 2 is a diagram of sequencing polymorphism of 1405 th site (Exon5) mutation site of chicken AMH gene.
FIG. 3 is an electrophoretogram of the amplified Taihang chicken AMH gene.
Detailed Description
It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
Description of terms: SNP (single nucleotide polymorphism), i.e., single nucleotide polymorphism), refers to a species polymorphism caused by a mutation of a single nucleotide (AGTC) in a genomic DNA sequence. SNPs are stable in a population with remaining base mutations, usually single base transitions, transversions, insertions and deletions.
SNPs occurring in the coding region are also called cSNPs, and the variation rate is only one fifth of that of the surrounding region, but cSNPs have important significance on the genetic traits of organisms, wherein the cSNPs cause the change of the coding sequence without affecting the translated protein amino acid sequence (the meaning of the mutated bases is the same after the base mutation), and are synonymous cSNPs; another type of mutation is a nonsynonymous mutation in which a change in the base sequence of the corresponding translated protein results in a change in the sequence of the protein, which in turn affects the function of the protein.
Gene expression transcription is regulated by 5' regulatory region sequences, and base mutations typically affect the initiation of transcription, and thus gene expression. It has been found that the AMH gene is secreted mainly by small antral follicular granulosa cells in poultry and plays a role in suppressing primordial follicular recruitment and reducing the response of immature follicles to FSH, thereby participating in follicular selection, but the specific expression control mechanism is not clear. Therefore, the invention mainly researches SNPs in the chicken AMH gene Exon region, aims to find effective molecular markers related to egg laying traits of the chicken, and provides an effective theoretical basis for molecular marker-assisted selective breeding of the chicken.
The number of SNP sites in a gene is large, and on average, one SNP is generated every 300 SNP sites, so that important and difficult researches on the SNP can find out the SNP which is obviously associated with a certain biological trait. In order to find out SNPs of an Exon region of a chicken AMH gene, the invention obtains a chicken AMH gene sequence (NM _205030.1) according to NCBI GenBank, designs a primer P-AMH-1, amplifies the genomic DNA of a chicken breeding material, carries out agarose gel electrophoresis and recovery on a PCR amplification product, obtains a sequence shown as SEQ ID NO.1 through sequencing, and detects 1 mutation site, namely a G1405A site, in AMH gene Exon 5.
Linkage disequilibrium analysis is carried out by using SHESIS online software, and the result shows that 1405 locus presents a linkage disequilibrium state. Therefore, the locus is selected for single locus marker analysis, and the result shows that the locus is related to the egg number of the laying day age of 300 days.
In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments.
The test materials used in the examples of the present invention are all conventional in the art and commercially available. The methods adopted by the invention are all the prior art in the field, and details are not shown.
Example 1: PCR amplification, sequence comparison and mutation site analysis of chicken AMH gene Exon5 sequence
1. Test materials
Selecting single cage bred 300 days old mahua feather Taixing hen with same feed level and breeding condition, wherein the hen is selected from Taixing hen breed conservation base of Kyobei Kyork poultry science and technology Limited. Random sampling, collecting blood from the wing vein, extracting the genomic DNA of the blood, and storing at-20 ℃.
2. Test method
2.1 primer design
The primer P-AMH-1 used in this experiment was designed based on the sequence of the chicken AMH gene in NCBI (NM-205030.1) (see Table 1 for details). The primer is designed specifically according to the sequence of the chicken in a database for researching the mutation of the chicken AMH gene Exon5 region.
2.2PCR amplification
The Taihang chicken genome of known egg laying level was randomly selected as a template. PCR amplification was performed with primer P-AMH-1. PCR amplification was performed using the Taihang chicken genome as template with primer P-AMH-1, shown in Table 1:
and (3) PCR reaction system: the total volume is 20. mu.L, including 0.5. mu.L of genomic DNA (50-100 ng/. mu.L), 2 XTAQAQALMaster Mix 10. mu.L, upstream and downstream primers 0.5. mu.L (10. mu.M), ddH2O8.5μL。
PCR amplification procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 10sec, annealing at 62 ℃ for 30sec, and extension at 72 ℃ for 30sec, for 36 cycles; at the end of the cycle, the incubation was carried out at 72 ℃ for 7 min. After the PCR amplification product is detected to be free from problems through 1.0% agarose electrophoresis, the PCR amplification product is sent to a company for direct sequencing.
TABLE 1
3. Enzyme digestion identification
Selecting a reaction system of BtsIMutI restriction endonuclease as single enzyme digestion, and reacting for 8h at 55 ℃. Enzyme digestion system: a total volume of 10. mu.L was included, including dd H2O 4. mu.L, 10 XBuffer 1. mu.L, PCR product 4. mu.L, and BtsIMutI restriction enzyme (1U/. mu.L) 1. mu.L.
4. Gel electrophoresis detection
The electrophoresis of the PCR product is shown in FIG. 1, and the length of the target fragment is 387bp (SEQ ID NO.1), DL2000 DNAmarker.
The DNA MAN version 7.0 is used for comparing sequence homology and completing the search of mutant nucleotide, and the sequencing result is analyzed by Seqman software, so that the amplified Taipan chicken AMH gene 1405 site (Exon5) has SNP (shown in figure 3, GG genotype: 387 bp; AG genotype: 387\239\148 bp; AA genotype: 239\148 bp; DL2000 DNA marker).
5. Correlation analysis of chicken AMH gene Exon5 polymorphism and development day age and egg yield
The mutant sites were analyzed using DNAstar. Using χ2Fitness tests judge whether the population is in Hardy-Weinberg equilibrium. The software SPSS 20.0 is used for carrying out correlation analysis of genotype and characters (day age of onset, egg number), and the level of significant difference is set as P by multiple comparative analysis of different genotypes<0.05。
6. Results and analysis
Linkage disequilibrium analysis was performed using the online software of SHESIS and it was found that 1405 locus exhibits linkage equilibrium (Table 2). Therefore, this site was selected for single site labeling analysis and found to correlate with the number of eggs laid at day-of-onset age, 300 days of age (Table 3).
TABLE 2 SNPs genotype and allele frequency distribution in Exon5 region of chicken AMH gene
TABLE 3 correlation analysis of polymorphism at position 1405 (Exon5) of chicken AMH gene with egg laying performance
Note: AFE refers to open-day age, E300 refers to 300-day egg production, and E500 refers to 500-day egg production.
The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.
SEQUENCE LISTING
<110> university of Hebei engineering
<120> AMH gene SNP molecular marker related to laying age and egg yield of chicken and application
<160>1
<170>PatentIn version 3.3
<210>1
<211>961
<212>DNA
<213> Artificial sequence
<400>1
tgctgaccct cttcatccgc cgggtgctga gcccccgcag cgagccgccc acccagccca 60
gctcccagca ctggttggac ttccagatga tggagacgct ccctcaccaa ctactcaacc 120
tgtcggagac ggccgccctg gagcgcctgg tgcagtcgga ggagccctcg gtgctgcttt 180
tcccccagga gggcggcgca gggctggagc agcattttgg ggactggcag ccagagggga 240
cggtgctgca gctgctgatg ggcaaactgc aggcggtgat ccacgagctg agggacatcc 300
cggagttcca agccaacacg gggctcttcc agcacctcct cagcttctgc taccaccctc 360
cagggccggc tgcgggcggg cagcccccag gctcagggaa gctgcacgca ctgctgctgc 420
tgaaggcgct gcaaacggtg cgggcgcgct ggcaggagag gaggaaagtc ctgcggcaga 480
accgcagcgc gcggcaccag gcgcactgca ggctgcagga gctgaccatc gacctgcgcg 540
accgcaactt catcgtcatg cccaccgtct acgaggccaa caactgcgag gggccctgca 600
ggctgcccct ctccacccgc gtgcccggct accactcgca caccgtgctg ctgctgggca 660
tgcaggagcg gggttcgccg ctgcagccgc ttccatgctg cgtgcccgtc cgttactcgg 720
accaactcat catcagcgtg ttggccgagg ggctggaggt gcgcaagttc cccaacatgg 780
tggcggagga gtgcggctgt cggtaggggt tcccacctgc agtgctcctg gctgagatgg 840
gagtgtccct ccgcgtgcct tttcctcctg gttgcctcct agcattgctc tggttctgtt 900
tttactctgt ggggctgtgc tgccctacat ccccctgcag tgtctcgtgg ctgtacccat 960
c 961
Claims (10)
1. The SNP molecular marker related to the laying day age and the egg yield traits of the chickens is characterized in that the SNP molecular marker is derived from an AMH gene, the nucleotide sequence is shown as SEQ ID NO.1, and the 242 nd base G of the sequence shown as SEQ ID NO.1 from the 5' end is mutated into A.
2. The SNP molecular marker related to the laying day age and egg yield traits of chickens according to claim 1, wherein individuals with the base A of Exon5 at the 1405 site of the AMH gene show the traits of early laying and 300-day-old high egg yield.
3. The use of the SNP molecular markers according to claim 1 or 2 for genetic breeding of chickens.
4. The use according to claim 3, characterized in that it is applied to the breeding of high-yielding laying hen breeds and/or the breeding of early-onset day-old laying hens.
5. A PCR primer for detecting SNP molecular markers related to the laying day age and the egg yield traits of chickens is characterized in that a marker primer P-AMH-1 is adopted, and the method comprises the following steps:
P-AMH-1F：5'CGGTTCTGCCGCAGGACTTT 3'；
P-AMH-1R：5'GCTCCCTCACCAACTGCTCA 3'。
6. use of the primers of claim 5 for assisting in breeding of high-producing layer varieties and/or early-producing day-old layer varieties.
7. A kit for detecting SNP molecular markers related to the age of a chicken in the day of onset and egg yield traits, which is characterized by comprising the primer of claim 5.
8. Use of the kit according to claim 7 for assisting in the breeding of high-yield layer breeds and/or early-flowering day-old layer breeds.
9. An SNP molecular marking method related to the laying age of chicken and the egg yield traits is characterized in that:
(1) extracting genome DNA: collecting blood from the wing vein, extracting genome DNA, and storing at-20 deg.C;
(2) designing a primer: adopting a labeled primer P-AMH-1, comprising the following steps:
P-AMH-1F：5'CGGTTCTGCCGCAGGACTTT 3'；
P-AMH-1R：5'GCTCCCTCACCAACTGCTCA3'；
(3) and (3) PCR amplification:
and (3) PCR reaction system: 50-100 ng/. mu.L of genomic DNA template 0.5. mu.L, 2 XTaq Master Mix 10. mu.L, 10. mu. M P-AMH-1F and 10. mu. M P-AMH-1R primers 0.5. mu.L each, ddH2O 8.5μL；
PCR amplification procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 10sec, annealing at 62 ℃ for 30sec, and extension at 72 ℃ for 30sec, for 36 cycles; after circulation, incubating at 72 ℃ for 7 min;
(4) and (3) electrophoresis detection: and detecting the amplified product by gel electrophoresis to obtain the genotype corresponding to the sample, and detecting 1 mutation site at the 1405 th site of the AMH gene, wherein the individual with the base A is related to the laying characteristics of the chicken at the day age of laying and 300 days of laying.
10. The method for breeding the early-laying day-old laying hen variety by the aid of the SNP molecular marker as claimed in claim 1 or 2, is characterized by comprising the following steps: in a chicken population, selecting a cock with the genotype of AA homozygous genotype and a hen with the genotype of AA homozygous to mate with each other, wherein the age of the birth date of the obtained offspring hen is obviously earlier than that of other genotypes, and the AA homozygous genotype is that the 242 th base of the 5 th end of a sequence shown in SEQ ID NO.1 is A or the 1405 Exon5 th base of the AMH gene is A.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010141720.5A CN111235284B (en) | 2020-03-04 | 2020-03-04 | AMH gene SNP molecular marker related to chicken open-laying days and egg yield and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010141720.5A CN111235284B (en) | 2020-03-04 | 2020-03-04 | AMH gene SNP molecular marker related to chicken open-laying days and egg yield and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111235284A true CN111235284A (en) | 2020-06-05 |
| CN111235284B CN111235284B (en) | 2023-12-26 |
Family
ID=70864629
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010141720.5A Active CN111235284B (en) | 2020-03-04 | 2020-03-04 | AMH gene SNP molecular marker related to chicken open-laying days and egg yield and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111235284B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112899372A (en) * | 2021-01-26 | 2021-06-04 | 河北工程大学 | HSD3B1 gene SNP molecular marker related to laying age and egg yield of chicken and application thereof |
| CN115287366A (en) * | 2022-06-24 | 2022-11-04 | 中国农业大学 | 15K SNP sequencing and typing chip for breeding chicken with open-laying day-old character and application |
| CN116103413A (en) * | 2023-03-17 | 2023-05-12 | 湖北省农业科学院畜牧兽医研究所 | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof |
| CN116751868A (en) * | 2023-03-17 | 2023-09-15 | 湖北省农业科学院畜牧兽医研究所 | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699308A (en) * | 2019-09-20 | 2020-01-17 | 华中农业大学 | AMH-INH-GNIH three-expression gene vaccine for improving animal fertility, and preparation method and application thereof |
-
2020
- 2020-03-04 CN CN202010141720.5A patent/CN111235284B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699308A (en) * | 2019-09-20 | 2020-01-17 | 华中农业大学 | AMH-INH-GNIH three-expression gene vaccine for improving animal fertility, and preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| ENSEMBLE: "rs1060058695", 《ENSEMBLE》 * |
| TAO ZHANG等: "Transcriptome analysis of ovary in relatively greater and lesser egg producing Jinghai Yellow Chicken", 《ANIMAL REPRODUCTION SCIENCE》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112899372A (en) * | 2021-01-26 | 2021-06-04 | 河北工程大学 | HSD3B1 gene SNP molecular marker related to laying age and egg yield of chicken and application thereof |
| CN115287366A (en) * | 2022-06-24 | 2022-11-04 | 中国农业大学 | 15K SNP sequencing and typing chip for breeding chicken with open-laying day-old character and application |
| CN116103413A (en) * | 2023-03-17 | 2023-05-12 | 湖北省农业科学院畜牧兽医研究所 | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof |
| CN116751868A (en) * | 2023-03-17 | 2023-09-15 | 湖北省农业科学院畜牧兽医研究所 | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof |
| CN116103413B (en) * | 2023-03-17 | 2023-09-22 | 湖北省农业科学院畜牧兽医研究所 | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof |
| CN116751868B (en) * | 2023-03-17 | 2024-01-30 | 湖北省农业科学院畜牧兽医研究所 | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111235284B (en) | 2023-12-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111235284B (en) | AMH gene SNP molecular marker related to chicken open-laying days and egg yield and application thereof | |
| Yang et al. | Identification of candidate growth-related SNPs and genes using GWAS in brown-marbled grouper (Epinephelus fuscoguttatus) | |
| US20100281547A1 (en) | Selecting animals for desired genotypic or potential phenotypic properties | |
| EP0570496A1 (en) | Polymorphic dna markers in bovidae | |
| US20100261173A1 (en) | Identification Of Fat And Lean Phenotypes In Chickens Using Molecular Markers | |
| Zhou et al. | The zon laboratory guide to positional cloning in zebrafish | |
| CN112899372A (en) | HSD3B1 gene SNP molecular marker related to laying age and egg yield of chicken and application thereof | |
| CN114231642B (en) | Molecular marker and specific primer pair related to diameter character of wool fibers of Erdos fine wool sheep and application | |
| Li et al. | Characterization, tissue expression, and imprinting analysis of the porcine CDKN1C and NAP1L4 genes | |
| US7993882B2 (en) | CRH and POMC effects on animal growth | |
| US20170058362A1 (en) | Method of identifying the presence of foreign alleles in a desired haplotype | |
| US20090246778A1 (en) | Identification of fat and lean phenotypes in chickens using molecular markers | |
| Hosseini et al. | Genetic association of PPARGC1A gene single nucleotide polymorphism with milk production traits in Italian Mediterranean buffalo | |
| CN114350818A (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| Xu et al. | SNP and haplotype analysis of paired box 3 (PAX3) gene provide evidence for association with growth traits in Chinese cattle | |
| EP1660675B1 (en) | Polymorphism of the igf2 gene and improving production characteristics of cattle | |
| Gencheva et al. | Identification of nucleotide variation of growth hormone gene in rabbit populations reared in Bulgaria | |
| Georges | Hypervariable minisatellites and their use in animal breeding | |
| Konfortov et al. | Characterisation of a bovine/murine hybrid cell panel informative for all bovine autosomes | |
| CN113151502B (en) | Genetic marker associated with meat production traits of live pigs and application | |
| CN115044680B (en) | SNP molecular marker related to slaughter traits of meat rabbits as well as detection primer group, detection kit and application thereof | |
| CN114231644A (en) | SNP molecular marker related to spotted deer antler weight character, detection primer, kit and application thereof | |
| Sun Wu et al. | Investigation of NELFE polymorphism and their association with litter size in two Chinese indigenous sheep breeds. | |
| US20120183958A1 (en) | Methods for predicting fat and lean phenotypes in chickens | |
| Hosseini et al. | Research Article Genetic Association of PPARGC1A Gene Single Nucleotide Polymorphism with Milk Production Traits in Italian Mediterranean Buffalo |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |