CN111235046A

CN111235046A - Recombinant yarrowia lipolytica for heterologous synthesis of α -santalene and construction method thereof

Info

Publication number: CN111235046A
Application number: CN202010080980.6A
Authority: CN
Inventors: 卢文玉; 张传波; 贾丹; 魏盼盼
Original assignee: Tianjin University
Current assignee: Tianjin University
Priority date: 2020-02-05
Filing date: 2020-02-05
Publication date: 2020-06-05

Abstract

The invention discloses a recombinant yarrowia lipolytica for heterologous synthesis of α -santalene and a construction method thereof, wherein the construction method comprises the following steps of (1) introducing an optimized α -santalene synthase coding gene STS into yarrowia lipolytica to obtain a recombinant bacterium 1, respectively improving the activities of HMG1, tHMG1, ERG8 and ERG10 on the basis of the recombinant bacterium 1, and improving the yield of α -santalene by the obtained recombinant yarrowia lipolytica for heterologous synthesis of α -santalene, and the method provides a basis for artificial synthesis of α -santalene.

Description

Recombinant yarrowia lipolytica for heterologous synthesis of α -santalene and construction method thereof

Technical Field

The invention relates to the technical field of biology, in particular to recombinant yarrowia lipolytica for heterologous synthesis of α -santalene and a construction method thereof.

Background

The synthetic biology is widely applied to the development and production of medicinal natural compounds, and different types of natural medicines and precursors thereof, such as alkaloid isoquinoline, isochinoside, polyketone 6-deoxyerythronolide B, benzenediol lactone, flavone/stilbene resveratrol, mandelic acid, terpenoid artemisinic acid, lycopene, astaxanthin, β -carotene, tanshinone diene and the like are successfully synthesized in heterologous microbial hosts.

The santalol oil has the main components of rare traditional Chinese medicines and the spice santalol, α -santalene is a sesquiterpene and is a precursor of α -santalol, the santalol contains more than 90% of santalol, the proportion of α - β -santalol is about 2:1, the santalol oil has wide commercial application and can be used for manufacturing fragrance and aromatherapy, the santalol oil has the effects of promoting qi circulation, relieving pain, warming stomach and stopping vomit, researches show that the santalol oil is a chemotherapeutic potential drug (Dwivediet al, 2003) for resisting skin cancer, the main source of the santalol oil is obtained by distilling a Santalum core material, the santalol is a hemiparasitic plant and grows very slowly, the santalol oil grows for tens of years, the plant extraction of the santalol oil not only consumes time and has a price, but also trees can cause damage to the natural environment, the santalol oil (Santalbuman L) is obtained by directly catalyzing santalol precursor of santalol 2-santalol, the santalol precursor of santalol by a yeast, the method, the santalol can be synthesized into a santalol precursor of a high-santalol, and the santalol, the santalol oil can be synthesized by a high-santalol, the direct synthesis method, and the santalol precursor of the sant.

Yarrowia lipolytica, a GRAS (genetic regulated as safe) non-conventional yeast, has been studied to show that it is suitable as a terpenoid production underpan cell, wherein the synthesis of the tetraterpene compound β -carotene is achieved in yarrowia lipolytica and the highest yield of current microbial heterologous synthesis of 4g/L is reached (Shuliang Gao et al, Metabolic Engineering,2017), the sesquiterpene compound α -farnesene is first synthesized in yarrowia lipolytica and yields of 259.98mg/L are achieved (Xiaoan Yang et al, Bioresource Technology,2016), the monoterpene compound limonene also achieves 23.56mg/L in yarrowia lipolytica (Xuan Cao et al Biotechnology for biofuels,2016), however, no synthetic biological methods are used to achieve the synthesis of α -heterologous santalene in yarrowia lipolytica, see also for heterologous yarrowia.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a construction method of recombinant yarrowia lipolytica for heterologous synthesis of α -santalene.

The second objective of the invention is to provide a construction method of a second recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene.

The third objective of the invention is to provide a construction method of a third recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene.

The fourth objective of the invention is to provide a construction method of a fourth recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene.

The fifth objective of the invention is to provide a method for constructing a fifth recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene.

The sixth object of the present invention is to provide a method for constructing the sixth recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene.

The seventh purpose of the invention is to provide the recombinant yarrowia lipolytica for heterologous synthesis of α -santalene constructed by the construction method of the recombinant yarrowia lipolytica for heterologous synthesis of α -santalene.

An eighth object of the present invention is to provide the use of a recombinant yarrowia lipolytica fermentation of the above-described individual heterosynthesization of α -santalene to produce α -santalene.

The technical scheme of the invention is summarized as follows:

a method of constructing a recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene, comprising the steps of:

(1) introducing an optimized α -santalene synthase coding gene STS into Yarrowia lipolytica (Yarrowia lipolytica) ATCC201249 to obtain a recombinant bacterium 1, wherein the nucleotide sequence of the gene STS is shown as SEQ ID NO. 1;

(2) introducing a coding gene HMG1 of 3-hydroxy-3-methylglutaryl coenzyme A reductase into the recombinant bacterium 1 to obtain a recombinant bacterium 2; the nucleotide sequence of the gene HMG1 is shown as SEQ ID NO. 2.

A second method of constructing a recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene, comprising the steps of:

(1) introducing an optimized α -santalene synthase coding gene STS into Yarrowia lipolytica (Yarrowia lipolytica) ATCC201249 to obtain a recombinant bacterium 1, wherein the nucleotide sequence of the gene STS is shown as SEQ ID NO.1, 1500 nucleotides at the 5' end of a coding gene HMG1 of 3-hydroxy-3-methylglutaryl coenzyme A reductase are removed to obtain a truncated coding gene tHMG1 of 3-hydroxy-3-methylglutaryl coenzyme A reductase, the nucleotide sequence of the gene HMG1 is shown as SEQ ID NO.2, and the nucleotide sequence of the gene tHMG1 is shown as SEQ ID NO. 3;

(2) the gene tHMG1 was introduced into recombinant bacterium 1 to obtain recombinant bacterium 3.

A method for constructing a third recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene, comprising the steps of:

(2) introducing an encoding gene ERG8 of phosphomevalonate kinase into the recombinant bacterium 1 to obtain a recombinant bacterium 4; the nucleotide sequence of the gene ERG8 is shown in SEQ ID NO. 4.

A fourth method for constructing a recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene, comprising the steps of:

(2) introducing an acetoacetyl-CoA thiolase encoding gene ERG10 into the recombinant strain 1 to obtain a recombinant strain 5; the nucleotide sequence of the gene ERG10 is shown in SEQ ID NO. 5.

A fifth method for constructing a recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene, comprising the steps of:

(2) introducing a coding gene HMG1 of 3-hydroxy-3-methylglutaryl coenzyme A reductase and a coding gene ERG8 of phosphomevalonate kinase into the recombinant bacterium 1 to obtain a recombinant bacterium 6; the nucleotide sequence of the gene HMG1 is shown as SEQ ID NO. 2; the nucleotide sequence of the gene ERG8 is shown in SEQ ID NO. 4.

A sixth method for constructing a recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene, comprising the steps of:

(2) introducing a gene tHMG1 and a coding gene ERG8 of phosphomevalonate kinase into the recombinant bacterium 1 to obtain a recombinant bacterium 7; the nucleotide sequence of the gene ERG8 is shown in SEQ ID NO. 4.

The recombinant yarrowia lipolytica for heterologous synthesis of α -santalene constructed by the construction method.

Use of the recombinant yarrowia lipolytica fermentation of the above-described heterologous synthesis of α -santalene for the production of α -santalene.

The invention has the advantages that:

experiments prove that the recombinant yarrowia lipolytica for heterologous synthesis of α -santalene obtained by the method improves the yield of α -santalene, and the method provides a basis for artificial synthesis of α -santalene.

Detailed Description

The original strain is yarrowia lipolytica ATCC201249, hereinafter abbreviated as yarrowia lipolytica.

Yarrowia lipolytica (Yarrowia lipolytica)

Purchase time, 2017.6 website https:// www.atcc.org

The present invention will be further illustrated by the following specific examples.

The experimental procedures used in the following examples are all conventional ones unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1, α construction of yarrowia lipolytica recombinant YL-STS of santalene

First, module construction

α -Sandalene synthase coding gene (α -santalene synthase, STS, GenBank: HQ452480) is derived from Chinese wampee (Clausena lansium) and is responsible for codon optimization and total chemical synthesis aiming at yarrowia lipolytica by the Ghan Kimura corporation to obtain an optimized α -Sandalene synthase coding gene, and the nucleotide sequence of the optimized α -Sandalene synthase coding gene is shown as SEQ ID NO. 1;

the promoter TEF1(SEQ ID NO.6), the terminator XPR2(SEQ ID NO.7), rDNA-up (SEQ ID NO.13) and rDNA-down (SEQ ID NO.14) are all from yarrowia lipolytica ATCC201249 genome, and the sequence of the screening marker gene URA3(SEQ ID NO.11) is from yarrowia lipolytica ATCC201249 and is synthesized by a chemical synthesis method by K.K.;

taking yarrowia lipolytica ATCC201249 genome as a template,

rDNA-up is amplified by taking rDNA-up-F (SEQ ID NO.17) and rDNA-up-R-tef (SEQ ID NO.18) as primers;

TEF1p-F-rdnaup (SEQ ID NO.19) and TEF1 p-R-oppST (SEQ ID NO.20) are used as primers to amplify a promoter TEF 1;

opSTS-F-tef (SEQ ID NO.21) and opSTS-R-xpr (SEQ ID NO.22) are used as primers to amplify STS (the nucleotide sequence of the optimized α -santalene synthase coding gene STS is shown as SEQ ID NO. 1);

XPR2 t-F-oppSTS (SEQ ID NO.23) and XPR2t-R-ura (SEQ ID NO.24) are used as primer amplification terminators XPR 2;

URA3 is amplified by using URA-F-xpr (SEQ ID NO.25) and URA-R-rdnadown (SEQ ID NO.26) as primers;

rDNA-down was amplified using rDNA-F-ura (SEQ ID NO.27) and rDNA-down-R (SEQ ID NO.28) as primers.

The PCR enzyme used in the present invention is that of Nanjing NuoZan Biotech Co., Ltd

Max Super-Fidelity polymerase. A50. mu.L PCR amplification system was as follows: DNA template, 1. mu.L; 2 μ L of each of the front lead (10 μ M) and the rear lead (10 μ M); dNTP (10mM), 1. mu.L; 2 × Phanta Max Buffer, 25 μ L;

max Super-Fidelity polymerase, 1 μ L; finally, 50 mu L of double distilled water is used for supplementing. An amplification program is set up on the PCR instrument. The amplification conditions were 95 ℃ pre-denaturation for 4min (1 cycle); denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 15sec, and extension at 72 ℃ for 1min (34 cycles); extension at 72 ℃ for 5min (1 cycle).

The fusion PCR system used in the invention is as follows: the total amount of DNA fragments is 800ng, and the molar ratio is 1: 1; dNTP (10mM), 1. mu.L; 2 × Phanta Max Buffer, 25 μ L;

max Super-Fidelity polymerase, 1 μ L; finally, 50 mu L of double distilled water is used for supplementing. An amplification program is set up on the PCR instrument. The amplification conditions were 95 ℃ pre-denaturation for 4min (1 cycle); denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 30sec, extension at 72 ℃ for 1min (11 cycles), and extension at 72 ℃ for 5min (1 cycle).

Finally obtaining DNA fragments used for transforming yarrowia lipolytica, and respectively connecting with gene STS expression cassette P of upstream homology arm rDNaup_TEF1-STS-T_XPR2And a downstream homology arm URA3-rDNAdown containing the selection marker gene URA 3.

Yarrowia lipolytica transformation

The initial strain yarrowia lipolytica ATCC201249 was cultured in YPD medium for 12 hours, and 300. mu.L of the initial strain was added to 3mL of fresh YPD medium and cultured for 5 hours. Centrifuging at 3000rpm for 5min, collecting thallus, discarding supernatant, and sterilizing with ddH₂The cells were washed with O, centrifuged at 3000rpm for 5min, the cells were collected, and the supernatant was discarded. Then, 1mL of 100mM lithium acetate was added to the cells, the cells were suspended uniformly by gentle pipetting, the cells were left at room temperature for 5min and then centrifuged at 3000rpm at room temperature for 5min, and the cells were collected to prepare yeast competent cells. The transformation mixed system comprises 240 mu L of PEG (50% W/V), 36 mu L of 1.0M lithium acetate and 10 mu L of ss-DNA, and transformation fragments are respectively connected with a gene STS expression cassette P of an upstream homology arm rDNaup_TEF1-STS-T_XPR2And two fragments containing the downstream homology arm URA3-rDNAdown of the selection marker gene URA3, each 400 ng. Finally using sterilized ddH₂The content of O is filled to 360 mu L. Adding the above components into the freshly prepared competent cells of yarrowia lipolytica in sequence, uniformly blowing by using a pipette, placing in a water bath at 42 ℃ for 30min, centrifuging at 4000rpm for 2min, discarding the supernatant, adding 1mL of YPD liquid culture medium, and culturing at 30 ℃ and 220rpm for 2 h. Then centrifuging at 4000rpm for 5min at normal temperature, discarding the supernatant, washing with sterile water for 2 times, finally resuspending the cells with 100 μ L of sterile water, and screening by coating URA-deficient plates. The screening culture condition is 30 ℃, and the culture lasts more than 48 h. And (3) selecting a transformant for overnight culture, extracting a genome, and verifying by pcr to obtain a correct clone of a correct target fragment, namely a strain YL-STS (recombinant bacterium 1).

Example 2 cloning of Gene elements and construction of plasmids containing the corresponding Gene elements

PCR amplification gene element

HMG1, tHMG1, ERG8 and ERG10 were amplified using yarrowia lipolytica ATCC201249 genome as a template and primers shown in Table 1, respectively. And purifying and recovering the gene fragment obtained after amplification for later use.

TABLE 1 PCR amplification Gene primers Table

max Super-Fidelity polymerase, 1 μ L; finally, 50 mu L of double distilled water is used for supplementing. An amplification program is set up on the PCR instrument. The amplification conditions were 95 ℃ pre-denaturation for 4min (1 cycle); denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 15sec, and extension at 7 ℃ for 1min (34 cycles); extension at 72 ℃ for 5min (1 cycle).

Second, pHMG1 plasmid construction

The PmlI enzyme cuts the plasmid pINA1269 (general Tatin biotechnology (Beijing) Co., Ltd.), and the fragment is purified and recovered to be about 7259 bp.

The plasmid was constructed using a one-step cloning kit of Nanjing Novozam Biotechnology Co., Ltd, and a reaction system shown in the following table was prepared in an ice-water bath.

TABLE 2 pHMG1 plasmid construction reaction System

After the system is prepared, a micro liquid transfer gun is used for gentle blowing and even mixing. The reaction mixture was left at 37 ℃ for 30 min. Immediately thereafter, the reaction was cooled in an ice-water bath for 5 min.

Chemical transformation method (Heat shock method) of competent cells of Escherichia coli

1. Taking out the Trans5 α chemical competent cell finished product from a refrigerator at the temperature of-80 ℃, placing the finished product in an ice box for thawing for 10min, and sucking 50 mu L of bacterial liquid into a sterilized 1.5ml PE centrifuge tube under the aseptic environment;

2. adding 5 mu L of recombinant system solution into a centrifuge tube, gently mixing uniformly, and placing in an ice box for 30 min;

3. taking out the centrifugal tube from the ice box, thermally shocking in a constant-temperature water bath at 42 ℃ for 30sec, taking out and immediately placing in the ice box for 2 min; 4. adding 500 mu L of sterilized LB liquid culture medium into a centrifuge tube, and putting the centrifuge tube into a shaking table with the set conditions of 37 ℃ and 200rpm for resuscitation for 1 h;

5. centrifuging for 3min under 4000rmp, sucking out 350 μ L of supernatant, collecting and resuspending thallus;

6. the bacterial liquid was spread on LB plate medium containing antibiotic Amp under aseptic conditions, and cultured overnight in an incubator at 37 ℃ by inversion.

The colony PCR of the transformant is selected for verification, the obtained correct target fragment is the correct transformant, and the plasmid which is verified to be correct by single enzyme digestion of the plasmid PmlI is extracted and named as the correct plasmid pHMG 1.

Plasmid construction of ptHMG1, pERG8 and pERG10

The amplified tHMG1, ERG8 and ERG10 gene fragments are respectively recombined with pINA1269 plasmid after PmlI linearization by utilizing a one-step cloning kit by utilizing the same method of the second pHMG1 plasmid construction, and correct recombinant plasmids are obtained after escherichia coli transformation, transformant verification and plasmid enzyme digestion verification extraction and are respectively named as ptHMG1, pERG8 and pERG 10.

Example 3 construction of recombinant yarrowia lipolytica YL-STS-01 (recombinant 2)

The BsrGI single-restriction enzyme plasmid pHMG1 was used to purify and recover a linearized plasmid fragment (containing the expression cassette P) of about 10259bp_hp4d-HMG1-T_XPR2)。

The same procedure as in example 1 was followed to prepare YL-STS competent cells and transform them into linearized pHMG1, which was then cultured in LEU and URA-deficient medium to obtain transformants. The screening culture condition is 30 ℃, the culture is carried out for more than 48h, a transformant is selected for overnight culture, a genome is extracted, and check primers are used for verifying to obtain a correct target fragment which is a correct clone and is named as a strain YL-STS-01 (recombinant strain 2), the nucleotide sequence of the gene STS is shown as SEQ ID NO.1, and the nucleotide sequence of the gene HMG1 is shown as SEQ ID NO. 2.

Example 4 construction of recombinant yarrowia lipolytica YL-STS-02 (recombinant 3) to YL-STS-04 (recombinant 5)

The plasmids ptHMG1, pERG8 and pERG10 were digested with BsrGI single enzyme, and the linearized plasmid fragment of about 10259bp was purified and recovered.

The same procedure as in example 1 was followed to prepare YL-STS competent cells and transform them into linearized pHMG1, which was then cultured in LEU and URA-deficient medium to obtain transformants. The screening culture condition is 30 ℃, the culture is carried out for more than 48h, a transformant is selected for overnight culture, a genome is extracted, and check primers are used for verifying to obtain correct target fragments which are named as correct clones, namely strains YL-STS-02 (recombinant strain 3), YL-STS-03 (recombinant strain 4) and YL-STS-04 (recombinant strain 5).

The nucleotide sequence of the gene tHMG1 is shown as SEQ ID NO. 3; the nucleotide sequence of the gene ERG8 is shown in SEQ ID NO. 4; the nucleotide sequence of the gene ERG10 is shown in SEQ ID NO. 5.

Example 5 construction of recombinant yarrowia lipolytica YL-STS-05 (recombinant 6) and YL-STS-06 (recombinant 7)

The promoters FBAIN (SEQ ID NO.8), GPD1(SEQ ID NO. 9); terminator XPR2(SEQ ID NO.7), CYC1(SEQ ID NO.10), zeta DNA-up (SEQ ID NO.15), zeta DNA-down (SEQ ID NO.16) are all from yarrowia lipolytica ATCC201249 genome, and screening marker gene LEU2(SEQ ID NO.12) sequence is from yarrowia lipolytica ATCC201249, and is synthesized by a chemical synthesis method by K.K. Bioengineering Ltd;

zeta DNA-up, 3-hydroxy-3-methylglutaryl coenzyme A reductase coding gene expression box P of upstream homologous arm of the zeta DNA site_FBAIN-HMG1-T_XPR2tExpression cassette P for mevalonate phosphokinase coding Gene_GPD1p-ERG8-T_CYC1tAnd the zeta DNA site downstream homology arm LEU 2-zeta DNA-down containing the selection marker gene A was prepared by the method described in example 7; the primer sequences of FBAIN fragment are (SEQ ID NO.37) and (SEQ ID NO.38), the primer sequences of GPD1 are (SEQ ID NO.39) and (SEQ ID NO.40),the primer sequences of XPR2 are (SEQ ID NO.41) and (SEQ ID NO.42), that of CYC1 are (SEQ ID NO.43) and (SEQ ID NO.44), that of ERG8 are (SEQ ID NO.45) and (SEQ ID NO.46), that of HMG1 is (SEQ ID NO.47) and (SEQ ID NO.48), that of the LEU fragment is (SEQ ID NO.49) and (SEQ ID NO.50), and that of zeta-UP DNAand zeta-DNAdown are (SEQ ID NO.51) and (SEQ ID NO.52), (SEQ ID NO.53) and (SEQ ID NO.54), respectively.

max Super-Fidelity polymerase, 1 μ L; finally, the solution is replenished to 50 mu L by double distilled water. An amplification program is set up on the PCR instrument. The amplification conditions were 95 ℃ pre-denaturation for 4min (1 cycle); denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 30sec, extension at 72 ℃ for 1min (11 cycles), and extension at 72 ℃ for 5min (1 cycle).

Finally obtaining DNA fragments used for transforming yarrowia lipolytica, respectively connecting with gene expression cassettes P of upstream homology arm rDNaup_FBAIN-HMG1-T_XPR2tAnd expression cassette P_GPD1p-ERG8-T_CYC1tThe downstream homology arm URA3-rDNA-down of rDNA locus containing screening marker gene LEU 2;

using the same yeast transformation method as in example 1, HMG1 expression cassettes P for genes HMG1 ligated respectively with upstream homology arms ζ DNUp were transformed_FBAIN-HMG1-T_XPR2tERG8 expression cassette P_GPD1p-ERG8-T_CYC1tAnd 400ng each of the four fragments of the homology arm LEU 2-zeta DNA-down downstream of the zeta DNA site containing the selection marker gene LEU 2. Culturing on a LEU-deleted yeast synthetic culture medium, selecting a culture condition of culturing at 30 ℃ for more than 48h, selecting a transformant for overnight culture, extracting a genome, verifying by pcr to obtain correct clones of all correct target fragments, and naming the correct clones as a strain YL-STS-05 (recombinant strain 6).

Using the same method as in example 5 above, the gene tHMG1 expression cassette P linked respectively to the upstream homology arms ζ DNUp was transformed_FBAIN-tHMG1-T_XPR2tERG8 expression cassette P_GPD1p-ERG8-T_CYC1tAnd 400ng each of the four fragments of the homology arm LEU 2-zeta DNA-down downstream of the zeta DNA site containing the selection marker gene LEU 2. Culturing on a LEU-deleted yeast synthetic culture medium, selecting a culture condition of culturing at 30 ℃ for more than 48h, selecting a transformant for overnight culture, extracting a genome, verifying by pcr to obtain correct clones of all correct target fragments, and naming the correct clones as a strain YL-STS-06 (recombinant strain 7).

Example 6 recombinant production of α -Sandalkene

1. Recombinant bacterium culture and product extraction

The recombinant yarrowia lipolytica strains YL-STS, YL-STS-01, YL-STS-02, YL-STS-03, YL-STS-04, YL-STS-05, YL-STS-06, and ATCC201249 obtained in examples 1, 2, 4, and 5 were activated on solid screening media; fermentation seed solutions were prepared in YPD liquid medium (30 ℃ C., 220rmp, 16 hours), and the cells were collected by centrifugation, transferred to a 250mL Erlenmeyer flask containing 30mL YPD fermentation medium, and cultured while adjusting OD to 0.5 (30 ℃ C., 220 rmp). Centrifuging after 6d, collecting cells, adding acetone, performing ultrasonic disruption in ice water bath for 10min, centrifuging at 12000rpm at normal temperature for 2min, and collecting supernatant and passing through 0.22mm organic membrane for use.

2. GC-MS identification α -santalene

α -qualitative and quantitative determination of santalene is carried out by GC-MS, the quantitative determination of α -santalene uses a-lupalene as an internal standard, the relative response factor RRF is 1, the detection conditions of GC-MS are that a chromatographic column Rxi-1HT, nitrogen flow rate is 1.2mL/min, sample inlet temperature is 250 ℃, an FID detector is 250 ℃, no-flow sampling is carried out, sample inlet amount is 1 muL, the temperature program in a furnace is that the initial temperature is 80 ℃, the initial temperature is maintained for 1min, 10 ℃/min is increased to 120 ℃, 3 ℃/min is increased to 160 ℃, 10 ℃/min is increased to 270 ℃, the temperature is maintained for 270 ℃, and the ion scanning range is 40-500 m/z.

3. Results

Yarrowia lipolytica ATCC201249 did not synthesize α -santalene.

And (3) detecting an extracted product of YL-STS (recombinant bacteria 1) by GC-MS, wherein the mass spectrum of the extracted product of the recombinant bacteria 1 is the same as that of the α -santalene standard library, and the result shows that α -santalene exists in the extracted product of the recombinant bacteria 1.

The result shows that the YL-STS (recombinant bacterium 1) α -santalene fermentation yield reaches 5.19 mg/L.

Based on YL-STS, recombinant bacteria for improving the yield of a target product α -santalene are obtained by up-regulating the expression of HMG1, tHMG1, ERG8 and ERG10 genes in yarrowia lipolytica, the yield of each recombinant bacteria after fermentation for 6 days is shown in Table 3, and the data listed in the table are averaged by three parallel experiments.

TABLE 3 yield of engineering bacteria α -santalene

Engineered bacterial strains	Up-regulated gene	STS yield (mg/L)
			YL-STS-01 (recombinant bacterium 2)	HMG1	7.49
YL-STS-02 (recombinant bacterium 3)	tHMG1	6.71
			YL-STS-03 (recombinant bacterium 4)	ERG8	5.93
YL-STS-04 (recombinant bacterium 5)	ERG10	6.20
			YL-STS-05 (recombinant bacterium 6)	HMG1、ERG8	9.43
YL-STS-6 (recombinant bacterium 7)	tHMG1、ERG8	8.42

Sequence listing

<110> Tianjin university

<120> recombinant yarrowia lipolytica for heterologous synthesis of α -santalene and construction method thereof

<160>54

<170>SIPOSequenceListing 1.0

<210>1

<211>1656

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgtcaactc aacaagtttc atcagagaac attgttcgta acgctgcgaa tttccatcct 60

aatatatggg gaaaccattt cctcacatgt ccttctcaga cgattgatag ttggactcaa 120

cagcaccaca aagaactgaa agaagaggtg aggaaaatga tggtgtctga tgcaaataaa 180

cctgcccaga gattgcgctt gattgatact gtccaaaggc taggtgtggc ttaccacttt 240

gaaaaggaga ttgatgatgc attggagaaa ataggtcatg acccttttga tgataaagat 300

gatctctaca ttgtctctct ttgttttcga ttgctgaggc agcatggaat taagatatca 360

tgtgatgtgt ttgagaagtt taaagatgac gatggaaaat tcaaggcatc attgatgaat 420

gatgttcaag gcatgctaag tttatatgag gcagcacacc tagccattca cggagaagat 480

attttagatg aagcaattgt tttcacgacc actcacctta agtcaacggt atctaattct 540

cctgtaaact ctacttttgc tgaacaaata cgtcattctc tcagagttcc tctccgtaaa 600

gctgtaccta ggttagagtc gaggtatttc ttggatatct attcaagaga tgatttgcac 660

gataaaactt tgctcaattt cgcaaagtta gactttaata tactacaagc aatgcaccag 720

aaggaagcaa gtgagatgac caggtggtgg agagattttg acttccttaa aaagctgcct 780

tatataagag acagagtcgt ggagctatat ttttggattc tggtgggagt gtcttatcag 840

cccaaattca gcactggtag aatttttttg tccaaaataa tatgccttga gaccctcgta 900

gatgatacat ttgacgccta cggtactttt gacgagctcg caatctttac tgaagcagtt 960

acaagatggg accttggcca cagagatgca ctaccagaat acatgaaatt cattttcaag 1020

acactcattg atgtctacag tgaagctgag caagaactgg caaaggaagg gagatcatac 1080

agcatacact atgcaatacg atcgttccaa gaactagtta tgaagtactt ctgcgaagcc 1140

aagtggttaa ataaaggtta tgttccgagc ctggacgatt ataaatcagt ttcattaaga 1200

agtatcggtt ttttaccgat agcggtagct tccttcgttt tcatgggtga tattgcaact 1260

aaggaggtct ttgaatggga aatgaataac cctaagatca taatagccgc agaaacgatt 1320

ttcagattcc tggatgacat agcaggccat aggtttgagc aaaagagaga acatagtcca 1380

tcagctattg aatgctacaa gaatcaacat ggagtgtctg aggaagaggc agttaaagcg 1440

ttgtcgttag aagttgctaa tagttggaaa gatataaatg aggagctgct tctcaaccca 1500

atggctattc ctttacctct gcttcaggtg attcttgatc tctcacgttc ggccgatttt 1560

atgtacggta atgctcaaga tcgcttcacg cattcaacga tgatgaaaga ccaagttgat 1620

ttggtgctga aggaccccgt taagcttgac gattaa 1656

<210>2

<211>3000

<212>DNA

<213> Yarrowia lipolytica

<400>2

atgctacaag cagctattgg aaagattgtg ggatttgcgg tcaaccgacc catccacaca 60

gttgtcctga cgtccatcgt ggcgtcaacc gcatacctcg ccatcctcga cattgccatc 120

ccgggtttcg agggcacaca acccatctca tactaccacc ctgcagcaaa atcttacgac 180

aaccctgctg attggaccca cattgcagag gccgacatcc cttcagacgc ctaccgactt 240

gcatttgccc agatccgtgt cagtgatgtt cagggcggag aggcccccac catccctggc 300

gccgtggccg tgtctgatct cgaccacaga atcgtcatgg actacaaaca gtgggccccc 360

tggaccgcca gcaacgagca gatcgcctcg gagaaccaca tctggaagca ctccttcaag 420

gaccacgtgg ccttcagctg gatcaagtgg ttccgatggg cctacctgcg tttgtccact 480

ctcatccagg gggcagacaa cttcgacatt gccgtggtcg cccttggcta tcttgccatg 540

cactacacct tcttcagtct cttccgatcc atgcgaaagg ttggctcgca cttttggctt 600

gcctccatgg ctctggtctc ttccaccttc gctttcctgc ttgcggtggt ggcttcctct 660

agcctgggtt accgacctag catgatcacc atgtccgagg gcctgccctt cctcgtggtc 720

gccattggct ttgaccgaaa ggtcaacctg gctagcgagg tgctcacatc caagagcagc 780

cagctcgctc ccatggtgca ggtgatcaca aagatcgcct ccaaggcgct gtttgagtac 840

agccttgagg tggccgccct gtttgctggc gcctataccg gagttcctcg actgtcccag 900

ttttgcttct tatctgcttg gatcctcatc ttcgactaca tgtttttgct gaccttctac 960

tctgctgtcc ttgctatcaa gtttgagatc aatcacatta agcgaaaccg aatgatccag 1020

gatgctctca aggaggatgg tgtatctgct gctgttgccg agaaggtagc cgactcttct 1080

cccgacgcca agctcgaccg aaagtccgac gtttctcttt ttggagcctc tggcgccatt 1140

gcggtgttca agatcttcat ggtccttggg ttccttggtc tcaacctcat caacctgact 1200

gccatccctc accttggcaa ggcggccgcc gctgcccagt ctgtgactcc catcaccctc 1260

tcccccgagc ttctccatgc catccccgcc tctgtgcccg ttgttgtcac ctttgtgccc 1320

agcgttgtgt acgagcactc ccagctcatt ctgcagctgg aggacgccct cactaccttc 1380

ctggctgcct gctccaaaac tattggtgac cccgtcatct ccaagtacat cttcctgtgc 1440

ctgatggtct ccaccgccct gaacgtctac ctgtttggag ccacccgaga agttgtgcga 1500

acccagtctg tgaaggtggt tgagaagcac gttcctatcg tcattgagaa gcccagcgag 1560

aaggaggagg acacctcttc tgaagactcc attgagctga ctgtcggaaa gcagcccaag 1620

cccgtgaccg agacccgttc tctggacgac ctagaggcta tcatgaaggc aggtaagacc 1680

aagcttctgg aggaccacga ggttgtcaag ctctctctcg agggcaagct tcctttgtat 1740

gctcttgaga agcagcttgg tgacaacacc cgagctgttg gcatccgacg atctatcatc 1800

tcccagcagt ctaataccaa gactttagag acctcaaagc ttccttacct gcactacgac 1860

tacgaccgtg tttttggagc ctgttgcgag aacgttattg gttacatgcc tctccccgtt 1920

ggtgttgctg gccccatgaa cattgatggc aagaactacc acattcctat ggccaccact 1980

gagggttgtc ttgttgcctc aaccatgcga ggttgcaagg ccatcaacgc cggtggcggt 2040

gttaccactg tgcttactca ggacggtatg acacgaggtc cttgtgtttc cttcccctct 2100

ctcaagcggg ctggagccgc taagatctgg cttgattccg aggagggtct caagtccatg 2160

cgaaaggcct tcaactccac ctctcgattt gctcgtctcc agtctcttca ctctaccctt 2220

gctggtaacc tgctgtttat tcgattccga accaccactg gtgatgccat gggcatgaac 2280

atgatctcca agggcgtcga acactctctg gccgtcatgg tcaaggagta cggcttccct 2340

gatatggaca ttgtgtctgt ctcgggtaac tactgcactg acaagaagcc cgcagcgatc 2400

aactggatcg aaggccgagg caagagtgtt gttgccgaag ccaccatccc tgctcacatt 2460

gtcaagtctg ttctcaaaag tgaggttgac gctcttgttg agctcaacat cagcaagaat 2520

ctgatcggta gtgccatggc tggctctgtg ggaggtttca atgcacacgc cgcaaacctg 2580

gtgaccgcca tctaccttgc cactggccag gatcctgctc agaatgtcga gtcttccaac 2640

tgcatcacgc tgatgagcaa cgtcgacggt aacctgctca tctccgtttc catgccttct 2700

atcgaggtcg gtaccattgg tggaggtact attttggagc cccagggggc tatgctggag 2760

atgcttggcg tgcgaggtcc tcacatcgag acccccggtg ccaacgccca acagcttgct 2820

cgcatcattg cttctggagt tcttgcagcg gagctttcgc tgtgttctgc tcttgctgcc 2880

ggccatcttg tgcaaagtca tatgacccac aaccggtccc aggctcctac tccggccaag 2940

cagtctcagg ccgatctgca gcgtctacaa aacggttcga atatttgcat acggtcatag 3000

<210>3

<211>1503

<212>DNA

<213> Yarrowia lipolytica

<400>3

atgacccagt ctgtgaaggt ggttgagaag cacgttccta tcgtcattga gaagcccagc 60

gagaaggagg aggacacctc ttctgaagac tccattgagc tgactgtcgg aaagcagccc 120

aagcccgtga ccgagacccg ttctctggac gacctagagg ctatcatgaa ggcaggtaag 180

accaagcttc tggaggacca cgaggttgtc aagctctctc tcgagggcaa gcttcctttg 240

tatgctcttg agaagcagct tggtgacaac acccgagctg ttggcatccg acgatctatc 300

atctcccagc agtctaatac caagacttta gagacctcaa agcttcctta cctgcactac 360

gactacgacc gtgtttttgg agcctgttgc gagaacgtta ttggttacat gcctctcccc 420

gttggtgttg ctggccccat gaacattgatggcaagaact accacattcc tatggccacc 480

actgagggtt gtcttgttgc ctcaaccatg cgaggttgca aggccatcaa cgccggtggc 540

ggtgttacca ctgtgcttac tcaggacggt atgacacgag gtccttgtgt ttccttcccc 600

tctctcaagc gggctggagc cgctaagatc tggcttgatt ccgaggaggg tctcaagtcc 660

atgcgaaagg ccttcaactc cacctctcga tttgctcgtc tccagtctct tcactctacc 720

cttgctggta acctgctgtt tattcgattc cgaaccacca ctggtgatgc catgggcatg 780

aacatgatct ccaagggcgt cgaacactct ctggccgtca tggtcaagga gtacggcttc 840

cctgatatgg acattgtgtc tgtctcgggt aactactgca ctgacaagaa gcccgcagcg 900

atcaactgga tcgaaggccg aggcaagagt gttgttgccg aagccaccat ccctgctcac 960

attgtcaagt ctgttctcaa aagtgaggtt gacgctcttg ttgagctcaa catcagcaag 1020

aatctgatcg gtagtgccat ggctggctct gtgggaggtt tcaatgcaca cgccgcaaac 1080

ctggtgaccg ccatctacct tgccactggc caggatcctg ctcagaatgt cgagtcttcc 1140

aactgcatca cgctgatgag caacgtcgac ggtaacctgc tcatctccgt ttccatgcct 1200

tctatcgagg tcggtaccat tggtggaggt actattttgg agccccaggg ggctatgctg 1260

gagatgcttg gcgtgcgagg tcctcacatc gagacccccg gtgccaacgc ccaacagctt 1320

gctcgcatca ttgcttctgg agttcttgca gcggagcttt cgctgtgttc tgctcttgct 1380

gccggccatc ttgtgcaaag tcatatgacc cacaaccggt cccaggctcc tactccggcc 1440

aagcagtctc aggccgatct gcagcgtcta caaaacggtt cgaatatttg catacggtca 1500

tag 1503

<210>4

<211>1257

<212>DNA

<213> Yarrowia lipolytica

<400>4

atgaccacct attcggctcc gggaaaggcc ctcctttgcg gcggttattt ggttattgat 60

ccggcgtatt cagcatacgt cgtgggcctc tcggcgcgta tttacgcgac agtttcggct 120

tccgaggcct ccaccacctc tgtccatgtc gtctctccgc agtttgacaa gggtgaatgg 180

acctacaact acacgaacgg ccagctgacg gccatcggac acaacccatt tgctcacgcg 240

gccgtcaaca ccgttctgca ttacgttcct cctcgaaacc tccacatcaa catcagcatc 300

aaaagtgaca acgcgtacca ctcgcaaatt gacagcacgc agagaggcca gtttgcatac 360

cacaaaaagg cgatccacga ggtgcctaaa acgggcctcg gtagctccgc tgctcttacc 420

accgttcttg tggcagcttt gctcaagtca tacggcattg atcccttgca taacacccac 480

ctcgttcaca acctgtccca ggttgcacac tgctcggcac agaagaagat tgggtctgga 540

tttgacgtgg cttcggccgt ttgtggctct ctagtctata gacgtttccc ggcggagtcc 600

gtgaacatgg tcattgcagc tgaagggacc tccgaatacg gggctctgtt gagaactacc 660

gttaatcaaa agtggaaggt gactctggaa ccatccttct tgccgccggg aatcagcctg 720

cttatgggag acgtccaggg aggatctgag actccaggta tggtggccaa ggtgatggca 780

tggcgaaaag caaagccccg agaagccgag atggtgtgga gagatctcaa cgctgccaac 840

atgctcatgg tcaagttgtt caacgacctg cgcaagctct ctctcactaa caacgaggcc 900

tacgaacaac ttttggccga ggctgctcct ctcaacgctc taaagatgat aatgttgcag 960

aaccctctcg gagaactagc acgatgcatt atcactattc gaaagcatct caagaagatg 1020

acacgggaga ctggtgctgc tattgagccg gatgagcagt ctgcattgct caacaagtgc 1080

aacacttata gtggagtcat tggaggtgtt gtgcctggag caggaggcta cgatgctatt 1140

tctcttctgg tgatcagctc tacggtgaac aatgtcaagc gagagagcca gggagtccaa 1200

tggatggagc tcaaggagga gaacgagggt ctgcggctcg agaaggggtt caagtag 1257

<210>5

<211>1179

<212>DNA

<213> Yarrowia lipolytica

<400>5

atggagcccg tctacattgt ttctactgct cgaaccccca ttggttcttt tctgagctcg 60

ctgagcggcc agacctacgt ggatctggga gcccatgccg tgaaggccgc actcgccaag 120

accgacatca agcccgacca ggtcgacgag atcatcttcg gtaacgttct ctccgccggc 180

gtcggacagg cccctgctcg acaggttgcc ctcaaggctg gtctccctga caccattgtc 240

gctaccaccg tcaacaaggt ctgtgcctcc ggtatgaagg ccatcatcca gggtgcccag 300

gccatcatga ccggatctgc cgacattgtc attgctggcg gtgccgagtc catgtccaac 360

gtgccccact acgtgcaggc ccgtgtcgct aacaagtacg gcaacggctc tctggtcgac 420

ggtatccagc gagacggtct gtttgacgcc tacgatggcc aggccatggg tgtggccgct 480

gaggtctgtg ctgacaccca ctccatctcc cgagaggagc aggacgagtt tgccattggc 540

tcttacaaga agacccaggc tgcctatgcc gccggcaagt ttaaggacga gattgccccc 600

attgagctgc ccggcttccg aggcaagcct ggtgtcgttg tctccgagga cgaggagtac 660

aagaacctca acgaggacaa gctcaagtct gcccgaactg tttttaagaa ggacggtacc 720

gtgactgccc ccaacgcctc ccctatcaac gacggtggag ctgccgtcat tctggcctct 780

gctgccaagg tcaaggagct tggtcttaag cccctgctca agattgtctc ttggggcgag 840

gctgccaacg agcccgtcaa gttcaccact gctcccgctc tggccgtccc cgttgccctc 900

aagcgagctg gtctcgaggc caaggacatt gacttttacg agttcaacga ggccttctct 960

gttgttggta tcgccaacac caagctgctt ggtctggact ccagcaaggt caacgtctac 1020

ggaggtgctg ttgccattgg tcaccctctg ggctgctctg gtgcccgagt cattgtcact 1080

ctcaactctg ttctgcacca ggaaggcggc aagtacggat gtgctgccat ctgcaacggt 1140

ggtggtggcg cttcctctat cattgttgag aagtgttag 1179

<210>6

<211>406

<212>DNA

<213> Yarrowia lipolytica

<400>6

agagaccggg ttggcggcgt atttgtgtcc caaaaaacag ccccaattgc cccaattgac 60

cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttcacc ccacatatca 120

aacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta 180

cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac 240

gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa 300

aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca 360

cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaa 406

<210>7

<211>411

<212>DNA

<213> Yarrowia lipolytica

<400>7

cctgtcccca cgttgccggt cttgcctcct actacctgtc catcaatgac gaggttctca 60

cccctgccca ggtcgaggct cttattactg agtccaacac cggtgttctt cccaccacca 120

acctcaaggg ctctcccaac gctgttgcct acaacggtgt tggcatttag gcaattaaca 180

gatagtttgc cggtgataat tctcttaacc tcccacactc ctttgacata acgatttatg 240

taacgaaact gaaatttgac cagatattgt tgtaaataga aaatctggct tgtaggtggc 300

aaaatcccgt ctttgttcat caattccctc tgtgactact cgtcatccct ttatgttcga 360

ctgtcgtatt tttattttcc atacatacgc aagtgagatg cccgtgtccg a 411

<210>8

<211>998

<212>DNA

<213> Yarrowia lipolytica

<400>8

aacagtgtac gcagtactat agaggaacaa ttgccccgga gaagacggcc aggccgccta 60

gatgacaaat tcaacaactc acagctgact ttctgccatt gccactaggg gggggccttt 120

ttatatggcc aagccaagct ctccacgtcg gttgggctgc acccaacaat aaatgggtag 180

ggttgcacca acaaagggat gggatggggg gtagaagata cgaggataac ggggctcaat 240

ggcacaaata agaacgaatactgccattaa gactcgtgat ccagcgactg acaccattgc 300

atcatctaag ggcctcaaaa ctacctcgga actgctgcgc tgatctggac accacagagg 360

ttccgagcac tttaggttgc accaaatgtc ccaccaggtg caggcagaaa acgctggaac 420

agcgtgtaca gtttgtctta gcaaaaagtg aaggcgctga ggtcgagcag ggtggtgtga 480

cttgttatag cctttagagc tgcgaaagcg cgtatggatt tggctcatca ggccagattg 540

agggtctgtg gacacatgtc atgttagtgt acttcaatcg ccccctggat atagccccga 600

caataggccg tggcctcatt tttttgcctt ccgcacattt ccattgctcg gtacccacac 660

cttgcttctc ctgcacttgc caaccttaat actggtttac attgaccaac atcttacaag 720

cggggggctt gtctagggta tatataaaca gtggctctcc caatcggttg ccagtctctt 780

ttttcctttc tttccccaca gattcgaaat ctaaactaca catcacacaa tgcctgttac 840

tgacgtcctt aagcgaaagt ccggtgtcat cgtcggcgac gatgtccgag ccgtgagtat 900

ccacgacaag atcagtgtcg agacgacgcg ttttgtgtaa tgacacaatc cgaaagtcgc 960

tagcaacaca cactctctac acaaactaac ccagctct 998

<210>9

<211>931

<212>DNA

<213> Yarrowia lipolytica

<400>9

cgcagtagga tgtcctgcac gggtcttttt gtggggtgtg gagaaagggg tgcttggaga 60

tggaagccgg tagaaccggg ctgcttgggg ggatttgggg ccgctgggct ccaaagaggg 120

gtaggcattt cgttggggtt acgtaattgc ggcatttggg tcctgcgcgc atgtcccatt 180

ggtcagaatt agtccggata ggagacttat cagccaatca cagcgccgga tccacctgta 240

ggttgggttg ggtgggagca cccctccaca gagtagagtc aaacagcagc agcaacatga 300

tagttggggg tgtgcgtgtt aaaggaaaaa aaaagaagct tgggttatat tcccgctcta 360

tttagaggtt gcgggataga cgccgacgga gggcaatggc gccatggaac cttgcggata 420

tcgatacgcc gcggcggact gcgtccgaac cagctccagc agcgtttttt ccgggccatt 480

gagccgactg cgaccccgcc aacgtgtctt ggcccacgca ctcatgtcat gttggtgttg 540

ggaggccact ttttaagtag cacaaggcac ctagctcgca gcaaggtgtc cgaaccaaag 600

aagcggctgc agtggtgcaa acggggcgga aacggcggga aaaagccacg ggggcacgaa 660

ttgaggcacg ccctcgaatt tgagacgagt cacggcccca ttcgcccgcg caatggctcg 720

ccaacgcccg gtcttttgca ccacatcagg ttaccccaag ccaaaccttt gtgttaaaaa 780

gcttaacata ttataccgaa cgtaggtttg ggcgggcttg ctccgtctgt ccaaggcaac 840

atttatataa gggtctgcat cgccggctca attgaatctt ttttcttctt ctcttctcta 900

tattcattct tgaattaaac acacatcaac a 931

<210>10

<211>251

<212>DNA

<213> Yarrowia lipolytica

<400>10

atcatgtaat tagttatgtc acgcttacat tcacgccctc ctcccacatc cgctctaacc 60

gaaaaggaag gagttagaca acctgaagtc taggtcccta tttatttttt ttaatagtta 120

tgttagtatt aagaacgtta tttatatttc aaatttttct tttttttctg tacaaacgcg 180

tgtacgcatg taacattata ctgaaaacct tgcttgagaa ggttttggga cgctcgaagg 240

ctttaatttg c 251

<210>11

<211>1907

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ggtgtgttct gtggagcatt ctcacttttg gtaaacgaca ttgcttcaag tgcagcggaa 60

tcaaaaagta taaagtgggc agcgagtata cctgtacaga ctgtaggcga taactcaatc 120

caattacccc ccacaacatg actggccaaa ctgatctcaa gactttattg aaatcagcaa 180

caccgattct caatgaaggc acatacttct tctgcaacat tcacttgacg cctaaagttg 240

gtgagaaatg gaccgacaag acatattctg ctatccacgg actgttgcct gtgtcggtgg 300

ctacaatacg tgagtcagaa gggctgacgg tggtggttcc caaggaaaag gtcgacgagt 360

atctgtctga ctcgtcattg ccgcctttgg agtacgactc caactatgag tgtgcttgga 420

tcactttgac gatacattct tcgttggagg ctgtgggtct gacagctgcg ttttcggcgc 480

ggttggccga caacaatatc agctgcaacg tcattgctgg ctttcatcat gatcacattt 540

ttgtcggcaa aggcgacgcc cagagagcca ttgacgttct ttctaatttg gaccgatagc 600

cgtatagtcc agtctatcta taagttcaac taactcgtaa ctattaccat aacatatact 660

tcactgcccc agataaggtt ccgataaaaa gttctgcaga ctaaatttat ttcagtctcc 720

tcttcaccac caaaatgccc tcctacgaag ctcgagctaa cgtccacaag tccgcctttg 780

ccgctcgagt gctcaagctc gtggcagcca agaaaaccaa cctgtgtgct tctctggatg 840

ttaccaccac caaggagctc attgagcttg ccgataaggt cggaccttat gtgtgcatga 900

tcaagaccca tatcgacatc attgacgact tcacctacgc cggcactgtg ctccccctca 960

aggaacttgc tcttaagcac ggtttcttcc tgttcgagga cagaaagttc gcagatattg 1020

gcaacactgt caagcaccag tacaagaacg gtgtctaccg aatcgccgag tggtccgata 1080

tcaccaacgc ccacggtgta cccggaaccg gaatcattgc tggcctgcga gctggtgccg 1140

aggaaactgt ctctgaacag aagaaggagg acgtctctga ctacgagaac tcccagtaca 1200

aggagttcct ggtcccctct cccaacgaga agctggccag aggtctgctc atgctggccg 1260

agctgtcttg caagggctct ctggccactg gcgagtactc caagcagacc attgagcttg 1320

cccgatccga ccccgagttt gtggttggct tcattgccca gaaccgacct aagggcgact 1380

ctgaggactg gcttattctg acccccgggg tgggtcttga cgacaaggga gacgctctcg 1440

gacagcagta ccgaactgtt gaggatgtca tgtctaccgg aacggatatc ataattgtcg 1500

gccgaggtct gtacggccag aaccgagatc ctattgagga ggccaagcga taccagaagg 1560

ctggctggga ggcttaccag aagattaact gttagaggtt agactatgga tatgtaattt 1620

aactgtgtat atagagagcg tgcaagtatg gagcgcttgt tcagcttgta tgatggtcag 1680

acgacctgtc tgatcgagta tgtatgatac tgcacaacct gtgtatccgc atgatctgtc 1740

caatggggca tgttgttgtg tttctcgata cggagatgct gggtacaagt agctaatacg 1800

attgaactac ttatacttat atgaggcttg aagaaagctg acttgtgtat gacttattct 1860

caactacatc cccagtcaca ataccaccac tgcactacca ctacacc 1907

<210>12

<211>2347

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gaattccgtc gtcgcctgag tcatcattta tttaccagtt ggccacaaac ccttgacgat 60

ctcgtatgtc ccctccgaca tactcccggc cggctggggt acgttcgata gcgctatcgg 120

catcgacaag gtttgggtcc ctagccgata ccgcactacc tgagtcacaa tcttcggagg 180

tttagtcttc cacatagcac gggcaaaagt gcgtatatat acaagagcgt ttgccagcca 240

cagattttca ctccacacac cacatcacac atacaaccac acacatccac aatggaaccc 300

gaaactaaga agaccaagac tgactccaag aagattgttc ttctcggcgg cgacttctgt 360

ggccccgagg tgattgccga ggccgtcaag gtgctcaagt ctgttgctga ggcctccggc 420

accgagtttg tgtttgagga ccgactcatt ggaggagctg ccattgagaa ggagggcgag 480

cccatcaccg acgctactct cgacatctgc cgaaaggctg actctattat gctcggtgct 540

gtcggaggcg ctgccaacac cgtatggacc actcccgacg gacgaaccga cgtgcgaccc 600

gagcagggtc tcctcaagct gcgaaaggac ctgaacctgt acgccaacct gcgaccctgc 660

cagctgctgt cgcccaagct cgccgatctc tcccccatcc gaaacgttga gggcaccgac 720

ttcatcattg tccgagagct cgtcggaggt atctactttg gagagcgaaa ggaggatgac 780

ggatctggcg tcgcttccga caccgagacc tactccgttc ctgaggttga gcgaattgcc 840

cgaatggccg ccttcctggc ccttcagcac aacccccctc ttcccgtgtg gtctcttgac 900

aaggccaacg tgctggcctc ctctcgactt tggcgaaaga ctgtcactcg agtcctcaag 960

gacgaattcc cccagctcga gctcaaccac cagctgatcg actcggccgc catgatcctc 1020

atcaagcagc cctccaagat gaatggtatc atcatcacca ccaacatgtt tggcgatatc 1080

atctccgacg aggcctccgt catccccggt tctctgggtc tgctgccctc cgcctctctg 1140

gcttctctgc ccgacaccaa cgaggcgttc ggtctgtacg agccctgtca cggatctgcc 1200

cccgatctcg gcaagcagaa ggtcaacccc attgccacca ttctgtctgc cgccatgatg 1260

ctcaagttct ctcttaacat gaagcccgcc ggtgacgctg ttgaggctgc cgtcaaggag 1320

tccgtcgagg ctggtatcac taccgccgat atcggaggct cttcctccac ctccgaggtc 1380

ggagactttg ttgccaacaa ggtcaaggag ctgctcaaga aggagtaagt cgtttctacg 1440

acgcattgat ggaaggagca aactgacgcg cctgcgggtt ggtctaccgg cagggtccgc 1500

tagtgtataa gactctataa aaagggccca gccctgctaa tgaaatgatg atttataatt 1560

taccggtgta gcaaccttga ctagaagaag cagattgggt gtgtttgtag tggaggacag 1620

tggtacgttt tggaaacagt cttcttgaaa gtgtcttgtc tacagtatat tcactcataa 1680

cctcaatagc caagggtgta gtcggtttat taaaggaagg gagttgtggc tgatgtggat 1740

agatatcttt aaagctggcg actgcaccca acgagtgtgg tggtagcttg ttactgtata 1800

ttcggtaaga tatattttgt ggggttttta gtggtgtttg gtaggttagt gtctggtata 1860

tgagttgtag gcatgacaat ttggaaaggg gtggactttg ggaatattgt gggatttcaa 1920

taccttagtt tgtacagggt aattgttaca aatgatacaa agaactgtat ttcttttcat 1980

ttgttttaat tggttgtata tcaagtccgt tagacgagct cagtgccatg gcttttggca 2040

ctgtatttca tttttagagg tacactacat ccagtgaggt atggtaaggt tgagggcata 2100

atgaaggcac cttgtactga cagtcacaga cctctcaccg agaattttat gagatatact 2160

cgggttcatt ttaggctccg attcgattca aattattact gtcgaaatcg gttgagcatc 2220

cgttgatttc cgaacagatc tcggcagtct ctcggatgta gaattaggtt tccttgaggc 2280

gagatgagac ggtaagttgg aggggtttga gaagagatag agatcggttt gtgtgacatg 2340

aattctt 2347

<210>13

<211>700

<212>DNA

<213> Yarrowia lipolytica

<400>13

tcgatcctaa ggggtggcat aactgtcgcg tacggcccga taagggcctt ctccaaaagg 60

gaagccggtt gaaattccgg cacttggatg tggattctcc acggcaacgt aactgaatgt 120

ggggacggtg gcacaagtct tggaaggagt tatcttttct ttttaacgga gtcaacaccc 180

tggaattagt ttgtctagag atagggtatc gttccggaag aggggggcag ctttgtcccc 240

tccgatgcac ttgtgacgcc ccttgaaaac ccgcaggaag gaatagtttt cacgccaagt 300

cgtactgata accgcagcag gtctccaagg tgaacagcct ctagttgata gaataatgta 360

gataagggaa gtcggcaaaa tagatccgta acttcgggat aaggattggc tctgggggtt 420

ggtggatgga agcgtgggag accccaaggg actggcggct gggcaactgg cagccggacc 480

cgcggcagac actgcgtcgc tccgtccaca tcatcaaccg ccccagaact ggtacggaca 540

aggggaatct gactgtctaa ttaaaacata gctttgcgat ggttgtaaaa caatgttgac 600

gcaaagtgat ttctgcccag tgctctgaat gtcaaagtga agaaattcaa ccaagcgcgg 660

gtaaacggcg ggagtaacta tgactctctt aaggtagcca 700

<210>14

<211>599

<212>DNA

<213> Yarrowia lipolytica

<400>14

aatgcctcgt catctaatta gtgacgcgca tgaatggatt aacgagattc ccactgtccc 60

tatctactat ctagcgaaac cacagccaag ggaacgggct tggcagaatc agcggggaaa 120

gaagaccctg ttgagcttga ctctagtttg acattgtgaa gagacatagg gggtgtagaa 180

taagtgggag cttcggcgcc ggtgaaatac cactaccctt atcgtttctt tacttattta 240

gtaagtggaa gtggtttaac aaccattttc tagcattcct ttccaggctg aagacattgt 300

caggtgggga gtttggctgg ggcggcacat ctgttaaaag ataacgcaga tgtcctaagg 360

gggactcaat gagaacagaa atctcatgta gaacaaaagg gtaaaagtcc ccttgatttt 420

gattttcagt gtgaatacaa accatgaaag tgtggcctat cgatccttta gttgttcgga 480

gtttgaacct agaggtgcca gaaaagttac cacagggata actggcttgt ggcagtcaag 540

cgttcatagc gacattgctt tttgatcctt cgatgtcggc tcttcctatc ataccgaag 599

<210>15

<211>348

<212>DNA

<213> Yarrowia lipolytica

<400>15

agagaatcgg cgttacctct ctcacaaagc ccttcagtac cgccgcctgt cgggaatcgc 60

gttcaggtgg aacaggacca cctcccttgc acttcttggt atatcagtat aggctgatgt 120

attcatagtg gggtttttca taataaattt actaacggca ggcaacattc actcggctta 180

aacgcaaaac ggaccgtctt gatatcttct gacgcattga ccaccgagaa atagtgttag 240

ttaccgggtg agttattgtt cttctacaca ggcgacgccc atcgtctaga gttgatgtac 300

taactcagat ttcactacct accctatccc tggtacgcac aaagcact 348

<210>16

<211>353

<212>DNA

<213> Yarrowia lipolytica

<400>16

tgtaacactc gctctggaga gttagtcatc cgacagggta actctaatct cccaacacct 60

tattaactct gcgtaactgt aactcttctt gccacgtcga tcttactcaa ttttcctgct 120

catcatctgc tggattgttg tctatcgtct ggctctaata catttattgt ttattgccca 180

aacaactttc attgcacgta agtgaattgt tttataacag cgttcgccaa ttgctgcgcc 240

atcgtcgtcc ggctgtccta ccgttagggg tagtgtgtct cacactaccg aggttactag 300

agttgggaaa gcgatactgc ctcggacaca ccacctgggt cttacgactg cag 353

<210>17

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

acgccgccaa cccggtctct tggctacctt aagagagtca t 41

<210>18

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

acgccgccaa cccggtctct tggctacctt aagagagtca t 41

<210>19

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

atgactctct taaggtagcc aagagaccgg gttggcggcg ta 42

<210>20

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

gaaacctgct gggtggacat tttgaatgat tcttatactc ag 42

<210>21

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

ctgagtataa gaatcattca aaatgtccac ccagcaggtt tc 42

<210>22

<211>37

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

ccggcaacgt ggggacaggt tagtcgtcca gcttgac 37

<210>23

<211>37

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

gtcaagctgg acgactaacc tgtccccacg ttgccgg 37

<210>24

<211>62

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

aatgtcgttt accaaaagtg agaatgctcc acagaacaca cctcggacac gggcatctca 60

ct 62

<210>25

<211>63

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

ttttattttc catacatacg caagtgagat gcccgtgtcc gaggtgtgtt ctgtggagca 60

ttc 63

<210>26

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>26

gtcactaatt agatgacgag gcattggtgt agtggtagtg cagtgg 46

<210>27

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>27

accactgcac taccactaca ccaatgcctc gtcatctaat tag 43

<210>28

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>28

cttcggtatg ataggaagag ccgacatcg 29

<210>29

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>29

acaaccacac acatccacgt gatgctacaa gcagctattg gaaag 45

<210>30

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>30

ttagtttcgg gttcccacgt gctatgaccg tatgcaaata ttcgaa 46

<210>31

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>31

acaaccacac acatccacgt gatgacccag tctgtgaagg tgg 43

<210>32

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>32

ttagtttcgg gttcccacgt gctatgaccg tatgcaaata ttcgaa 46

<210>33

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>33

acaaccacac acatccacgt gatgaccacc tattcggctc cg 42

<210>34

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>34

ttagtttcgg gttcccacgt gctacttgaa ccccttctcg agc 43

<210>35

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>35

acaaccacac acatccacgt gatgcgactc actctgcccc g 41

<210>36

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>36

ttagtttcgg gttcccacgt gctactcgac agaagagacc t 41

<210>37

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>37

gtataagaat cattcaaaat gctacaagca gctattgga 39

<210>38

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>38

tccaatagct gcttgtagca ttttgaatga ttcttatac 39

<210>39

<211>60

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>39

ttattttcca tacatacgca agtgagatgc ccgtgtccga cgcagtagga tgtcctgcac 60

<210>40

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>40

agccgaatag gtggtcattg ttgatgtgtg tttaattcaa g 41

<210>41

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>41

gaattaaaca cacatcaaca atgaccacct attcggctcc 40

<210>42

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>42

gcgtgacata actaattaca tgatctactt gaaccccttc tc 42

<210>43

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>43

cgagaagggg ttcaagtaga tcatgtaatt agttatgtca c 41

<210>44

<211>60

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>44

ctcaggcgac gacggaattc gcaaattaaa gccttcgagc gtcccaaaac cttctcaagc 60

<210>45

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>45

gaattaaaca cacatcaaca atgaccacct attcggctcc 40

<210>46

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>46

gcgtgacata actaattaca tgatctactt gaaccccttc tc 42

<210>47

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>47

tgcatacggt catagcctgt ccccacgttg ccg 33

<210>48

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>48

cggcaacgtg gggacaggct atgaccgtat gcaaatattc g 41

<210>49

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>49

ctttaatttg cgaattccgt cgtcgcctga g 31

<210>50

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>50

gagtgttaca aagaattcat gtcacacaaa ccg 33

<210>51

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>51

agagaatcgg cgttacctct ctcacaaagc 30

<210>52

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>52

gcgtacactg ttagtgcttt gtgcgtacca g 31

<210>53

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>53

catgaattct ttgtaacact cgctctggag agttagtcat 40

<210>54

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>54

ctgcagtcgt aagacccagg tggtgtgt 28

Claims

1. The construction method of the recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene is characterized by comprising the following steps:

(1) introducing an optimized α -santalene synthase coding gene STS into yarrowia lipolytica to obtain a recombinant bacterium 1, wherein the nucleotide sequence of the gene STS is shown as SEQ ID NO. 1;

2. The construction method of the recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene is characterized by comprising the following steps:

(1) introducing an optimized α -santalene synthase coding gene STS into yarrowia lipolytica to obtain a recombinant bacterium 1, wherein the nucleotide sequence of the gene STS is shown as SEQ ID NO.1, 1500 nucleotides at the 5' end of a coding gene HMG1 of 3-hydroxy-3-methylglutaryl coenzyme A reductase are removed to obtain a truncated coding gene tHMG1 of 3-hydroxy-3-methylglutaryl coenzyme A reductase, the nucleotide sequence of the gene HMG1 is shown as SEQ ID NO.2, and the nucleotide sequence of the gene tHMG1 is shown as SEQ ID NO. 3;

3. The construction method of the recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene is characterized by comprising the following steps:

4. The construction method of the recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene is characterized by comprising the following steps:

5. The construction method of the recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene is characterized by comprising the following steps:

6. The construction method of the recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene is characterized by comprising the following steps:

(2) introducing a gene tHMG1 and a coding gene ERG8 of phosphomevalonate kinase into the recombinant bacterium 1 to obtain a recombinant bacterium 7;

the nucleotide sequence of the gene ERG8 is shown in SEQ ID NO. 4.

7. The recombinant yarrowia lipolytica for the heterologous synthesis of α -santalene constructed by the method of construction of one of the claims 1-6.

8. The use of the recombinant yarrowia lipolytica fermentation of the heterologously synthesized α -santalene of claim 7 to produce α -santalene.