CN111234016A - Fully human monoclonal antibody of anti-complement C5 molecule and application - Google Patents

Abstract

The invention discloses a fully human monoclonal antibody of an anti-complement C5 molecule, wherein a light chain and a heavy chain of the antibody have unique CDR regions, so that the antibody has excellent antigen binding activity, and the antibody has obvious effect of inhibiting the lysis of CHO cells and erythrocytes sensitized by the antibody in a cell lysis inhibition experiment. The anti-C5 monoclonal antibody disclosed by the invention can obviously improve the survival rate of mice in the treatment of MRL/lpr lupus erythematosus mice, and obviously improve the symptoms of proteinuria, glomerular score, interstitial inflammation, vasculitis, crescent body/necrosis and the like of a treatment group, thereby showing that the monoclonal antibody provided by the invention has excellent application prospect in the preparation of autoimmune disease treatment medicines.

Description

Fully human monoclonal antibody of anti-complement C5 molecule and application

Technical Field

The invention discloses an antibody, and belongs to the technical field of polypeptides.

Background

The complement system is composed of more than 30 soluble protein molecules, is a part of the natural immune system, and comprises more than 30 molecules such as complement inherent components, various regulatory factors, complement receptors and the like. The complement system can be activated by 3 independent and interconnected pathways, thereby exerting various biological effects such as opsonophagocytosis, cell lysis, inflammation mediation, immunoregulation and immune complex removal, including phagocytosis enhancement, phagocyte chemotaxis enhancement, vascular permeability enhancement, virus neutralization, cytolysis, immune response regulation, and the like. While complement activation provides a valuable first-line defense against potential pathogens, complement activation that promotes a protective inflammatory response may also represent a potential threat to the host. Complement activation and its deposition on target structures can also indirectly cause cell or tissue destruction. Complement activation products that mediate tissue damage are produced at various points in the complement pathway. Inappropriate complement activation on host tissues plays an important role in the pathology of many autoimmune and inflammatory diseases.

There are 3 pathways for complement activation, namely the classical pathway, the mannan-binding agglutination pathway and the alternative pathway. The classical complement activation pathway is activated by an antigen-antibody complex, and components involved in this pathway include C1-C9, which are artificially divided into three groups, i.e., recognition units (Clq, Clr, Cls), activation units (C4, C2, C3) and membrane attack units (C5-C9), according to their roles in the activation process, which play roles in different stages of activation, i.e., recognition stage, activation stage and membrane attack stage, respectively. The Mannan-Binding agglutination pathway is a change of the classical pathway, and Mannan-Binding Lectin (MBL) in plasma directly recognizes N-galactosamine or mannose on the surfaces of various pathogenic microorganisms, so that MASP-1, MASP-2, C4, C2 and C3 are sequentially activated, C3 and C5 convertases which are the same as those of the classical pathway are formed, and the activation pathway of complement cascade enzymatic reaction is activated. The alternative activation pathway is activated by foreign substances, dead tissues, cells, bacteria and the like, and is different from the classical activation pathway in that the activation is over three components of C1, C4 and C2, the C3 is directly activated, and then the chain reaction of the components of C5 to C9 is completed. Following activation of C3, a number of proteins are involved in the classical pathway, such as C1Q, C1r/C1s, C4 and C2. The classical pathway C3 convertase consists of C3bC4b2 a. During activation of the bypass pathway, C3B produced by the complement system can bind to properdin and factor B, forming the complex "PC 3 bB". Then, within this complex, factor D cleaves factor B into Bb and Ba. This cleavage allows Ba to be released from the complex and forms the alternative pathway C3 convertase PC3 bBb. PC3bBb cleaves C3 into C3a and C3b, establishing an amplification loop for the bypass pathway. In addition, in addition to the widely recognized role of the alternative pathway as an independent pathway in complement activation, the classical pathway and mannan-binding agglutination pathway may also provide an amplification loop for initiation of complement activation of the alternative pathway. In this alternative pathway mediated amplification mechanism, activation of the resulting C3 convertase C3bC4b2a cleaves C3 into two active fragments: anaphylatoxin C3a and C3b with opsonizing effect. C3a is a potent anaphylatoxin that can cause a variety of clinical conditions. C3a activates neutrophils, monocytes, platelets, mast cells and T cells. C3a has been shown to be critical for inducing paw edema in an adjuvant-induced arthritis model. Addition of newly formed C3b to the already produced C3 convertase can form C5 convertase, which can cleave C5 to produce C5b and C5 a.

C5 is a glycosylated β globulin having a molecular weight of 190kDa at a concentration of 75 μ g/ml in serum (0.4.mu.M), 1.5-3% of the molecular weight being carbohydrates mature C5 is a heterodimer consisting of a 35amino acid long, about 115kDa chain α linked to a 656 amino acid long, 75kDa β chain by a disulfide bond, the protein translation product of C5 is a 1659 amino acid long C5 precursor protein and 18 amino acid long leader peptide, the C5 precursor protein is cleaved at 655 to 659 amino acids to yield a β chain of 1-655 amino acid long and an α chain of 660-1658 amino acid residues, the middle four amino acid residues of which are cleaved (Haviland et al J.munol.1991, 146: 362-368).

C5a is generated from the first 74 amino acid residues at the amino terminus of the α chain by cleavage with C5 convertase, which molecule acts as a complement inhibitor if the cleavage effect of C5 convertase is blocked by the binding of a specific molecule at the cleavage site.

C5a is also a potent anaphylatoxin that causes changes in smooth muscle, vascular tone and vascular permeability, and is also a potent chemokine and activator of neutrophils, monocytes, platelets, endothelial cells and T cells. C5 a-mediated cellular activation can significantly amplify the inflammatory response by inducing the release of other inflammatory mediators, including cytokines, hydrolases, arachidonic acid metabolites, and reactive oxygen species. The other cleavage product, C5b, was inserted into the lipid bilayer on the target cell surface and became the core of C6, C7, C8 and C9 deposition, forming a C5b-9 complex. C5b-9 is also known as the Membrane Attack Complex (MAC). There is evidence that MAC plays an important role in inflammation and in addition it plays a role in lysing the cell pore-forming complex.

While complement activation provides a valuable first-line defense against potential pathogens, complement activation that promotes a protective inflammatory response may also represent a potential threat to the host. For example, C3a and C5a anaphylatoxins may be recruited to the diseased site and activate neutrophils, monocytes, and platelets. These activated cells indiscriminately release destructive enzymes, which may cause organ damage. Therefore, based on the new attempt of downregulating or inhibiting complement activation to treat some inflammatory diseases caused by complement activation, studies have shown that downregulation or inhibition of complement activation is effective for treating some disease indications, such as rheumatoid arthritis, systemic lupus erythematosus, glomerulonephritis, etc., in animal models and in vitro studies. Several endogenous soluble complement inhibitors (C1-inhibitor, soluble complement receptor 1 or sCR1) have been evaluated in clinical studies as recombinant proteins. The anti-C5 recombinant humanized monoclonal antibody can be specifically bonded to human terminal complement protein C5, and can block the release of inflammatory factor C5a and the formation of C5b-9 by inhibiting the cleavage of human complement C5 to C5a and C5 b. Preclinical studies have shown that this antibody has a high affinity for C5, blocks the formation of C5a and C5b-9, and protects mammalian cells from C5b-9 mediated damage (Thomas et al, Mol Immunol 1996,33:1389), and the anti-C5 antibody disclosed in this document only shows properties in terms of affinity and inhibition of neutralization, and has not been demonstrated in terms of inhibition of complement-mediated pathological damage. The technology was obtained in 2002 as U.S. patent grant US6355245, 9 months 2011, and approved by the U.S. Food and Drug Administration (FDA) as an orphan drug for treating a typical hemolytic uremic syndrome (aHUS) patient, i.e., anti-C5 antibody marketed as Eculizumab (Eculizumab). However, the efficacy of eculizumab in the clinical application of treatment of hemolytic uremic syndrome is still controversial.

In view of the key role of the C5 molecule in the complement activation pathway, the present invention aims to provide a monoclonal antibody specifically binding to the C5 molecule, so as to effectively inhibit the cleavage of the C5 molecule, inhibit the production of anaphylatoxin C5a as its cleavage product to inhibit or reduce the inflammatory reaction, and inhibit the production of another cleavage product C5b, thereby effectively preventing the formation of C5b-9, i.e., Membrane Attack Complex (MAC), inhibiting the pathway of complement activation amplification loop, and further providing the application of the antibody in the drugs for treating autoimmune diseases such as lupus erythematosus and the like mainly damaged by immune complexes.

Disclosure of Invention

Based on the above objects, the present invention provides a fully human monoclonal antibody against complement C5, wherein the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the antibody light chain variable region are represented by the amino acid sequences at positions 25-35, 51-57 and 90-99 of SEQ ID NO. 1, respectively, and the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the antibody heavy chain variable region are represented by the amino acid sequences at positions 30-35, 50-66 and 99-108 of SEQ ID NO. 5, respectively.

In a preferred embodiment, the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO. 1, and the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO. 5.

In a more preferred embodiment, the amino acid sequence of the antibody light chain constant region is set forth in SEQ ID NO. 3 and the amino acid sequence of the antibody heavy chain constant region is set forth in SEQ ID NO. 7.

Secondly, the invention also provides a polynucleotide for coding the heavy chain and/or the light chain of the monoclonal antibody.

In a preferred embodiment, the polynucleotide sequence encoding the variable region of the light chain of the antibody is shown in SEQ ID NO. 2 and the polynucleotide sequence encoding the variable region of the heavy chain of the antibody is shown in SEQ ID NO. 6.

In a more preferred embodiment, the polynucleotide encoding the antibody light chain constant region has the sequence shown in SEQ ID NO. 4 and the polynucleotide encoding the antibody heavy chain constant region has the sequence shown in SEQ ID NO. 8.

Third, the present invention also provides a vector expressing the above polynucleotide encoding the heavy chain and/or the light chain of the monoclonal antibody.

The vector for expressing the polynucleotide encoding the heavy chain and/or the light chain of the monoclonal antibody of the present invention is not particularly limited, and may be any eukaryotic expression vector capable of expressing the encoding polynucleotide. In a preferred embodiment of the invention, the vector expressing the polynucleotide encoding the light chain of the monoclonal antibody is the pAB lambda vector and the vector expressing the polynucleotide encoding the heavy chain of the monoclonal antibody is the pABH vector. .

Fourthly, the invention also provides a host cell containing the vector, and the cell is an Expi 293F cell.

Finally, the invention provides the application of the monoclonal antibody in preparing a medicament for treating the autoreactive diseases.

In a preferred embodiment, the autoimmune disease is lupus erythematosus.

The light chain and the heavy chain of the anti-C5 antibody disclosed by the invention have unique CDR regions, show excellent antigen binding activity in antigen binding capacity, and have a Ka (1/(M S) of 7.68 multiplied by 10⁴Kd (1/s) of 4.12X 10^-5，K_D(m) is 6.82X 10^-10. In a cell lysis inhibition experiment, the anti-C5 monoclonal antibody has obvious effect of inhibiting the dissolution of antibody-sensitized CHO cells and erythrocytes, the concentration of complement inhibitor for inhibiting 50% of CHO cells from dissolving is 18nmol/L, and the concentration of complement inhibitor for inhibiting 50% of erythrocytes from dissolving is 12nmol/L, which shows that the anti-C5 monoclonal antibody can effectively inhibit complement activation pathways. The anti-C5 monoclonal antibody disclosed by the invention can obviously improve the survival rate of mice in the treatment of MRL/lpr lupus erythematosus mice, the whole treatment process of a high-dose treatment group can completely protect the MRL/lpr lupus erythematosus mice, the survival rate is 100%, and the survival rate of a low-dose group can be maintained to be more than 90% even at the 24 th week. But also treatThe symptoms of proteinuria, glomerular integral, interstitial inflammation, vasculitis, crescent/necrosis and the like of the group are obviously improved, and the application prospect of the anti-C5 monoclonal antibody in preparing the medicine for treating the autoimmune disease is excellent.

Drawings

FIG. 1. 12% SDS-PAGE identification of anti-C5 antibody;

FIG. 2 Western Blot identification profile of anti-C5 antibody;

FIG. 3 is a graph of survival rates for single chain antibodies targeting C5 in MRL/lpr mice;

FIG. 4 is a graph comparing changes in proteinuria in MRL/lpr mice treated with single chain antibody targeting C5.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are only illustrative and do not limit the scope of protection defined by the claims of the present invention.

EXAMPLE 1 preparation of fully human monoclonal antibodies against complement C5 molecule

1.1 phage antibody expression library construction and expression see example 1 of Chinese patent application CN109575132A, the disclosure of CN109575132A is incorporated by reference into the specification of the present application.

1.2 screening of recombinant phage antibodies: a polyethylene dish was coated with C5 antigen (complete Technology, cat # A120Lot, Access # P06684), and the supernatant containing the recombinant phage was incubated with the dish for 2 hours at 37 ℃. The plate was washed 20 times with PBS, followed by 20 times with PBST (0.05% Tween20 in PBS), and the PBST was discarded. 10mL of TG1 cells in logarithmic growth phase were added and cultured at 37 ℃ for 1 hour. Centrifuging, collecting the supernatant, and performing the next round of screening. The screening process of "adsorption-elution-propagation" was repeated 2 times. Phage surface display libraries of enriched clones can be generated upon superinfection with M13K07 helper phage.

1.3 screening and identification of monoclonal recombinant phages: after the third round of screening, use2 XYT TG1 was diluted by multiple times (stock solution, 1:10, 1:100, 1:1000), spread on SOBAG solid medium (molecular cloning, third edition, Huang-Pentang, etc.), and cultured overnight at 30 ℃. 94 single colonies were randomly picked from the plate, inoculated into 100. mu.l of 2 XYTAG (containing 100. mu.g/mL ampicillin and 2% glucose) culture medium, and cultured overnight at 30 ℃. 20 μ l of the culture medium was transferred to 200 μ l of a medium containing 5X 10⁸pfu/mL M13K07 in 2 XYTAG medium, cultured at 37 ℃ for 2 hours. Centrifugation was performed, and 200. mu.l of 2 XYTAK (2 XYT containing 100. mu.g/mL ampicillin and 50. mu.g/mL kanamycin) was used to resuspend the precipitated cells, and the cells were cultured overnight at 30 ℃. Centrifuging and collecting the supernatant to obtain the monoclonal recombinant phage.

The enzyme-linked plates were coated with C5 antigen, 0.5% BSA as a negative control, and goat anti-M13 phage antibody as a positive control. Blocking with 1% BSA at 37 ℃ for 1 hour. 100 μ l of an equal volume of the mixture of recombinant phage antibody supernatant and blocking solution was added to the enzyme-linked plate, and M13 phage was added to the control wells. After incubation at 37 ℃ for 1 hour, the plates were washed 3 times with PBST (PBS containing 0.05% Tween 20) and 3 times with PBS. Mu.l of goat anti-M13 phage antibody IgG-HRP (1:2000) was added to each well and incubated at 37 ℃ for 1 hour. PBST and PBS were washed 3 times each, and freshly prepared substrate H was added₂O₂OPD, reacting at room temperature for 20min, adding 50 μ l 2MH₂SO₄Terminating the reaction at A₄₉₀The light absorption value of each well was measured. Among the positive clones, those with the highest binding activity to C5 were selected, which had an optical absorption value of 2.1 times or more that of the negative control.

1.4 respectively amplifying light chain and heavy chain fragments of the positive clone with the strongest binding activity by utilizing a PCR (polymerase chain reaction) technology, wherein the upstream of the light chain and the heavy chain fragments is provided with a BsrGI enzyme cutting site, and the downstream is provided with a BamHI enzyme cutting site;

light chain upstream primer:

5’>CGCGTGTACAGGAAGCTGGGCCGATATCGTTCTGACTCAACCTC<3’

light chain downstream primer: 5 '> CGCGAAGCTTGGTGCCACCGCCAAACAC < 3'

Heavy chain upstream primer:

5’>GCGCCCCTTAAGGGCGTGCAGTGCGAAGTGCAATTGGTGGAAAGC<3’

heavy chain downstream primer:

5’>CGGTGCTAGCGCTCGACACGGTCACCAGAGT<3’

the PCR reaction conditions are pre-denaturation at 95 ℃ for 5 minutes, then an amplification cycle is carried out, denaturation at 95 ℃ is carried out for 50 seconds, annealing at 68 ℃ is carried out for 40 seconds, extension at 72 ℃ is carried out for 50 seconds, and extension at 72 ℃ is carried out for 10 minutes after 25 cycles. The amplification product is identified by agarose gel electrophoresis, the length of the light chain amplification product is about 300kb, the length of the heavy chain amplification product is about 400kb, and the lengths of the light chain amplification product and the heavy chain amplification product are consistent with the expectation.

1.5 fragment purification using kit.

1.6 cleavage of the fragment with BsrGI and BamHI enzymes

And respectively connecting the light chain fragment and the heavy chain fragment which are subjected to enzyme digestion with a pAB lambda vector (stored in the laboratory) and a pABH vector (stored in the laboratory).

1.7 transfer the ligated fragment to a top10 (Beijing kang, century Biotechnology Ltd., CW0807S) (also available as DH5 α) competent cell, recover, culture overnight in an ampicillin resistant plate, and culture a single clone.

1.8 DNA sequence analysis of the positive clone recombinant plasmid: determining the DNA sequence of the anti-C5 antibody on the positive recombinant plasmid by using a T7 DNA sequence TAATACGACTCACTATAGG, wherein the amino acid sequence of the light chain variable region of the antibody is shown as SEQ ID NO. 1, the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the light chain variable region are respectively shown as the amino acid sequences of 25 th to 35 th, 51 th to 57 th and 90 th to 99 th positions of the SEQ ID NO. 1, and the polynucleotide sequence for encoding the light chain variable region is shown as SEQ ID NO. 2; the amino acid sequence of the light chain constant region is shown in SEQ ID NO. 3, and the sequence of the polynucleotide encoding the light chain constant region is shown in SEQ ID NO. 4. The amino acid sequence of the heavy chain variable region of the antibody is shown as SEQ ID NO. 5, the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the heavy chain variable region are respectively shown as the amino acid sequences of positions 30-35, 50-66 and 99-108 of SEQ ID NO. 5, and the polynucleotide sequence for encoding the heavy chain variable region of the antibody is shown as SEQ ID NO. 6; the amino acid sequence of the heavy chain constant region is shown as SEQ ID NO. 7, and the sequence of the polynucleotide encoding the antibody heavy chain constant region is shown as SEQ ID NO. 8.

1.9 comparing the sequences, connecting the fragment and the carrier with correct bacterial liquid, enlarging and culturing, and extracting the plasmid.

1.10 transient expression and affinity chromatography purification of monoclonal antibodies

An Expi293 expression system was used which combines a high expression Expi293 cell line, chemically defined serum free medium and a high efficiency transfection reagent with a proprietary enhancer. Mixing 15ug heavy chain carrier and 15ug light chain carrier, transfecting Expi 293F cell, operating according to the instruction (thermo Fisher Scientific, A14635), harvesting culture solution after 3 days, centrifuging to obtain supernatant about 30ml, using 5ml preinstalled Protein A affinity chromatographic column, balancing with 20mM PBS before loading, injecting sample after conductivity shows to baseline, washing the chromatographic column with 20mM PBS after loading, eluting target Protein with 0.1M glycine OD buffer solution with pH3.0, and eluting target Protein after conductivity shows to baseline₂₈₀After near baseline, collection was stopped, the column was washed with at least 3 column volumes of 20mM PBS until baseline leveled off, and the column was washed with 20% ethanol. The content of the monoclonal antibody protein is determined by using an ultraviolet method, and the formula is as follows: protein content 1.54A₂₈₀-1.38A₂₆₀. After purification by affinity chromatography, 20. mu.l of the purified desalted protein solution was taken, and 4. mu.l of 6 Xreducing buffer and non-reducing buffer were added, respectively, to the solution in a boiling water bath for 5 minutes, subjected to SDS-PAGE, and then decolorized. The SDS-PAGE results are shown in FIG. 1 (lane 1 shows the non-reduced SDS-PAGE electrophoresis of the mAb, the theoretical total molecular weight is around 150kDa, the actual electrophoretogram is around 250kDa due to glycosylated proteins, lane 2 shows the molecular weight marker, lane 3 shows the reduced SDS-PAGE electrophoresis of the mAb, the heavy chain (heavy chain, H) is expected to be 50kDa, and the Light chain (Light chain, L) is expected to be 25 kDa).

1.11 Western-Blotting identification of monoclonal antibodies

1.11.15% of concentrated gel and 6% of separation gel.

1.11.21 μ l of 1mg/ml antigen were subjected to SDS-PAGE, 70V gel concentrate, 130V gel isolate.

1.11.3, for a transfer time of 24min onto the PVDF film.

1.11.45% skimmed milk powder, 0.1% Tween20 in TBS for 2 h.

1.11.510 ml of primary antibody with a concentration of 5. mu.g/ml were incubated at room temperature for 2 h.

1.11.6TBST washing 5 times, 5 min/time.

1.11.7 goat anti-human antibody was used as a secondary antibody, diluted 1:5000, and incubated at room temperature for 1 h.

1.11.8TBST 5 washes 5 times, 5 min/time.

1.11.9 developing color.

The Western-Blotting identification result is shown in FIG. 2, wherein lane 1 is a molecular weight marker, lane 2 is a Western-Blotting identification band of the monoclonal antibody, the theoretical value of the molecular weight of the monoclonal antibody is about 150kDa, and the actual electrophoretogram is about 250kDa due to the glycosylated protein.

Example 2 analysis of kinetics of interaction of anti-complement C5 monoclonal antibody with C5 ligand

The kinetic analysis of the interaction of the anti-complement C5 monoclonal antibody with the C5 ligand was performed using a Surface Plasmon Resonance (SPR) detection system.

2.1 laboratory instruments and reagents

The instrument comprises the following steps: reichert2SPR (Reichert corporation), chip: SAM chip (for macromolecular detection), (ReichertInc., PART NO: 13206061).

Reagent: 500ml of 1xPBST (filtration, 0.22uM filter filtration), EDC (now ready for use), NHS (now ready for use), 1 mM pH8.5 ethanolamine (5-10ml), 10mM pH2.0 HCl (5-10ml), 10mM pH2.0 glycine (5-10 ml).

2.2. Experimental procedure

2.2.1 Pre-enrichment

2.2.1.1 proteins were diluted to 10. mu.g/mL, 200. mu.L with sodium acetate at different pH.

TABLE 1 sodium acetate pH selection Table

Name of protein	pH value of sodium acetate	Fixed channel
			Antigens	6.0/5.5/5.0/4.5/4.0	A certain channel

2.2.1.2 protein was injected in a channel, 25. mu.L/min, 2 min.

2.2.1.3 appropriate pH conditions (pH5.0) were selected.

2.2.2 protein immobilization

2.2.2.176.66 mg EDC and 11.52mg NHS were dissolved in 1mL ultrapure water, 200. mu.L was taken, and both the right and left channels were activated, 10. mu.L/min, 7 min.

2.2.2.2 antigens were diluted to 50. mu.g/mL, 200. mu.L with sodium acetate at the appropriate pH and immobilized separately in a channel. 10 μ L/min,7 min.

2.2.2.3 if the fixed amount is not sufficient at one time, the injection of antibody is repeated.

2.2.2.4 mu.L of 1M ethanolamine (pH8.5) was taken and the two channels were blocked at 10. mu.L/min for 7 min.

2.2.3 antibody-antigen binding preliminary experiments

2.2.3.1 antibodies were diluted with PBST to 100nM, 25. mu.L/min, bound for 3min, and dissociated for 5 min.

2.2.3.210 mM pH2.0 HCl (or 10mM pH2.0 glycine) regeneration for 2min, dissociation for 2 min.

2.2.4 official experiment

2.2.4.1 antibodies were diluted to 100nM with PBST, 2-fold more diluted, 7 gradients, 25 μ L/min, 3min binding, 5min dissociation.

2.2.4.210 mM pH2.0 HCl (or 10mM pH2.0 glycine) regeneration for 2min, dissociation for 2 min.

The SPR test results shown in table 2 indicate that the anti-C5 monoclonal antibody provided by the present invention shows excellent antigen binding potency.

TABLE 2 kinetic parameters of the binding of the anti-complement C5 monoclonal antibody to C5

Example 3 in vitro inhibition of complement activation by anti-C5 Total antibody

To determine complement inhibitory activity, 60% -80% of the fused CHO cells were separated with EDTA, washed 2 times with DMEM, and then resuspended in DMEM to a final concentration of 10⁶Individual cells/mL. Adding 100mL/L rabbit anti-CHO cell membrane antiserum into the cell suspension, and acting at 4 deg.C for 30min to sensitize the cells. The antiserum was then discarded and the cells resuspended in NHS diluted in DMEM to a final volume of 50. mu.L or 100. mu.L. The cells were incubated at 37 ℃ for 60min and finally cell viability was measured by the placental blue staining exclusion method (both live and dead cells were counted). The monoclonal antibody was diluted with DEME and added to NHS, and then to the CHO cell suspension. The final concentration was based on the control CHO cell lysis at which 100g/L NHS resulted in approximately 90% antibody sensitization. Complement-mediated inhibition of erythrolysis experiments sheep erythrocytes sensitized with antibody (EAs) were tested. Hemolysis assay was performed in gelatin phorona buffer (GVB)⁺⁺) In a final volume of 300. mu.L, containing 2.5X 10⁷EAs, NHS were diluted 1: 300. The reaction mixture was incubated at 37 ℃ for 60min and finally stopped by adding 300. mu.L of a solution containing 10mmol/L EDTA-PBS. Centrifuging, collecting supernatant, and quantitatively detecting heme in the supernatant with a spectral imager at 413nm wavelength.

Detecting the activity of the monoclonal antibody complement inhibitor: the results of complement-mediated CHO cell and erythrocyte lysis experiments show that in cell lysis inhibition experiments, the anti-C5 monoclonal antibody inhibits antibody-sensitized CHO cells and erythrocytes with obvious lysis effects (see Table 3 for details), and that the anti-C5 monoclonal antibody can effectively inhibit the classical complement activation pathway.

TABLE 3 concentration of complement inhibitor that inhibits lysis of 50% of cells

Example 4 therapeutic Effect of anti-C5 monoclonal antibodies in MRL/lpr lupus erythematosus mice

1. Improvement of survival rate

Comparison of survival rates of MRL/lpr mice from 16 weeks to 24 weeks in the anti-C5 mab high dose treatment group (n-28), ScFv-DAF low dose treatment group (n-28), and PBS control group (n-28).

The MRL/lpr lupus erythematosus mouse model, which was first established in 1979 by Murphy and Roths, was made by 12 generations of complex crossing processes of multiple strains of mice, and 75% of the mouse genes of the model were derived from LG/J, 12.6% from AKR/J, 12.1% from C3H/Di, and 0.3% from C57BL/6 strain of mice. MRL/lpr mice contain recessive mutations in the Fas gene associated with spontaneous apoptosis of cells, the appearance of lymphoproliferative genes, resulting in T cell proliferation, generalized lymphadenectasis, and erosive arthritis, anti-DNA, anti-Sm, anti-Su, anti-nucleoside P antibodies, high titer ANA, hypergammaglobulinemia, and rheumatoid factor. The mouse was first developed at 8 weeks when autoantibodies were detectable in the serum. Lymphadenitis was observed at 12 weeks. At 12-16 weeks, MRL/lpr mice began to develop large amounts of autoantibodies, including anti-double stranded DNA antibodies. Multiple organs were involved at the age of approximately 16 weeks and stable deterioration of renal function characterized by severe proteinuria occurred. 16-24 weeks old mice develop proliferative immune complex mediated glomerulonephritis, vasculitis, and eventually death due to renal failure, with a mortality rate of 50%.

In this example, 16-week-old MRL/lpr mice that had developed renal failure symptoms were randomized into three groups, the first group (n-28) was a high dose treatment group and received 0.4mg/W of anti-C5 mab weekly from week 16-24, the second group (n-28) was a low dose treatment group and received 0.1mg/W of anti-C5 mab weekly from week 16-24, the third group (n-28) was a control group and received equal amounts of PBS weekly from week 16-24. The administration routes of the three groups are tail vein injection. The protection rate of the anti-C5 monoclonal antibody on MRL/lpr lupus erythematosus mice was evaluated according to the survival rate of the administration group and the control group.

The experimental results are shown in fig. 3, as C5 in the complement activation pathway of the mice treated with the anti-C5 mab is effectively inhibited by the anti-C5 mab, the complement activation cascade reaction is difficult to enter an amplification loop, and autoimmune inflammatory lesions are effectively inhibited, the survival rate of the MRL/lpr lupus erythematosus mice is significantly improved, the MRL/lpr lupus erythematosus mice can be completely protected in the whole treatment process of the anti-C5 mab high-dose treatment group, the survival rate is 100%, the survival rate of the anti-C5 mab low-dose treatment group can be maintained at 90% or more even at 24 weeks, and the survival rate of the mice in the treatment group from 18 weeks is significantly improved compared with the survival rate in the control group.

2. Improvement of renal function

The mice were placed in metabolic cages to study the effect of anti-C5 monoclonal antibody on urinary albumin secretion in MRL/lpr lupus erythematosus mice. 24 hour urine from mice was collected every two weeks starting at 16 weeks. To prevent bacterial growth, ampicillin, gentamicin (ampicilin, gentamicin; Invitrogen Life Technologies) and chloramphenicol (Sigma-Aldrich) were added to the collection tubes. A standard curve was drawn by ELISA method using mouse albumin samples (Bethy Laboratories) of known concentration and urine albumin secretion of experimental mice was determined and creatinine content in mouse urine was determined using a biochemical analyzer (Beckman Coulter). The final evaluation results are expressed as urinary albumin (mg) to creatinine (mg) ratio for 24 hours per experimental mouse. A higher urinary albumin creatinine ratio indicates impaired kidney function. As shown in fig. 4, the proteinuria of the MRL/lpr mouse anti-C5 mab treated group (0.1mg/W, n-24) was compared with the PBS control group (n-26). At the 22 th to 24 th weeks, the proteinuria level of the treatment group is obviously reduced compared with that of the control group (P <0.01), and the anti-C5 monoclonal antibody provided by the invention can be proved to be capable of remarkably improving the symptom of renal function injury.

3. Reduction of inflammatory response in kidney

After the experiment is finished, the kidney of the excised mouse is longitudinally dissected into two halves, wherein one half is subjected to immunofluorescence analysis, the other half is fixed by 10% neutral formaldehyde, the other half is subjected to solid paraffin embedding and sectioning, the sectioning of the kidney tissue processed by paraffin is dyed by a hematoxylin-eosin dyeing method and a periodic acid snowflake dyeing method, glomerulonephritis, hyperplasia, crescent moon formation and necrosis symptoms observed by the sectioning are respectively graded by a blind method, and meanwhile, the change of renal interstitium is also graded. The scores were divided into five grades of 0, 1, 2, 3 and 4, with 0 being no damage and 4 being severe damage. Perivascular inflammatory exudation was evaluated in a semi-quantitative manner by blinding two independent observers on more than 10 vessels per section. Inflammation was scored as 0-3, 0 as no inflammation, 1 as less than 50% of the vessels surrounded by 3 layers of cells, 2 as more than 50% of the vessels surrounded by 3-6 layers, 3 as most severely represented, more than 6 layers surrounded by cells. The evaluation results are shown in Table 4.

TABLE 4 comparison of Kidney Damage in MRL/lpr mice between the anti-C5 mab-treated group and PBS control group at week 24 after 16-to 23-week treatment

Compared with the control group, the anti-C5 monoclonal antibody treatment group (0.1mg/W) has more obvious reduction in glomerular score, interstitial inflammation, vasculitis, crescent/necrosis and the like (P <0.05) than the control group.

Sequence listing

<110> Beijing Congpumet Innovation medicine science and technology, Limited liability company

<120> fully human monoclonal antibody of anti-complement C5 molecule and application

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>110

<212>PRT

<213>Homo sapiens

<400>1

Ser Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Val AlaPro Gly Gln

1 5 10 15

Thr Ala Arg Ile Thr Cys Ser Gly Asp Ala Leu Gly Asp Lys Tyr Ala

20 25 30

Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr

35 40 45

Glu Asp Ser Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser

50 55 60

Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr Gln Ala Glu

65 70 75 80

Asp Glu Ala Asp Tyr Tyr Cys Ser Ala Trp Glu Asp Asp Ala Glu His

85 90 95

Gln Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gln

100 105 110

<210>2

<211>330

<212>DNA

<213>Homo sapiens

<400>2

atggccagct acgaactgac ccagccgccg agcgtgtcgg tggcgccggg tcagaccgcg 60

cgtatcacct gctcgggcga tgcgctgggc gataaatacg cgagctggta tcagcagaaa 120

ccgggtcagg caccggtgct ggtgatttac gaagattcta aacgcccgtc tggcatcccg 180

gaacgcttta gcggctcgaa ttcgggcaacaccgcgaccc tgaccattag cggcacccag 240

gcggaggatg aggcggacta ttactgctcg gcgtgggagg acgacgctga gcatcaggtg 300

tttggcggtg gcaccaaact gaccgtgctg 330

<210>3

<211>105

<212>PRT

<213>Homo sapiens

<400>3

Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu Glu

1 5 10 15

Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe Tyr

20 25 30

Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val Lys

35 40 45

Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys Tyr

50 55 60

Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser His

65 70 75 80

Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu Lys

85 90 95

Thr Val Ala Pro Thr Glu Cys Ser Glx

100 105

<210>4

<211>321

<212>DNA

<213>Homo sapiens

<400>4

ggtcagccca aggctgcccc ctcggtcact ctgttcccgc cctcctctga ggagcttcaa 60

gccaacaagg ccacactggt gtgtctcata agtgacttct acccgggagc cgtgacagtg 120

gcctggaagg cagatagcag ccccgtcaag gcgggagtgg agaccaccac accctccaaa 180

caaagcaaca acaagtacgc ggccagcagc tatctgagcc tgacgcctga gcagtggaag 240

tcccacagaa gctacagctg ccaggtcacg catgaaggga gcaccgtgga gaagacagtg 300

gcccctacag aatgttcata g 321

<210>5

<211>120

<212>PRT

<213>Homo sapiens

<400>5

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val

50 55 60

LysGly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asn Pro Phe Tyr Val Gly Val Phe Asp Val Trp Gly Gln Gly

100 105 110

Thr Leu Val Thr Val Ser Ser Ala

115 120

<210>6

<211>360

<212>DNA

<213>Homo sapiens

<400>6

gaagtgcaat tggtggaaag cggtggcggt ctggtgcagc cgggtggcag cctgcgtctg 60

agctgcgcag cgagcggctt cacctttagc agctacgcga tgagctgggt gcgccaggca 120

ccgggtaaag gtctggaatg ggtgagcgcg attagcggta gcggcggcag cacctactat 180

gcggatagcg tgaaaggccg ttttaccatc tcgcgtgata actcgaaaaa caccctgtac 240

ctgcagatga acagcctgcg tgcggaagat accgcggtgt attattgcgc acgtcattat 300

cctggtccgt atgctttcga tgtctggggt cagggcactc tggtgaccgt gtcgagcgcg 360

<210>7

<211>329

<212>PRT

<213>Homo sapiens

<400>7

Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser

1 5 10 15

Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe

20 25 30

Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly

35 40 45

Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu

50 55 60

Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr

65 70 75 80

Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys

85 90 95

Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro

100 105 110

Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys

115 120 125

Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val

130 135 140

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

145 150 155 160

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

165 170 175

Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

180 185 190

Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

195 200 205

Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln

210 215 220

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu

225 230 235 240

Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

245 250 255

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn

260 265 270

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

275 280 285

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val

290 295 300

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

305 310 315 320

Lys SerLeu Ser Leu Ser Pro Gly Lys

325

<210>8

<211>990

<212>DNA

<213>Homo sapiens

<400>8

agcaccaagg gcccatcggt cttccccctg gcaccctcct ccaagagcac ctctgggggc 60

acagcggccc tgggctgcct ggtcaaggac tacttccccg aaccggtgac ggtgtcgtgg 120

aactcaggcg ccctgaccag cggcgtgcac accttcccgg ctgtcctaca gtcctcagga 180

ctctactccc tcagcagcgt ggtgaccgtg ccctccagca gcttgggcac ccagacctac 240

atctgcaacg tgaatcacaa gcccagcaac accaaggtgg acaagaaagt tgagcccaaa 300

tcttgtgaca aaactcacac atgcccaccg tgcccagcac ctgaactcct ggggggaccg 360

tcagtcttcc tcttcccccc aaaacccaag gacaccctca tgatctcccg gacccctgag 420

gtcacatgcg tggtggtgga cgtgagccac gaagaccctg aggtcaagtt caactggtac 480

gtggacggcg tggaggtgca taatgccaag acaaagccgc gggaggagca gtacaacagc 540

acgtaccgtg tggtcagcgt cctcaccgtc ctgcaccagg actggctgaa tggcaaggag 600

tacaagtgca aggtctccaa caaagccctc ccagccccca tcgagaaaac catctccaaa 660

gccaaagggc agccccgaga accacaggtg tacaccctgc ccccatcccg ggatgagctg 720

accaagaacc aggtcagcct gacctgcctg gtcaaaggct tctatcccag cgacatcgcc 780

gtggagtggg agagcaatgg gcagccggag aacaactaca agaccacgcc tcccgtgctg 840

gactccgacg gctccttctt cctctatagc aagctcaccg tggacaagag caggtggcag 900

caggggaacg tcttctcatg ctccgtgatg catgaggctc tgcacaacca ctacacgcag 960

aagagcctct ccctgtcccc gggtaaatga 990

Claims (10)

1. A fully human monoclonal antibody against complement C5, wherein the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region of the antibody are shown as the amino acid sequences at positions 25-35, 51-57 and 90-99 of SEQ ID NO. 1, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of the antibody are shown as the amino acid sequences at positions 30-35, 50-66 and 99-108 of SEQ ID NO. 5, respectively.

2. The monoclonal antibody of claim 1, wherein the amino acid sequence of the antibody light chain variable region is shown as SEQ ID NO. 1, and the amino acid sequence of the antibody heavy chain variable region is shown as SEQ ID NO. 5.

3. The monoclonal antibody of claim 2, wherein the amino acid sequence of the antibody light chain constant region is set forth in SEQ ID NO. 3 and the amino acid sequence of the antibody heavy chain constant region is set forth in SEQ ID NO. 7.

4. A polynucleotide encoding the heavy and/or light chain of a monoclonal antibody according to any one of claims 1-3.

5. The polynucleotide of claim 4, wherein the polynucleotide sequence encoding the variable region of the light chain of said antibody is represented by SEQ ID No. 2 and the polynucleotide sequence encoding the variable region of the heavy chain of said antibody is represented by SEQ ID No. 6.

6. The polynucleotide of claim 5, wherein the polynucleotide encoding the antibody light chain constant region has the sequence shown in SEQ ID NO. 4 and the polynucleotide encoding the antibody heavy chain constant region has the sequence shown in SEQ ID NO. 8.

7. A vector expressing the polynucleotide encoding the heavy and/or light chain of the monoclonal antibody of claim 6.

8. A host cell comprising the vector of claim 7, wherein said cell is an Expi 293F cell.

9. Use of a monoclonal antibody according to any one of claims 1 to 3 for the preparation of a medicament for the treatment of an autoimmune disease.

10. The use of claim 9, wherein the autoimmune disease is lupus erythematosus.

Images