CN111218469B - Double T-DNA vector pBID-RT Enhanced and construction method and application thereof - Google Patents

Abstract

The invention provides a double T-DNA carrier pBID-RT Enhanced and a construction method and application thereof, relating to the technical field of transgenosis; the vector is based on a plasmid of pCAMBIA3300 and comprises two reverse independent T-DNA regions, wherein the nucleotide sequence of the first T-DNA region is shown as SEQ ID NO.1, and the nucleotide sequence of the second T-DNA region is shown as SEQ ID NO. 2. The use of the vector can reduce the frequency of integration of T-DNA into linked sites, T₁Generation and F₁The unmarked transgenic plants in the generation account for 76.92 percent; the glufosinate-resistant transgenic rape and the glufosinate-resistant and glyphosate-resistant transgenic rape can be obtained by utilizing the vector. The carrier of the invention can be used for successfully and efficiently producing unmarked transgenic cabbage type rape plants and creating two herbicide-resistant varieties.

Description

Double T-DNA vector pBID-RT Enhanced and construction method and application thereof

Technical Field

The invention belongs to the technical field of genetic transformation, and particularly relates to a double T-DNA vector pBID-RT Enhanced and a construction method and application thereof.

Background

Brassica napus (b.napus L.) is one of the most important oil crops in the world, the main plant for the production of protein-rich products. In order to meet the increasing demand, it is necessary to improve existing varieties using genetic engineering methods and create new and superior brassica napus varieties, which provides another approach to create new varieties with improved traits and desirable characteristics that cannot be obtained by traditional breeding methods. Since the successful modification of brassica napus was first reported, agrobacterium-mediated systems have been used to successfully improve brassica napus. Improvements in many important properties, including herbicide, insect and fungal resistance, and improvements in oil and fat content and proteins, have been introduced into brassica napus by transgenic methods. The safety of transgenic brassica napus faces the same problems and debate as other transgenic crops, one of which is the concern of selectable marker genes.

The genetic transformation of a target gene requires the concomitant transformation with other antibiotic or herbicide-resistant selectable marker genes to aid in the selection of positive transgenic plants carrying the target gene. Once the transgenic plant is regenerated and identified, the selectable marker gene is no longer required. Furthermore, transgenic plants carrying marker genes not only affect public acceptance, but also increase the environmental risk of introduction of marker genes into related weeds and non-transgenic crops. These factors complicate the regulatory process of commercialization of transgenic plants. Furthermore, the marker gene limits this multiple gene stacking process for multiple transformations of different genes. Therefore, the production of marker-free transgenic brassica napus varieties will be beneficial to the development and final commercial utilization of brassica napus.

To date, a number of methods have been developed that enable the removal of selectable marker genes, including co-transformation, site-specific recombination, and homologous recombination. Among these methods, co-transformation is a simple, clean technique, and leaves no residual DNA sequences such as inverted repeats and recombination sites in transgenic plants in which marker genes are deleted, thus being widely used. Co-transformation refers to the simultaneous integration of one T-DNA carrying a marker gene and another T-DNA carrying a gene of interest into the genome, and if both genes are integrated at a site that is not linked, they will subsequently recombine and segregate in the progeny. Co-transformation has applications in many species, including soybean, tobacco, corn, sorghum, rice and durum wheat. However, using current co-transformation techniques, a "double T-DNA" vector is constructed by inserting "right and left box" sequences into a binary vector, a T-DNA; GUS is mostly used as a target gene, Bar is used as a marker gene, and finally, a unmarked plant with GUS and Bar removed is obtained, so that the unmarked plant has no application value.

Disclosure of Invention

In view of the above, the invention aims to provide a double T-DNA vector pBID-RT Enhanced and a construction method and application thereof, which can reduce the frequency of T-DNA integration to linked loci, thereby improving the occurrence probability of unmarked transgenic plants and simultaneously obtaining various transgenic materials with practical application values.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a double T-DNA carrier pBID-RT Enhanced, which takes plasmid of pCAMBIA3300 as a basis and comprises two reverse independent T-DNA regions, wherein the nucleotide sequence of the first T-DNA region is shown as SEQ ID NO.1, and the nucleotide sequence of the second T-DNA region is shown as SEQ ID NO. 2; the distance between the first T-DNA region and the second T-DNA region is greater than 2 kb.

Preferably, the first T-DNA region comprises selectable marker genes including the CP4-EPSPS gene and the GOX-V247 gene; the nucleotide sequence of the CP4-EPSPS gene is shown in SEQ ID NO. 3; the nucleotide sequence of the GOX-V247 gene is shown as SEQ ID NO. 4.

Preferably, the second T-DNA region comprises a target gene Bar, and the nucleotide sequence of the target gene Bar is shown as SEQ ID NO. 5.

The invention also provides a construction method of the vector pBID-RT Enhanced, which comprises the following steps: (1) double enzyme digestion is carried out to remove the multiple cloning site MCS of pCAMBIA3300 plasmid, after the cohesive end is filled up, enzyme linkage is carried out to form a ring, thus obtaining pCAMBIA3300 plasmid without MCS;

(2) inserting a new said multiple cloning site MCS between pBR322 bom and pVS1 oriV site of said MCS-free pCAMBIA3300 plasmid;

(3) and inserting a sequence containing a selective marker gene into the new multi-cloning site MCS to obtain a first T-DNA region, and constructing to obtain the vector pBID-RT Enhanced.

Preferably, the enzyme used in the double enzyme digestion in step (1) comprises EcoRI and PmeI; filling in the cohesive ends with klenow enzyme; the linear molecules with the cohesive ends aligned are ligated into a loop using ligase.

The invention also provides the vector pBID-RT Enhanced or the application of the vector pBID-RT Enhanced constructed by the construction method in rape genetic transformation.

Preferably, the oilseed rape is transformed using an agrobacterium-mediated genetic transformation method.

The invention provides a double T-DNA carrier pBID-RT Enhanced, wherein the distance between two T-DNAs of the carrier pBID-RT Enhanced is more than 2kb, and the T-DNAs are arranged in an inverted manner. The frequency of integration of the T-DNA into a linkage site can be reduced; in the example of the invention, among the 13T 1 and F1 generations, 10 lines were identified with the presence of marker-free transgenic plants, accounting for 76.92%;

according to the invention, Bar is taken as a target gene, and CP4-EPSPS gene and GOX-V247 gene are taken as marker genes, so that not only can a unmarked plant (glufosinate herbicide resistant transgenic material) containing Bar and with Bar removed CP4-EPSPS be obtained, but also a transgenic plant (glufosinate herbicide resistant transgenic material) with Bar and CP4-EPSPS can be obtained, and a transgenic plant (glyphosate herbicide resistant transgenic material) containing CP4-EPSPS and with Bar removed can be obtained.

The invention adopts an agrobacterium-mediated glyphosate screening method to obtain 76 regenerated brassica napus plants in total, and the result shows that 76 independent T plants₀Among the plants, 18 plants are Bar⁺EPSPS⁺GOX⁺39 plants are Bar^-EPSPS⁺GOX +, the cotransformation rate of the vector pBID-RTenhanced is 31.58%; and the Bar gene and the CP4-EPSPS gene are inserted into the same transgene at different copy numbersSince the number of inserted copies of the T-DNA carrying CP4-EPSPS in the genome of the plant is low, a high frequency of progeny segregation marker genes can be obtained because of the large T-DNA fragment.

The vector pBID-RT Enhanced of the double T-DNA can be used for successfully and efficiently producing unmarked transgenic brassica napus plants and creating two herbicide-resistant varieties, can be used for tests, crop improvement and commercial requirements, and has potential for transforming a plurality of plant species in practical application, including dicotyledonous plants and monocotyledonous plants.

Drawings

FIG. 1 is a plasmid structure diagram of vector pBID-RT Enhanced;

FIG. 2 is a diagram showing the results of transgene assay, wherein A is PCR assay Bar gene, B is PCR assay CP4-EPSPS gene, C is PCR assay GOX-V247 gene, and in A, B and C, M represents DL2000 DNA marker; lanes 1-17 represent individual T's obtained by pBID-RT Enhanced transformation₀Plant growing; p represents an expression vector pBID-RTenhanced; WT denotes wild-type ZS 6; d is the test strip to detect the EPSPS protein expression in the transgenic cabbage type rape plant, wherein P represents a positive control, and the Bar protein is transformed into MS8 cabbage type rape plant; WT denotes wild-type ZS 6; e is the test strip for detecting Bar protein expression in the transgenic cabbage type rape plants, wherein P represents GT73 transgenic cabbage type rape plants containing EPSPS protein, WT represents wild type ZS 6;

FIG. 3 shows Southern hybridization assay Trans-T₀Gene copy number in transgenic brassica napus, wherein: southern hybridization detection of transT₀Bar (A, C, E) and EPSPS (B, D, F) gene copy number of transgenic cabbage type rape (A, B, D, F), T is identified from pBID-RT Enhanced double T-DNA system₁Generation (C, D, E, F) unmarked plants; lanes 1 to 17 in A and B represent T₀The generation plant has Bar⁺EPSPS⁺The genotype; C. d, E lanes 1 to 12 of F represent T₁The plant has Bar⁺EPSPS genotype, lanes 13-24 represent T₁The plant has Bar⁺EPSPS⁺The genotype; and M represents a DNA molecular weight marker, WT represents wild-type ZS6, P represents a positive control;

FIG. 4 shows PCR screening of T1 generation unmarked transgenic plants, wherein A is the Bar gene, B is the EPSPS gene, and C is the GOX gene; in the figure, M represents a DL1000 DNA marker; lanes 1 to 17 represent individual T₁Plant growing; p represents a positive control; WT denotes wild-type ZS 6.

Detailed Description

The invention provides a double T-DNA carrier pBID-RT Enhanced, which takes plasmid of pCAMBIA3300 as a basis and comprises two reverse independent T-DNA regions, wherein the nucleotide sequence of the first T-DNA region is shown as SEQ ID NO.1, and the nucleotide sequence of the second T-DNA region is shown as SEQ ID NO. 2; the distance between the first T-DNA region and the second T-DNA region is greater than 2 kb.

In the vector pBID-RT Enhanced, the distance between two T-DNAs is more than 2kb, and the T-DNA containing the CP4-EPSPS marker gene is obviously longer than the other T-DNA, so that the copy number of the T-DNA containing the CP4-EPSPS marker gene integrated into a genome is low, and the T-DNA is integrated into the genome₁The T-DNA can be more easily separated and discarded; and the T-DNA is arranged in an inverted manner, so that the frequency of integration of the T-DNA into a linked site can be reduced.

The first T-DNA region of the present invention comprises a selection marker gene, preferably comprising CP4-EPSPS gene (EPSPS gene for short) and GOX-V247 gene (GOX gene for short). The CP4-EPSPS gene is preferably derived from Salmonella typhimurium (Salmonella typhimurium) and can encode 5-enolpyruvate phenyloxalate-3-phosphate lipase, so that the plants generate resistance to herbicide glyphosate; the nucleotide sequence of the CP4-EPSPS gene is preferably shown as SEQ ID NO. 3.

The GOX-V247 gene is preferably derived from human leucobacter canescens (Ochrobactrum anthropi) and is a glyphosate degradation gene, and the nucleotide sequence of the GOX-V247 gene is preferably shown as SEQ ID No. 4. After the CP4-EPSPS gene and the GOX-V247 gene are combined, the glyphosate resistance can be improved while the glyphosate residue is reduced, and the negative influence of the glyphosate residue on sensitive pollination and reproductive development of plants is avoided.

The second T-DNA region of the invention preferably comprises a target gene Bar, and the nucleotide sequence of the target gene Bar is preferably shown as SEQ ID NO. 5.

The invention also provides a construction method of the vector pBID-RT Enhanced, which comprises the following steps: (1) double enzyme digestion is carried out to remove the multiple cloning site MCS of pCAMBIA3300 plasmid, after the cohesive end is filled up, enzyme linkage is carried out to form a ring, thus obtaining pCAMBIA3300 plasmid without MCS;

(2) inserting a new said multiple cloning site MCS between pBR322 bom and pVS1 oriV site of said MCS-free pCAMBIA3300 plasmid;

(3) and inserting a sequence containing a selective marker gene into the new multi-cloning site MCS to obtain a first T-DNA region, and constructing to obtain the vector pBID-RT Enhanced.

The invention removes the multi-cloning site MCS of pCAMBIA3300 plasmid by double enzyme digestion, after filling up the cohesive end, the enzyme links into ring, gets pCAMBIA3300 plasmid without MCS. The enzyme used for the double enzyme digestion of the invention preferably comprises EcoRI and PmeI. The present invention preferably makes use of the klenow enzyme to fill in the sticky ends. In the present invention, the linear molecules after the cohesive ends are filled up are preferably ligated to form a loop by using a ligase. The reaction system and procedure of the enzyme of the present invention are not particularly limited, and conventional systems and procedures in the art may be used.

After obtaining the pCAMBIA3300 plasmid without MCS, the invention inserts a new multi-cloning site MCS between pBR322 bom and pVS1 oriV sites of the pCAMBIA3300 plasmid without MCS. The MCS removed by double enzyme digestion of the multiple enzyme digestion sites in the invention is preferably the same as the MCS of the newly inserted multiple cloning sites.

The invention inserts the sequence containing the selection marker gene into the new multi-cloning site MCS to obtain a first T-DNA region, and constructs and obtains the vector pBID-RT Enhanced. In the present invention, it is preferable that a synthetic sequence including the left border, the enhanced CaMV35S promoter, the CP4-EPSPS gene, the NOS terminator, the enhanced CaMV35S promoter, the GOX-V247 gene, the NOS terminator and the right border is inserted into the new MCS in pCAMBIA3300 to form the first T-DNA region of the sequence shown in SEQ ID NO.1 with a full length of 5776 bp. Since the pCAMBIA3300 plasmid itself contains the Bar gene, and the distance between the second T-DNA region containing the Bar gene and the first T-DNA region is more than 2kb, an Enhanced double T-DNA vector pBID-RT Enhanced is formed.

The invention also provides the vector pBID-RT Enhanced or the application of the vector pBID-RT Enhanced constructed by the construction method in rape genetic transformation. In the present invention, it is preferable to transform rape by using Agrobacterium-mediated genetic transformation method, and the genetic transformation method is not particularly limited, but preferred references include Liu F, Xiong XJ, Wu L, Fu DH, Hayward A, Zeng XH, Cao YL, Wu YH, Li YJ, & Wu G (2014) BraLTP1, a lipid transfer protein gene-infected in ecological tissue displacement, cell promotion and flow reduction in Brassica napus. PLOS (IF 3.534)9(10): e 110272.

The following examples are provided to illustrate the double T-DNA vector pBID-RT Enhanced of the present invention and its construction method and application in detail, but they should not be construed as limiting the scope of the present invention.

Example 1

Construction of pBID-RT Enhanced

For plasmid pCAMBIA3300 containing the Bar gene, the MCS (multiple cloning site) was excised with EcoRI and PmeI enzymes, then the cohesive ends were filled in with klenow enzyme, and the linear molecule was self-ligated into loops with ligase. A new MCS (identical to the excised MCS sequence) was then inserted between pBR322 bom and pVS1 oriV sites. The synthetic sequence comprising the left border, enhanced CaMV35S promoter, CP4-EPSPS gene, NOS terminator, enhanced CaMV35S promoter, GOX-V247 gene, NOS terminator and right border was inserted into the new MCS in pCAMBIA3300, at a full length of 5776bp (SEQ ID NO. 1). The expression vector pBID-RT Enhanced (the plasmid is shown in figure 1) is constructed.

Reference is made to the procedure of Liu et al for genetic transformation of pBID-RT Enhanced twin T-DNA vectors in oilseed rape (Liu F, Xiong XJ, Wu L, Fu DH, Hayward A, Zeng XH, Cao YL, Wu YH, Li YJ,&wu G (2014) BraLTP1, a lipid transfer protein gene involved in encapsulated in aqueous wall displacement, cell promotion and flow reduction in Brassica napus. PLOS ONE (IF 3.534)9(10) e 110272): the pBID-RT Enhanced plasmid is introduced into Agrobacterium tumefaciens GV3101 by electrotransformation, and LB agar plate is placed at 37 deg.CThe plates were cultured, the plates were supplemented with appropriate concentrations of antibiotics (gentamicin 50mg/L, rifampicin 50mg/L and kanamycin 50mg/L), positive clones were selected and PCR verified. The cabbage type rape is transformed by a single positive agrobacterium colony, and the receptor adopts Zhongshuang No. 6. Soaking seeds of Zhongshuang No. 6 in 75% ethanol for 1min, soaking in 1.5% mercuric chloride for 10-15 min, germinating in the dark for 5-6 d, cutting the yellowed hypocotyl into small segments of 7mm, mixing with 50mL of agrobacterium (the OD value of the agrobacterium is about 0.3) in a liquid DM culture medium (MS +30g/L of sucrose +100 mu M of acetosyringone, pH 5.8), and soaking for 0.5 h. Then transferring the hypocotyls with air-dried surfaces to a co-culture medium (MS +30g/L sucrose +18g/L mannitol +1 mg/L2, 4-D +0.3mg/L kinetin +100 mu M acetosyringone +8.5g agarose, pH value 5.8) for 2D, and then to a selection medium (MS +30g/L sucrose +18g/L mannitol +1 mg/L2, 4-D +0.3mg/L kinetin +20 mg/LAgNO)₃+8.5g/L agarose +250mg/L carbenicillin disodium, pH 5.8). After 3 weeks, hypocotyl calli were transferred to regeneration medium (MS +10g/L glucose +0.25g/L xylose +0.6 g/L2- (N-morpholino) ethanesulfonic acid hydrate +2mg/L zeatin +0.1mg/L indole-3-acetic acid +8.5g/L agarose +80mg/L glyphosate +250mg/L carbenicillin disodium, pH 5.8) for 2 weeks. Transferring the hypocotyl into a new regeneration culture medium every 2 weeks for 3-4 regeneration cycles in total, transferring the hypocotyl into a rooting culture medium (MS +10g/L sucrose +10g/L agar, pH 5.8) after seedling formation for rooting (about 3 weeks). Transplanting the transformed rooted plant into a flowerpot for growing.

In the transformation process, as the hypocotyl is sensitive to glyphosate, the glyphosate is added into the culture medium only in the regeneration period, so that the transformed cells are more competitive than the untransformed cells. The regenerated shoots were screened on selection medium containing 80mg/L glyphosate.

Adopting agrobacterium-mediated glyphosate screening method to obtain 76 regenerated cabbage type rape plants. The presence of the Bar, EPSPS and GOX genes in regenerated Brassica napus plants was detected by PCR and the expression of the Bar and EPSPS proteins was detected by a test strip, as shown in Table 1 and FIG. 2, 18 out of 76 independent T0 plants were Bar⁺EPSPS⁺GOX⁺39 plants are Bar^-EPSPS⁺GOX⁺，pBID-RTThe Enhanced vector cotransformation rate is 31.58%.

TABLE 1 Co-transformation frequency of transformants of the pBID RT Enhanced double T-DNA vector System T0

Southern hybridization of the double T-DNA system of pBID-RT Enhanced: DNA digested by Hind III is hybridized with Bar probe, the hybridization product is 262bp, and the probe primers are respectively as follows:

Bar-F(SEQ ID NO.6)：GAAGGCACGCAACGCCTACGA；

Bar-R(SEQ ID NO.7)：TGGCATGACGTGGGTTTCTGG；

the DNA cut by EcoRI is hybridized with an EPSPS probe, the hybridization product is 579bp, and the probe primers are respectively as follows:

EPSPS-F(SEQ ID NO.8)：GTGGGGATTGAAGAAGAGTGG；

EPSPS-R(SEQ ID NO.9)：CCAAAGACTCCAACGCCAAT。

identification of Co-Integrated T by southern blot₀Transgenic plants to detect the integration status and copy number of the Bar and EPSPS genes (FIG. 3). The Blot results showed that the Bar gene was integrated in a single copy in 4 out of 17 transgenic plants and in 3 copies in most plants (A in FIG. 3). However, in 17 Brassica napus plants, there were 9 single copies of the EPSPS gene (B in FIG. 3). The results show that the Bar gene and the EPSPS gene are inserted into the genome of the same transgenic plant at different copy numbers. All T0 positive transgenic plants have normal fertility, and no sterile transgenic plants are found.

Randomly select 8T₀ Bar⁺EPSPS⁺GOX⁺Plants, either selfed or crossed with the transformation receptor ZS6, were grown to maturity in the greenhouse. To obtain marker-free transgenic Brassica napus plants (FIG. 4, Table 2), 13T were tested₁Is substituted or F₁Of breeding linesPlants were analyzed. In the seedling stage, each T1 generation plant is tested for the presence of Bar, EPSPS and GOX genes by a PCR method. 4 transgenic plants were detected in the T1 generation: bar⁺EPSPS⁺GOX⁺、Bar^-EPSPS⁺GOX⁺、Bar⁺EPSPS^-GOX^-And Bar^-EPSPS^-GOX^-. Majority of T₁The plant is Bar⁺EPSPS⁺GOX⁺And some are unlabeled bars⁺EPSPS^-GOX^-A plant. 13T₁Generation and F₁37 unmarked plants are identified in 10 lines in the generation transgenic lines, the frequency of the unmarked gene lines is 76.92%, and the efficiency of the marker gene separation among different lines is 4.35-52.94%. At T₁10T of generation unmarked offspring₀In the line, the separation efficiency of the marker gene was 21.06% on average.

TABLE 2T₁Generation strain EPSPS and Bar genotyping detection

Selection of 12 unmarked Brassica napus Bar⁺EPSPS^-GOX^-Southern hybridization analysis was performed (C and D in FIG. 3). Since EPSPS and GOX are closely linked sites in the same T-DNA, identification of EPSPS represents both genes. All 12T₁ Bar⁺EPSPS^-GOX^-All showed 1-2 bars, no EPSPS bands, and showed four different band patterns, representing four independent T₀A transgenic line. Corresponding four T₀Lines all show an EPSPS band ( lines 2, 6, 8 and 15 of B in FIG. 3), representing four T₀The EPSPS gene is present in a single copy in the strain.

By using the scheme of the inventionObtaining Bar⁺EPSPS^-GOX^-Bar is obtained in addition to the plants (glufosinate-resistant)⁺EPSPS⁺GOX⁺Transgenic brassica napus (glufosinate and glyphosate resistant) is resistant to both herbicides. Therefore, 12 bars were selected⁺EPSPS⁺GOX⁺T of genotype₁Or F₁Progeny, verified by Southern hybridization with untransformed wild-type ZS6 as control (E and F in fig. 3). 12T₁Or F₁ Bar⁺EPSPS⁺GOX⁺Progeny showed 1-4 Bar bands and 1-2 EPSPS bands, while all progeny showed 6 different banding patterns, representing 6 independent transgenic T₀Lines (E and F in FIG. 3).

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> institute of oil crop of academy of agricultural sciences of China

<120> double T-DNA vector pBID-RT Enhanced and construction method and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5776

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

taaacgctct tttctcttag gtttacccgc agcggataac aatttcacac aggaaacagc 60

tatgaccatg attacgccaa gctatttagg tgacactata gaatactcaa gctatgcatc 120

atcccgggcg cgccagggag ctccccgatc tagtaacata gatgacaccg cgcgcgataa 180

tttatcctag tttgcgcgct atattttgtt ttctatcgcg tattaaatgt ataattgcgg 240

gactctaatc ataaaaaccc atctcataaa taacgtcatg cattacatgt taattattac 300

atgcttaacg taattcaaca gaaattatat gataatcatc gcaagaccgg caacaggatt 360

caatcttaag aaactttatt gccaaatgtt tgaacgatcg gatctgaggc tgcagttact 420

agttccggat ctttaggatg caggaccagt ttgcttggac ttaccaatac cgaaacggtt 480

tggtgcgaat ggagagatgt cgatagaggt cttctcacct gcgaggagct cagaaacgag 540

ggttgcggtc attggagcac cagtcatacc gaggtgaccg tgaccgaaag cgtagataac 600

gtctggagta cgggtagcac gaccaatcac tggaagggaa tccgggatgc ttggacggaa 660

acccatccac ttggagtaac gttcttcaga actggcagga gcgagagctg gaagcaactt 720

acgagcgcga gtgtagagaa cgtgagcacg cttccagtta ggagcagcag tgagaccagc 780

gaactcaacg gttccagcaa cacgaagacc catctccata ggagtagcga tgaactttcc 840

agaagcatcg gtagttggaa tacgtggagc agcttctggg ttggcgatca cgatgtggta 900

tccacgttcg gtatccaatg ggatgtcatc accaagggag ttagcaagag acttggagtg 960

tgcaccagct gcaacaacag ctgcatcaac agcaagaaca ccgttggtgg tggtgatacc 1020

cttgagagca cgaccttcag tctcgaatcc gataacacga gcagacacga actctccacc 1080

gttagcgatg aaacgacgaa acaagagagt cacgagacct tgtgggttga tggtgtgacc 1140

gttctcttcg ataaggattc ccttggtaaa ggcgtgagac aagttaggat cgaaatcacg 1200

caatgcatca gcgctgagga tttgagtacg aacaccgttg agacgacgaa gttcccaacc 1260

tccacggtcc ctggcgaagt ctgcttctcc acggtacacg gtaaggtgac cttcgtgacg 1320

gataaggtgg ctagcatcag cctcctcagc caaggacttg atcaaaggca cagtggactt 1380

gatgaggtta cggagtgcct tagcttgctc cttcaccttg tttggtcttc cagcaagcaa 1440

gaaacgaatc aaccaaggca tgatggttgg aaagtagccg aaacggatgg acaatggacc 1500

cattgggtca agaagccact ttggaacgct agtcaagttt cctggcatgg acattggaac 1560

aacggaggaa ccgttgaagc aaccagcgtt accgaaagag gcaccttcac ctggtgggtt 1620

tggatcaatc aaggtaacct tgaatccacg acgttgaagc atcaaagcag tgcaaacacc 1680

aacgattcca gctccagcga taccaacctt cttgtggttc tcagccatgg cctgcatgca 1740

gttgacgcga ccaccggaat cggtaaggtc aggaaggtaa gagagagtct caaacttctt 1800

ctttccaatc ggaggccaca cctgcatgca gttaactctt ccgccgttgc ttgtgatgga 1860

agtaatgtcg ttgttagcct tgcgggtggc tgggaaggca gcggaggact taagtccgtt 1920

gaaaggagcg accatagtgg cctgagccgg agaggcaacc atagtagcgg aagagagcat 1980

agaggaagcc atggtggatc tgaggctgca gttactagtt ccggatctga gatagatttg 2040

tagagagaga ctggtgattt cagcgtgtcc tctccaaatg aaatgaactt ccttatatag 2100

aggaaggtct tgcgaaggat agtgggattg tgcgtcatcc cttacgtcag tggagatatc 2160

acatcaatcc acttgctttg aagacgtggt tggaacgtct tctttttcca cgatgctcct 2220

cgtgggtggg ggtccatctt tgggaccact gtcggcagag gcatcttgaa cgatagcctt 2280

tcctttatcg caatgatggc atttgtaggt gccaccttcc ttttctactg tccttttgat 2340

gaagtgacag atagctgggc aatggaatcc gaggaggttt cccgatatta ccctttgttg 2400

aaaagtctca atagcccttt ggtcttctga gactgtatct ttgatattct tggagtagac 2460

gagagtgtcg tgctccacca tgttatcaca tcaatccact tgctttgaag acgtggttgg 2520

aacgtcttct ttttccacga tgctcctcgt gggtgggggt ccatctttgg gaccactgtc 2580

ggcagaggca tcttgaacga tagcctttcc tttatcgcaa tgatggcatt tgtaggtgcc 2640

accttccttt tctactgtcc ttttgatgaa gtgacagata gctgggcaat ggaatccgag 2700

gaggtttccc gatattaccc tttgttgaaa agtctcaata gccctttggt cttctgagac 2760

tgtatctttg atattcttgg agtagacgag agtgtcgtgc tccaccatgt tggcaagctg 2820

ctctagccaa tggatctgag gctgcagtta ctagttccgg atctcccgat ctagtaacat 2880

agatgacacc gcgcgcgata atttatccta gtttgcgcgc tatattttgt tttctatcgc 2940

gtattaaatg tataattgcg ggactctaat cataaaaacc catctcataa ataacgtcat 3000

gcattacatg ttaattatta catgcttaac gtaattcaac agaaattata tgataatcat 3060

cgcaagaccg gcaacaggat tcaatcttaa gaaactttat tgccaaatgt ttgaacgatc 3120

ggatctgagg ctgcagttac tagttccgga tcttcaagca gccttagtgt cggagagttc 3180

gatcttagct ccaagaccag ccatcaaatc catgaactct gggaagctag tagcgatcat 3240

agtagcatca tcaacagtaa cagggttttc agaaacgaga cccataacga ggaagctcat 3300

agcgatacgg tgatcgaggt gggtagcgac agctgctcca gaagcgttac cgagaccctt 3360

accgtcagga cgaccacgca cgacgagaga agtctcacct tcatcgcaat caacaccgtt 3420

gagcttgaga ccgtttgcga cagcagaaag acggtcgctt tccttaacac ggagttcttc 3480

caaaccgttc ataacggtag caccttcagc gaatgcagct gcaacagcga gaattggata 3540

ctcgtcgatc atagaaggag cacggtcttc tggaacagta acacccttca aagtagaaga 3600

acgaacacgc aagtcagcca cgtcttctcc accagcaaga cgtgggttga tcacttcgat 3660

gtcggcaccc atttcctgca gagtcaagat gagaccagta cgggttgggt tcatcaaaac 3720

gttaaggatg gtgacgtcgg aacctggaac aagcaaggca gcaaccaatg ggaaagcagt 3780

agaggatgga tcacctggaa catcaatcac ttgaccggtg agcttaccac gaccttcaag 3840

acggatggta cgcacaccgt cagcatcagt ctcaacggta aggttagcac caaaaccttg 3900

aagcatcttt tcagtgtggt cacgagtcat gattggctcg ataacagtgg tgatacctgg 3960

ggtgttgaga ccagcaagca gaacagcgga cttcacttga gcggaagcca taggtaccct 4020

gtaggtgatt ggcgttggag tctttggtcc acgcaaggta actggaagac gatcaccgtc 4080

ttcagacttc acctgcacac ccatttcgcg aagtgggttc aacacacgac ccattggacg 4140

cttagtgaga gaagcgtcac caatgaaagt gctatcgaaa tcgtaaacac caacaagacc 4200

catagtcaaa cggcaaccag ttgcagcgtt accgaaatcg agaggagcct caggagcaag 4260

gagtccaccg ttaccaacac catcaatgat ccaagtatca ccttccttac ggattctggc 4320

acccatagct tgcatagcct taccagtgtt gataacatct tcaccttcca aaagaccggt 4380

gatacgagtt tcaccgctag cgagacctcc aaacatgaag gacctgtggg agatagactt 4440

gtcacctgga atacggacgg ttccagaaag accagaggac ttacgagcag ttgctggacg 4500

gctgcttgca ccgtgaagca tgcacgccgt ggaaacagaa gacatgacct taagaggacg 4560

aagctcagag ccaattaacg tcatcccact cttcttcaat ccccacgacg acgaaatcgg 4620

ataagctcgt ggatgctgct gcgtcttcag agaaaccgat aagggagatt tgcgttgact 4680

ggatttcgag agattggaga taagagatgg gttctgcaca ccattgcaga ttctgctaac 4740

ttgcgccatg gtggatctga gatagatttg tagagagaga ctggtgattt cagcgtgtcc 4800

tctccaaatg aaatgaactt ccttatatag aggaaggtct tgcgaaggat agtgggattg 4860

tgcgtcatcc cttacgtcag tggagatatc acatcaatcc acttgctttg aagacgtggt 4920

tggaacgtct tctttttcca cgatgctcct cgtgggtggg ggtccatctt tgggaccact 4980

gtcggcagag gcatcttgaa cgatagcctt tcctttatcg caatgatggc atttgtaggt 5040

gccaccttcc ttttctactg tccttttgat gaagtgacag atagctgggc aatggaatcc 5100

gaggaggttt cccgatatta ccctttgttg aaaagtctca atagcccttt ggtcttctga 5160

gactgtatct ttgatattct tggagtagac gagagtgtcg tgctccacca tgttatcaca 5220

tcaatccact tgctttgaag acgtggttgg aacgtcttct ttttccacga tgctcctcgt 5280

gggtgggggt ccatctttgg gaccactgtc ggcagaggca tcttgaacga tagcctttcc 5340

tttatcgcaa tgatggcatt tgtaggtgcc accttccttt tctactgtcc ttttgatgaa 5400

gtgacagata gctgggcaat ggaatccgag gaggtttccc gatattaccc tttgttgaaa 5460

agtctcaata gccctttggt cttctgagac tgtatctttg atattcttgg agtagacgag 5520

agtgtcgtgc tccaccatgt tggcaagctg ctctagccaa ttctagaggg ggatccggaa 5580

ctagtaactg cagcctcaga tctcggtgaa ttctgtagat atccatcaca ctggcggccg 5640

cagctcgagc atgtcgactc tcgtgggccc aattcgccct atagtgagtc gtattacaat 5700

tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgaatt tgtttacacc 5760

acaatatatc ctgcca 5776

<210> 2

<211> 1896

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60

gacgttttta atgtactgaa ttaacgccga attaattcgg gggatctgga ttttagtact 120

ggattttggt tttaggaatt agaaatttta ttgatagaag tattttacaa atacaaatac 180

atactaaggg tttcttatat gctcaacaca tgagcgaaac cctataggaa ccctaattcc 240

cttatctggg aactactcac acattattat ggagaaactc gagggtcatc agatctcggt 300

gacgggcagg accggacggg gcggtaccgg caggctgaag tccagctgcc agaaacccac 360

gtcatgccag ttcccgtgct tgaagccggc cgcccgcagc atgccgcggg gggcatatcc 420

gagcgcctcg tgcatgcgca cgctcgggtc gttgggcagc ccgatgacag cgaccacgct 480

cttgaagccc tgtgcctcca gggacttcag caggtgggtg tagagcgtgg agcccagtcc 540

cgtccgctgg tggcgggggg agacgtacac ggtcgactcg gccgtccagt cgtaggcgtt 600

gcgtgccttc cagggacccg cgtaggcgat gccggcgacc tcgccgtcca cctcggcgac 660

gagccaggga tagcgctccc gcagacggac gaggtcgtcc gtccactcct gcggttcctg 720

cggctcggta cggaagttga ccgtgcttgt ctcgatgtag tggttgacga tggtgcagac 780

cgccggcatg tccgcctcgg tggcacggcg gatgtcggcc gggcgtcgtt ctgggctcat 840

atctcattgc cccccgggat ctgcgaaagc tcgagagaga tagatttgta gagagagact 900

ggtgatttca gcgtgtcctc tccaaatgaa atgaacttcc ttatatagag gaaggtcttg 960

cgaaggatag tgggattgtg cgtcatccct tacgtcagtg gagatatcac atcaatccac 1020

ttgctttgaa gacgtggttg gaacgtcttc tttttccacg atgctcctcg tgggtggggg 1080

tccatctttg ggaccactgt cggcagaggc atcttgaacg atagcctttc ctttatcgca 1140

atgatggcat ttgtaggtgc caccttcctt ttctactgtc cttttgatga agtgacagat 1200

agctgggcaa tggaatccga ggaggtttcc cgatattacc ctttgttgaa aagtctcaat 1260

agccctttgg tcttctgaga ctgtatcttt gatattcttg gagtagacga gagtgtcgtg 1320

ctccaccatg ttatcacatc aatccacttg ctttgaagac gtggttggaa cgtcttcttt 1380

ttccacgatg ctcctcgtgg gtgggggtcc atctttggga ccactgtcgg cagaggcatc 1440

ttgaacgata gcctttcctt tatcgcaatg atggcatttg taggtgccac cttccttttc 1500

tactgtcctt ttgatgaagt gacagatagc tgggcaatgg aatccgagga ggtttcccga 1560

tattaccctt tgttgaaaag tctcaatagc cctttggtct tctgagactg tatctttgat 1620

attcttggag tagacgagag tgtcgtgctc caccatgttg gcaagctgct ctagccaaac 1680

ccaacttaat cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc 1740

ccgcaccgat cgcccttccc aacagttgcg cagcctgaat ggcgaatgct agagcagctt 1800

gagcttggat cagattgtcg tttcccgcct tcagtttaaa ctatcagtgt ttgacaggat 1860

atattggcgg gtaaacctaa gagaaaagag cgttta 1896

<210> 3

<211> 1596

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tcaagcagcc ttagtgtcgg agagttcgat cttagctcca agaccagcca tcaaatccat 60

gaactctggg aagctagtag cgatcatagt agcatcatca acagtaacag ggttttcaga 120

aacgagaccc ataacgagga agctcatagc gatacggtga tcgaggtggg tagcgacagc 180

tgctccagaa gcgttaccga gacccttacc gtcaggacga ccacgcacga cgagagaagt 240

ctcaccttca tcgcaatcaa caccgttgag cttgagaccg tttgcgacag cagaaagacg 300

gtcgctttcc ttaacacgga gttcttccaa accgttcata acggtagcac cttcagcgaa 360

tgcagctgca acagcgagaa ttggatactc gtcgatcata gaaggagcac ggtcttctgg 420

aacagtaaca cccttcaaag tagaagaacg aacacgcaag tcagccacgt cttctccacc 480

agcaagacgt gggttgatca cttcgatgtc ggcacccatt tcctgcagag tcaagatgag 540

accagtacgg gttgggttca tcaaaacgtt aaggatggtg acgtcggaac ctggaacaag 600

caaggcagca accaatggga aagcagtaga ggatggatca cctggaacat caatcacttg 660

accggtgagc ttaccacgac cttcaagacg gatggtacgc acaccgtcag catcagtctc 720

aacggtaagg ttagcaccaa aaccttgaag catcttttca gtgtggtcac gagtcatgat 780

tggctcgata acagtggtga tacctggggt gttgagacca gcaagcagaa cagcggactt 840

cacttgagcg gaagccatag gtaccctgta ggtgattggc gttggagtct ttggtccacg 900

caaggtaact ggaagacgat caccgtcttc agacttcacc tgcacaccca tttcgcgaag 960

tgggttcaac acacgaccca ttggacgctt agtgagagaa gcgtcaccaa tgaaagtgct 1020

atcgaaatcg taaacaccaa caagacccat agtcaaacgg caaccagttg cagcgttacc 1080

gaaatcgaga ggagcctcag gagcaaggag tccaccgtta ccaacaccat caatgatcca 1140

agtatcacct tccttacgga ttctggcacc catagcttgc atagccttac cagtgttgat 1200

aacatcttca ccttccaaaa gaccggtgat acgagtttca ccgctagcga gacctccaaa 1260

catgaaggac ctgtgggaga tagacttgtc acctggaata cggacggttc cagaaagacc 1320

agaggactta cgagcagttg ctggacggct gcttgcaccg tgaagcatgc acgccgtgga 1380

aacagaagac atgaccttaa gaggacgaag ctcagagcca attaacgtca tcccactctt 1440

cttcaatccc cacgacgacg aaatcggata agctcgtgga tgctgctgcg tcttcagaga 1500

aaccgataag ggagatttgc gttgactgga tttcgagaga ttggagataa gagatgggtt 1560

ctgcacacca ttgcagattc tgctaacttg cgccat 1596

<210> 4

<211> 1560

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttaggatgca ggaccagttt gcttggactt accaataccg aaacggtttg gtgcgaatgg 60

agagatgtcg atagaggtct tctcacctgc gaggagctca gaaacgaggg ttgcggtcat 120

tggagcacca gtcataccga ggtgaccgtg accgaaagcg tagataacgt ctggagtacg 180

ggtagcacga ccaatcactg gaagggaatc cgggatgctt ggacggaaac ccatccactt 240

ggagtaacgt tcttcagaac tggcaggagc gagagctgga agcaacttac gagcgcgagt 300

gtagagaacg tgagcacgct tccagttagg agcagcagtg agaccagcga actcaacggt 360

tccagcaaca cgaagaccca tctccatagg agtagcgatg aactttccag aagcatcggt 420

agttggaata cgtggagcag cttctgggtt ggcgatcacg atgtggtatc cacgttcggt 480

atccaatggg atgtcatcac caagggagtt agcaagagac ttggagtgtg caccagctgc 540

aacaacagct gcatcaacag caagaacacc gttggtggtg gtgataccct tgagagcacg 600

accttcagtc tcgaatccga taacacgagc agacacgaac tctccaccgt tagcgatgaa 660

acgacgaaac aagagagtca cgagaccttg tgggttgatg gtgtgaccgt tctcttcgat 720

aaggattccc ttggtaaagg cgtgagacaa gttaggatcg aaatcacgca atgcatcagc 780

gctgaggatt tgagtacgaa caccgttgag acgacgaagt tcccaacctc cacggtccct 840

ggcgaagtct gcttctccac ggtacacggt aaggtgacct tcgtgacgga taaggtggct 900

agcatcagcc tcctcagcca aggacttgat caaaggcaca gtggacttga tgaggttacg 960

gagtgcctta gcttgctcct tcaccttgtt tggtcttcca gcaagcaaga aacgaatcaa 1020

ccaaggcatg atggttggaa agtagccgaa acggatggac aatggaccca ttgggtcaag 1080

aagccacttt ggaacgctag tcaagtttcc tggcatggac attggaacaa cggaggaacc 1140

gttgaagcaa ccagcgttac cgaaagaggc accttcacct ggtgggtttg gatcaatcaa 1200

ggtaaccttg aatccacgac gttgaagcat caaagcagtg caaacaccaa cgattccagc 1260

tccagcgata ccaaccttct tgtggttctc agccatggcc tgcatgcagt tgacgcgacc 1320

accggaatcg gtaaggtcag gaaggtaaga gagagtctca aacttcttct ttccaatcgg 1380

aggccacacc tgcatgcagt taactcttcc gccgttgctt gtgatggaag taatgtcgtt 1440

gttagccttg cgggtggctg ggaaggcagc ggaggactta agtccgttga aaggagcgac 1500

catagtggcc tgagccggag aggcaaccat agtagcggaa gagagcatag aggaagccat 1560

<210> 5

<211> 552

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tcagatctcg gtgacgggca ggaccggacg gggcggtacc ggcaggctga agtccagctg 60

ccagaaaccc acgtcatgcc agttcccgtg cttgaagccg gccgcccgca gcatgccgcg 120

gggggcatat ccgagcgcct cgtgcatgcg cacgctcggg tcgttgggca gcccgatgac 180

agcgaccacg ctcttgaagc cctgtgcctc cagggacttc agcaggtggg tgtagagcgt 240

ggagcccagt cccgtccgct ggtggcgggg ggagacgtac acggtcgact cggccgtcca 300

gtcgtaggcg ttgcgtgcct tccagggacc cgcgtaggcg atgccggcga cctcgccgtc 360

cacctcggcg acgagccagg gatagcgctc ccgcagacgg acgaggtcgt ccgtccactc 420

ctgcggttcc tgcggctcgg tacggaagtt gaccgtgctt gtctcgatgt agtggttgac 480

gatggtgcag accgccggca tgtccgcctc ggtggcacgg cggatgtcgg ccgggcgtcg 540

ttctgggctc at 552

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gaaggcacgc aacgcctacg a 21

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tggcatgacg tgggtttctg g 21

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gtggggattg aagaagagtg g 21

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ccaaagactc caacgccaat 20

Claims (2)

1. The application of the double T-DNA carrier pBID-RT Enhanced in the cabbage rape genetic transformation is characterized in that the carrier pBID-RT Enhanced takes a plasmid of pCAMBIA3300 as a base and comprises two reverse independent T-DNA regions, the nucleotide sequence of the first T-DNA region is shown as SEQ ID NO.1, and the nucleotide sequence of the second T-DNA region is shown as SEQ ID NO. 2; the distance between the first T-DNA region and the second T-DNA region is greater than 2 kb.

2. The use according to claim 1, wherein the method of agrobacterium-mediated genetic transformation is used to transform oilseed rape.

Images