CN111206044A - Novel plasmid vector construction method - Google Patents

Abstract

The invention discloses a new plasmid vector construction method. The invention firstly discloses a method for constructing a recombinant vector containing exogenous target DNA molecules by using CRISPR/Cpf1 or CRISPR/Cas 9; further disclosed are kits comprising crRNA and Cpf1 protein or gRNA and Cas9 protein. The method utilizes crRNA and Cpf1 protein or gRNA and Cas9 protein to replace restriction endonuclease to linearize a vector to obtain a linearized vector; obtaining an insert fragment with homology arms at two ends by using a PCR method, wherein the homology arms at the two ends are respectively homologous with sequences at two ends of the linearized vector; the insert is recombined on a linearized vector by using a homologous recombination cloning method, a new vector is finally constructed, any restriction enzyme and ligase are not used in the whole construction process, and the construction method is convenient, flexible, universal, simple and efficient.

Description

Novel plasmid vector construction method

Technical Field

The invention relates to the field of biotechnology. In particular to a new plasmid vector construction method, in particular to a method for constructing a recombinant vector containing exogenous target DNA molecules by adopting a CRISPR system.

Background

Restriction endonucleases are enzymes of the type that recognize and attach specific deoxyribonucleotide sequences and cleave the phosphodiester bond between two deoxyribonucleotides at specific positions in each strand, referred to as restriction enzymes. According to the structure of the restriction enzyme, the requirement of the cofactor is cut and acted on the way, can be divided into three types with the restriction enzyme, be first Type (Type I), second Type (Type II) and third Type (Type III) respectively. The two types of restriction enzymes are used in the linearization of various plasmid vectors and in vector construction because their recognition sites overlap or are adjacent to the cleavage sites, and their recognition sites are usually added to the plasmid vector to form a multiple cloning site MCS. Restriction enzymes are used in the construction of almost all vectors. The use of restriction enzyme facilitates the construction process of plasmid vector, but is limited by the type of recognition site, the random transformation of plasmid vector can not be realized, and the recognition sequence residue exists after the insertion sequence, and the seamless insertion can not be realized.

The existing most commonly used plasmid vector construction methods comprise two methods, one is an enzyme digestion connection method, namely a restriction enzyme digestion vector and an insert fragment, the restriction enzyme digestion vector and the insert fragment are connected by T4 DNA ligase, and then positive clone is obtained through transformation, resistance screening and identification; the other is a homologous recombination cloning method, namely, a vector is digested by using restriction enzymes, homologous sequences on two sides of a digestion site on the vector are introduced on two sides of a PCR product of an inserted segment, then in-vitro recombination between the vector segment and the inserted segment is realized by using recombinase, and positive clone is obtained through transformation (the recombined clone with gaps can be repaired in escherichia coli), resistance screening and identification. However, both methods are limited by restriction enzymes and recognition sites thereof, so that plasmid vector construction can be carried out only at the restriction enzyme recognition sites, and redundant restriction enzyme recognition sequences are reserved in the modified plasmid vector.

CRISPR systems were first deployed in 2013 in mammalian gene editing, relying on a guide RNA to guide Cas or other kinds of DNA cleaving proteins, which can recognize specific DNA sequences and cause double strand breaks thereof. Different guide RNAs can recognize different targets, realize specific recognition and fragmentation in the genome of the mammal and finish gene editing.

However, there are few reports on vector construction using CRISPR system so far.

Disclosure of Invention

The invention aims to solve the technical problem of finding a method capable of replacing restriction enzyme to realize the construction of a seamless recombinant vector containing exogenous DNA molecules.

In order to solve the technical problems, the invention firstly provides a method for constructing a recombinant vector containing an exogenous DNA molecule of interest by using CRISPR/Cpf1 or CRISPR/Cas 9.

The method is a CRISPR/Cpf1 method or a CRISPR/Cas9 method;

the CRISPR/Cpf1 method comprises the following steps:

1) obtaining a skeleton vector, wherein the skeleton vector is a vector (a cloning vector or an expression vector) containing a PAM sequence identified by the Cpf1 protein, and the PAM sequence identified by the Cpf1 protein is named as Cpf 1-PAM;

2) preparing CRISPR RNA (crRNA) by taking a downstream DNA sequence of the Cpf1-PAM in the skeleton vector as a target sequence;

3) cutting the skeleton vector by using the crRNA and the Cpf1 protein to obtain a linearized vector

4) Respectively adding homologous arms which are respectively homologous with the two ends of the linearized vector to the two ends of the exogenous target DNA molecule, and then obtaining a recombinant vector containing the exogenous target DNA molecule by a homologous recombination cloning method with the linearized vector;

the CRISPR/Cas9 method comprises the following steps:

1) obtaining a framework vector, wherein the framework vector is a vector (a cloning vector or an expression vector) containing a PAM sequence recognized by a Cas9 protein, and the PAM sequence recognized by the Cas9 protein is named as Cas 9-PAM;

2) preparing guide RNA (gRNA) by taking an upstream DNA sequence of the Cas9-PAM in the skeleton vector as a target sequence;

3) cutting the framework vector by using the gRNA and the Cas9 protein to obtain a linearized vector;

4) and respectively adding homologous arms which are respectively homologous with the two ends of the linearized vector to the two ends of the exogenous target DNA molecule, and then obtaining the recombinant vector containing the exogenous target DNA molecule by a homologous recombination cloning method with the linearized vector.

In the above method, the Cpf1-PAM is 5 '-YTN-3'; the Cas9-PAM is 5 '-NGG-3'; wherein Y represents T or C, and N represents A, T, G or C.

In the above method, the downstream DNA sequence of Cpf1-PAM is separated from the Cpf1-PAM by 0 base;

the upstream DNA sequence of Cas9-PAM is separated from the Cas9-PAM by 0 bases.

In the method, the length of the downstream DNA sequence of Cpf1-PAM may be 17-30 bp;

the upstream DNA sequence of Cas9-PAM can be 17-30bp in length.

The invention further provides a kit of reagents.

The reagent set is a reagent A or a reagent B;

the reagent A comprises crRNA and Cpf1 protein;

the agent B includes gRNA and Cas9 proteins.

The reagent A in the kit also comprises a skeleton carrier A, wherein the skeleton carrier A contains a PAM sequence of Cpf1 protein, the PAM sequence recognized by the Cpf1 protein is named as Cpf1-PAM, and the crRNA is specifically bound with a downstream DNA sequence of the Cpf1-PAM in the skeleton carrier;

the reagent B in the kit also comprises a framework vector B, wherein the framework vector B contains a PAM sequence of a Cas9 protein, the PAM sequence recognized by the Cas9 protein is named as Cas9-PAM, and the gRNA is specifically combined with an upstream DNA sequence of the Cas9-PAM in the framework vector.

In the kit, the Cpf1-PAM is 5 '-YTN-3'; the Cas9-PAM is 5 '-NGG-3'; wherein Y represents T or C, and N represents A, T, G or C.

The invention further provides the application of the kit in constructing a recombinant vector containing the exogenous DNA molecule of interest.

The invention uses the specific recognition and breaking capacity of Cpf1 protein and crRNA or Cas9 protein and gRNA to DNA to replace restriction endonuclease, and combines with a homologous recombination cloning method independent of DNA ligase, and applies the method to vector construction, and the method is convenient, flexible, universal, simple and efficient, and is embodied in the following points:

1. specific restriction enzyme recognition sites do not need to exist on the vector, restriction enzymes are not used, the recognition of the target by the gRNA or the crRNA requires that a PAM sequence exists at the downstream or the upstream of the target sequence, so that a multi-cloning site sequence with the restriction enzyme recognition sites does not need to be inserted into the vector.

2. Since it is not necessary to insert a multiple cloning site sequence into the vector, seamless ligation of the vector and the insert (construction using homologous recombinant cloning) can be achieved when constructing a recombinant vector, without introducing any redundant sequences between the vector and the insert.

3. Because a plurality of PAM sequences exist on the vector (the PAM sequences can appear once every 16bp on average, a complementary strand can also be used as a recognition target sequence, and a target point can be designed in every 8bp on average), the PAM sequences can be found on two sides of the sequence to be modified to carry out vector fragmentation at a high probability, and various modifications including insertion, deletion and mutation can be carried out at any position in a plasmid vector or a BAC vector by combining a homologous recombination cloning method.

4. For ease of use, a fixed target and PAM sequence can be introduced at the vector common cleavage site, so that cleavage at the common site can be achieved using a fixed gRNA and Cas9 protein combination or a crRNA and Cpf1 protein combination.

Drawings

Fig. 1 is a flow diagram of construction of a recombinant vector using the CRISPR system.

FIG. 2 is a schematic diagram of the structure of pX330 vector.

FIG. 3 shows the design of Cpf1/crRNA cleavage sites.

FIG. 4 shows the result of agarose gel electrophoresis of the cut pX330 vector.

FIG. 5 shows the electrophoresis results of the PCR products of the P2AEGFP fragment containing the homology arms.

FIG. 6 shows the result of PCR identification electrophoresis of pX330-P2AEGFP colonies; wherein 1-10 represent 10 different clones, respectively.

FIG. 7 shows the comparison of the PCR-identified positive colony sequencing result of pX330-P2AEGFP colony with the theoretical sequence.

FIG. 8 is a schematic diagram of the structure of pX330-P2AEGFP vector.

FIG. 9 is a schematic structural diagram of a PB-GFP vector.

FIG. 10 is a design of Cas9/gRNA cleavage site.

FIG. 11 shows the results of electrophoresis of cleaved PB-GFP plasmid.

FIG. 12 is a schematic diagram showing the structure of the insert fragment of puro expression cassette containing homology arms.

FIG. 13 is a schematic diagram showing the positions of amplification primers of the puro expression cassette insert containing the homology arms.

FIG. 14 shows the result of electrophoresis of PCR products containing the insert of puro expression cassette of homology arm.

FIG. 15 shows the results of PCR-based electrophoresis of PB-GFP-puro colonies; wherein 1-10 represent 10 different clones, respectively.

FIG. 16 shows the comparison of the sequencing result of positive colonies identified by PCR on PB-GFP-puro colonies with the theoretical sequence.

FIG. 17 is a schematic structural diagram of a PB-GFP-puro vector.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The sources of the materials used in the examples of the invention are as follows:

the pX330 vector was purchased from addge (Plasmid #42230, from Feng Zhang lab), and has the structure shown in FIG. 2, which is the sequence obtained by replacing position 5475-6312 of SEQ ID NO.9 with the following sequence: CCGGCCAGGCAAAAAAGAAAAAGTAAGAATTCCTAGAGCTCGCTGATCAGCCTCG, the other sequences remain unchanged from the resulting sequence.

The PB-GFP vector is a fluorescence screening vector constructed on the basis of a PiggyBac vector, the structure diagram is shown in figure 9, the full length is 5879bp, the sequence is obtained by deleting 1727-3171-bit of SEQ ID NO.15, and other sequences are kept unchanged.

The Phanta Max PCR kit was purchased from nuozoken under the accession number P505.

The Clonexpress II One Step Cloning Kit homologous recombination Cloning Kit was purchased from Novowed under the accession number C112

The invention discloses a CRISPR (Cas9/gRNA or Cpf1/crRNA and the like) complex for replacing a restriction endonuclease to linearize a vector to obtain a linearized vector; and obtaining insertion fragments with homologous arms (15-20bp) which are respectively added at two ends and are respectively homologous with two ends of the linearized vector by using a PCR method; and recombining the insert to a linearized vector by using a homologous recombination cloning method, converting competent engineering bacteria, screening to obtain positive clones, and further sequencing to confirm that the vector is successfully constructed. The whole vector construction process is shown in figure 1, no restriction enzyme or ligase is used, and the construction method is convenient, flexible, universal, simple and efficient. The present invention will be described in detail with reference to the following examples 1 and 2.

Example 1 construction of pX330-P2AEGFP vector Using CRISPR/Cpf1

The Cpf1/crRNA is used as a GE (guide Endonuclease) guide endonuclease, and a P2AEGFP sequence is inserted after a nuclear localization signal coding sequence in a pX330 vector, so that the vector has the fluorescence screening and enriching capacity.

Specifically cleaving 1 site of Cpf1/crRNA in the region immediately before and after the stop codon of the Nuclear Localization Signal (NLS) coding sequence of pX330 plasmid (the structure is shown in FIG. 2, the sequence is obtained by replacing the 5475-6312 site of SEQ ID NO.9 with CCGGCCAGGCAAAAAAGAAAAAGTAAGAATTCCTAGAGCTCGCTGATCAGCCTCG, and the other sequences are remained unchanged) to obtain linearized vector; an insert of P2AEGFP (hereinafter referred to as a P2AEGFP fragment containing a homology arm) having homology arms at both ends thereof which are homologous to both ends of the linearized vector is obtained by PCR, and the vector pX330-P2AEGFP is obtained by homologous recombination cloning. The method comprises the following specific steps:

preparation of linear carrier

1. Design of Cpf1/crRNA cleavage sites

The target was designed in the region of the pX330 vector immediately before and after the termination codon of the NLS coding sequence, and there was no overlap between the targets, ensuring that both targets could be recognized and cleaved simultaneously, as shown in fig. 3.

The crRNA target sequences are as follows:

GFP-KI-crRNA1 target sequence and PAM sequence:TTACTTTTTCTTTTTTGCCTGGC (SEQ ID NO.1), wherein the underlined nucleotides are PAM sequences, and the 4 th to 23 th positions of the SEQ ID NO.1 are GFP-KI-crRNA1 target sequences;

GFP-KI-crRNA2 target sequence and PAM sequence:TTCCTAGAGCTCGCTGATCAGCC (SEQ ID NO.2), wherein the underlined nucleotides are a PAM sequence, and positions 4-23 of the SEQ ID NO.2 are a GFP-KI-crRNA2 target sequence.

(Cpf1 cleavage site: at nucleotide 18 of the sense strand and at nucleotide 23 of the antisense strand downstream of the PAM sequence)

2. In vitro transcription to obtain crRNA for use in fragmentation vectors

The crRNA can be obtained by an in vitro transcription method, or can be chemically synthesized, and can be modified to enhance the stability. In vitro transcription of RNA is a relatively simple and rapid method for obtaining crRNA, and the following method provides a method for obtaining crRNA for targeting binding to a carrier by in vitro transcription of RNA:

2.1 preparation of in vitro transcribed DNA templates

Through a whole gene synthesis method, PCR obtains the following two sequence PCR products as an in vitro transcription DNA template, namely GFP-KI-crRNA 1-in vitro transcription DNA template shown by SEQ ID NO.3 (wherein, the 1 st to 109 th positions of the SEQ ID NO.3 are used for increasing the sequence length, the 110 nd and 125 th positions of the SEQ ID NO.3 are T7 promoters, the 126 th and 145 th positions of the SEQ ID NO.3 are crRNA skeleton sequences, the 146 th and 165 th positions of the SEQ ID NO.3 are crRNA target sequences, namely GFP-KI-crRNA1 target sequences) and GFP-KI-crRNA 2-in vitro transcription DNA template shown by SEQ ID NO.4 (wherein, the 1 st to 109 th positions of the SEQ ID NO.4 are used for increasing the sequence length, the 110 th and 125 th positions of the SEQ ID NO.4 are T7 promoters, the 126 th and 145 th positions of the SEQ ID NO.4 are crRNA skeleton sequences, the 146 th position of the SEQ ID NO. 165 is a crRNA sequence, i.e., the GFP-KI-crRNA2 target sequence). The method comprises the following specific steps:

the reaction system is as follows:

composition of	Volume ul
		ddH2O (without RNase)	To 50ul
2×Phanta Max Buffer	25ul
		dNTP(10mM)	1ul
DMSO	2ul
		Primer mix (10uM 0.1ul per Primer)	0.4ul
F primer T7-crRNA-1(10uM)	1ul
		R primer T7-crRNA1-4 or T7-crRNA2-4(10uM)	1ul
Phanta Max	1ul
		Total volume	50ul

Note: when a GFP-KI-crRNA 1-in vitro transcription DNA template is synthesized by a whole gene, the Primer mix is a mixture of T7-crRNA-1, T7-crRNA-2, T7-crRNA-3 and T7-crRNA1-4, and the R Primer is T7-crRNA 1-4; when GFP-KI-crRNA 2-in vitro transcription DNA template is synthesized by whole gene, the Primer mix is a mixture of T7-crRNA-1, T7-crRNA-2, T7-crRNA-3 and T7-crRNA2-4, and the R Primer is T7-crRNA 2-4.

The PCR conditions were as follows:

circulating at 95 deg.C for 3min (95 deg.C for 15s and 58 deg.C for 15s and 72 deg.C for 20s) for 35 times and 5min at 72 deg.C; storing at 4 ℃.

The whole gene synthesis primer sequence is as follows:

after the PCR is finished, 3ul of PCR products is run through 1% agarose electrophoresis to determine that the products are correct in size, and the correct PCR products are reserved at the temperature of-20 ℃, namely a 165bp GFP-KI-crRNA 1-in vitro transcription DNA template (SEQ ID NO.3) and a GFP-KI-crRNA 2-in vitro transcription DNA template (SEQ ID NO.4) are respectively obtained through whole gene synthesis.

2.2 in vitro transcription

In vitro transcription was performed separately on the GFP-KI-crRNA 1-in vitro transcribed DNA template and GFP-KI-crRNA 2-in vitro transcribed DNA template according to the in vitro transcription kit instructions (Thermo # K0441). Four kinds of TranscriptAId Enzyme Mix and NTP, put on ice to dissolve, 5X TranscriptAId Reaction Buffer room temperature dissolution and placement (the low temperature easily with NTP and DNA to produce the precipitation), four kinds of NTP Mix in the tube in advance, use each reagent Mix centrifugation.

Preparing an in vitro transcription system: at room temperature, the components are added in the following order, the system is mixed and centrifuged, and the reaction is carried out for 6 hours at 37 ℃ to obtain the in vitro transcription product. In vitro transcripts were stored at-80 ℃ without purification on the same day.

2.3 in vitro transcript purification

By MEGAclear^TMKit Purification (Thermo AM1908) was performed to obtain purified products GFP-KI-crRNA 1-in vitro transcribed RNA (GUAAUUUCUACUGUUGUAGAUCUUUUUCUUUUUUGCCUGGC, SEQ ID NO. 5) and GFP-KI-crRNA 2-in vitro transcribed RNA (GUAAUUUCUACUGUUGUAGAUCUAGAGCUCGCUGAUCAGCC, SEQ ID NO. 6) which were dissolved in 50ul RNase-free water, quantified, and stored at-80 ℃.

3. FnCpf1/crRNA complex in vitro cutting pX330 plasmid containing target spot, and recovering linearized vector

3.1 preparation of FnCpf1 protein

FnCpf 1-derived prokaryotic expression (pET28a-FnCpf1) and purification via a 6 × His tag fused thereto. The amino acid sequence of FnCpf1 prokaryotic-expressed by pET28a-FnCpf1 is shown as SEQ ID NO.7, wherein, the 25 th to 1323 th sites of SEQ ID NO.7 are the sequence of FnCpf1, the 1 st to 24 th sites of SEQ ID NO.7 are the sequence containing 6 His label, and the 1324 th and 1376 th sites of SEQ ID NO.7 are the sequence containing nuclear localization signal and 6 His label.

3.2 preparation of linearized vector

The components were mixed as follows, and after adding all the components, the reaction was carried out at 37 ℃ for 1 hour.

2.0ul (20mg/ml) of proteinase K and 1ul (10mg/ml) of RNase A (derived from TaKaRa MiniBESTUniversal Genomic DNA Extraction Kit Ver.5.0 Code No.9765) were added and reacted at room temperature for 30 minutes to obtain a cleaved pX330 plasmid.

Adding DNA loading buffer into the cut pX330 plasmid, mixing, detecting by agarose gel electrophoresis, and judging whether the cutting is complete by using the mixture of 0.5ug pX330 plasmid and DNA loading buffer as a control.

The results are shown in FIG. 4, where the cut pX330 plasmid was slower than the plasmid pX330, consistent with the electrophoresis speed of linear DNA versus supercoiled DNAThe slow character, indicates that the cleaved pX330 plasmid has been linearized. The linearized vector cleaved from the FnCpf1/crRNA complex was purified and recovered using a Gel recovery Kit (Novozam FastPure Gel DNA Extraction Mini Kit # DC301), and dissolved in 50ul ddH₂O at-20 ℃ for later use.

II, preparation of the insert

The P2AEGFP fragment containing the homology arm shown in SEQ ID NO.8 is obtained by PCR through an EGFP-containing plasmid template pEGFP-N1 (purchased from Clontech company, the code number is #6085-1), and is recovered by gel to obtain the P2AEGFP fragment containing the homology arm shown in SEQ ID NO.8, wherein the 1 st to 16 th positions of the SEQ ID NO.8 are upstream homology arm sequences, the 17 th to 39 th positions of the SEQ ID NO.8 are carrier sequences (which are NLS part coding sequences) for complementing crRNA/cpf1 cutting, the 40 th to 48 th positions of the SEQ ID NO.8 are GSG coding sequences, the 49 th to 105 th positions of the SEQ ID NO.8 are P2A sequences, the 106 th and 825 th positions of the SEQ ID NO.8 are EGFP coding sequences, the 826 th and 854 nd positions of the SEQ ID NO.8 are carrier sequences for complementing crRNA/cpf1 cutting, and the 855 nd and 870 nd positions of the SEQ ID NO.8 are downstream homology arm sequences. The method comprises the following specific steps:

to amplify the P2AEGFP fragment containing the homology arm, PCR was performed using pEGFP-N1 as a template and P2AEGFP-F1/P2AEGFP-R1, and PCR was performed using the resulting PCR product as a template, using P2AEGFP-F2/P2AEGFP-R1 as primers, using the resulting PCR product as a template, and using P2AEGFP-F3/P2AEGFP-R2 as primers, to obtain a PCR product.

Wherein, the reaction system is as follows:

composition of	Volume ul
		ddH2O	To 50ul
2×Phanta Max Buffer	25ul
		dNTP(10mM)	1ul
DMSO	2ul
		Template plasmid (10ng/ul)/PCR product	1ul
F primer (10uM)	1ul
		R primer (10uM)	1ul
Phanta Max	1ul
		Total volume	50ul

The PCR conditions were as follows:

circulating at 95 deg.C for 3min (95 deg.C for 15s and 58 deg.C for 15s and 72 deg.C for 30s) for 35 times and 5min at 72 deg.C; storing at 4 ℃.

The primer sequences are as follows:

the PCR product was subjected to 1% agarose electrophoresis and separated, as shown in FIG. 5, and the desired fragment, i.e., the homologous arm-containing P2AEGFP fragment (insert fragment) shown in SEQ ID NO.8 was recovered with a Gel recovery Kit (Novozae FastPug DNA Extraction Mini Kit # DC301), and dissolved in 50ul ddH₂O at-20 ℃ for later use.

Thirdly, obtaining a recombinant reaction product by adopting a homologous recombination cloning method

Homologous recombination Cloning was performed using the homologous recombination Cloning Kit (Novozan Clonexpress II One Step Cloning Kit # C112) on the linearized vector obtained in Step One (the linearized vector recovered by cleavage of the Cpf1/crRNA complex) and the insert obtained in Step two (the homology-arm-containing P2 GFP AEfragment shown in SEQ ID NO. 8). The method comprises the following specific steps:

adding the components according to the following reaction system, mixing, reacting at 37 ℃ for 30min, immediately placing on ice after the reaction is finished, and converting to obtain a recombinant reaction product.

Wherein, the reaction system is as follows:

composition of	Volume ul
		Linearized vector	85ng
Insert fragment	20ng
		5×CE II Buffer	2ul
Exnase II	1ul
		ddH2O	To 10ul

Fourth, transformation and culture

1) 100 μ L of DH5 α chemically competent cells (Vazyme # C502) were placed in an ice bath;

2) adding 10 mu L of the recombinant reaction product obtained in the third step into a centrifuge tube filled with competent cells, uniformly mixing, and standing in an ice bath for 30 min;

3) placing the competent cells in ice bath for 30min in water bath at 42 deg.C for 90s, and rapidly transferring to ice bath to cool the cells for 3 min;

4) adding 300 μ L sterile LB culture medium (without antibiotic) into the centrifuge tube, mixing, and shake culturing at 37 deg.C with 220rpm shaking table for 60 min;

5) adding 100uL of competent cells to an LB solid agar medium containing corresponding antibiotics, and uniformly coating the competent cells by using a sterile coating rod; and (3) inverting the LB solid agar culture medium coated with the competent cells into an incubator at 37 ℃ for culturing for 12-16 h to obtain a plate.

Fifth, clone identification and sending test

10 clones were picked from the plate constructed in step four, and each of them was placed in LB medium containing 300. mu.l of Amp resistance, incubated overnight at 37 ℃ and colony PCR was identified the next day with the primer Cas9-3-F/BGH-R using Green Taq Mix (cat # P131) of Nodezan.

Wherein, the reaction system is as follows:

ddH2O	to 20ul
		Green Taq Mix	10ul
Primer 1(10uM)	0.8ul
		Primer 2(10uM)	0.8ul
Template bacterial liquid	1ul
		Total volume	20ul

The reaction conditions were as follows:

the primer sequences are as follows:

Cas9-3-F	AGAGGTGCTGGACGCCACCCTG
		BGH-R	GTGGCACCTTCCAGGGTCAAGG

after the PCR is completed, 10 clones are taken, 3ul of each clone is taken to be subjected to 1% agar gel electrophoresis analysis, and the band is 1022bp and is identified as positive. The PCR identification result of the bacterial liquid is shown in FIG. 6, and the result shows that 10 clones are positive.

And identifying positive clone bacterial liquid, sending the positive clone bacterial liquid to a general biological company for sequencing, sequencing primers Cas9-3-F and BGH-R, comparing the sequencing results with predicted sequences, as shown in FIG. 7, showing that 10 clones have no forward sequencing result except one clone (namely No. 5), the reverse sequencing is incomplete, and the sequencing of other 9 clones is correct, and confirming that the Cpf1/crRNA replaces commercial restriction enzyme to construct a pX330-P2AEGFP vector inserted with P2 AEGFP.

Cloning with correct sequencing result, respectively taking 20ul of bacterial liquid, culturing in a test tube containing 3ml of Amp LB overnight, and performing plasmid extraction by using a plasmid miniprep kit on the next day to obtain a recombinant vector pX330-P2AEGFP vector (the structure is shown in figure 8, the sequence is shown in SEQ ID NO.9, wherein the 5507-6283 bit of the SEQ ID NO.9 is a P2AEGFP sequence) and storing at-20 ℃ for later use.

Example 2 construction of PB-GFP-puro vector Using CRISPR/Cas9

A PB-GFP-puro vector is obtained by inserting a puro expression frame into a PB-GFP vector (the structure diagram is shown in figure 9, the sequence is a sequence obtained by deleting 1727 th-3171 th site of SEQ ID NO.15 and keeping other sequences unchanged) by using Cas9/gRNA as a GE (guide endonuclease) guide endonuclease, and the PB-GFP vector is used for screening and enriching cells into which the vector is successfully transfected.

The insertion of a puro expression Cassette (loxp-SV40 promoter-puro-SV 40 polyA signals-loxp) between the Ins2(Insulator2) and pGK Cassette expression cassettes of the PB-GFP vector requires a break between the two elements, but there is no suitable single cleavage site for the insertion of the puro expression Cassette between the Ins2 and pGK expression cassettes. According to the invention, Cas9/gRNA is used for carrying out specific breakage between an Ins2 and a pGK Cassette expression frame of a PB-GFP vector to obtain a linearized vector; meanwhile, an insert fragment containing a puro expression frame is obtained through PCR, homology arms (hereinafter referred to as puro expression frames containing homology arms) which are respectively homologous with two ends of a linearization vector are intentionally introduced into two ends of the insert fragment during PCR, and a PB-GFP-puro vector is obtained through a homologous recombination cloning method, and the specific process is as follows:

first, preparation of vector fragment

1. Design of cleavage sites

puro-KI-gRNA target and PAM sequence: GCTCGTAGATGGCCAGCAGCTGG(SEQ ID NO.10, in which the PAM sequence is underlined and the puro-KI-gRNA target sequence is found at positions 1 to 20 of SEQ ID NO. 10), the results are shown in FIG. 10, where the theoretical cleavage site is a vertical line, and one base G which is missing from pGK cassette can be simultaneously complemented by integrating the puro expression cassette.

2. In vitro transcription to obtain gRNA for cutting vector

The gRNA can be obtained by an in vitro transcription method, or can be chemically synthesized, and the gRNA can be modified to enhance the stability. In vitro RNA transcription is a relatively simple and rapid method for obtaining grnas, and the following provides a method for obtaining grnas for targeted binding to a vector by in vitro RNA transcription:

2.1 preparation of in vitro transcribed DNA templates

Through a whole gene synthesis method, PCR obtains the following sequence PCR product as an in vitro transcription template, namely the Puro-KI-gRNA-in vitro transcription DNA template shown in SEQ ID No.11 (wherein, the 110 th and 125 th positions of the SEQ ID No.11 are T7 promoters, the 126 th and 145 th positions of the SEQ ID No.11 are Puro-KI-gRNA target sequences, and the 146 th and 225 th positions of the SEQ ID No.11 are gRNA framework sequences). The method comprises the following specific steps:

the reaction system is as follows:

composition of	Volume ul
		ddH2O (without RNase)	To 50ul
2×Phanta Max Buffer	25ul
		dNTP(10mM)	1ul
DMSO	2ul
		Primer mix (10uM 6 primers each 0.1ul)	0.6ul
F primer gRNA-1(10uM)	1ul
		R primer gRNA-6(10uM)	1ul
Phanta Max	1ul
		Total volume	50ul

Note: the Primer mix is a mixture of T7-gRNA-1, T7-gRNA-2, T7-gRNA-3, T7-gRNA-4, T7-gRNA-5 and T7-gRNA-6.

The reaction conditions were as follows

The primer sequences for the whole gene synthesis are as follows

After the PCR is finished, 3ul of PCR products is run through 1% agarose electrophoresis to determine that the products are correct in size, and the correct PCR products are reserved at 20 ℃ below zero, namely a 225bp Puro-KI-gRNA-in vitro transcription DNA template (SEQ ID NO.11) is obtained through whole gene synthesis.

2.2 in vitro transcription

In vitro transcription (Thermo # K0441) of Puro-KI-gRNA-in vitro transcription DNA template was performed according to the in vitro transcription kit instructions, four kinds of TranscriptAId Enzyme Mix and NTP were dissolved on ice, 5 × TranscriptAId reaction Buffer was dissolved and placed at room temperature (the precipitation of NTP and DNA is easily caused by low temperature), and the four kinds of NTP were mixed in a tube in advance, and the reagents were mixed and centrifuged before use.

In vitro transcription system: at room temperature, the components are added in the following order, the system is mixed and centrifuged, and the reaction is carried out for 6 hours at 37 ℃ to obtain the in vitro transcription product. In vitro transcripts were stored at-80 ℃ without purification on the same day.

DEPC water	4ul
		Template PCR product	2ul(2ug)
5 × transcription reaction buffer	4ul
		ATP/CTP/GTP/UTP mix	8ul (mix in advance)
Transcriptase Mix	2ul
		General System	20ul

2.3 in vitro transcript purification

By MEGAclear^TMKit Purification (Thermo AM1908) was performed to obtain purified puro-KI-gRNA-RNA (GGCUCGUAGAUGGCCAGCAGCGUUUUAGAGCUAGAAAUAGCAAGUUAAA-AUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU, SEQ ID NO. 12) which was in vitro transcribed, dissolved in 50ul RNase-free water, quantified and stored at-80 ℃.

3. Cas9/gRNA complex in vitro cutting target-containing PB-GFP plasmid, and glue recovering linearized vector

3.1 preparation of Cas9 protein

Cas9 was expressed from prokaryotic sources (pET28a-SpCas9) and purified via a 6 × His tag fused thereto. The amino acid sequence of Cas9 prokaryotic-expressed by pET28a-SpCas9 is shown as SEQ ID NO.13, wherein, the 64 th to 1430 th sites of the SEQ ID NO.13 are the sequence of Cas9, the 1 st to 63 th sites of the SEQ ID NO.13 contain the sequence of NLS and 6 His tag, and the 1431 st and 1454 th sites of the SEQ ID NO.13 contain the sequence of 6 His tag.

3.2 preparation of linearized vector

The components were mixed as follows, and after adding all the components, the reaction was carried out at 37 ℃ for 1 hour.

2.0ul (20mg/ml) of proteinase K and 1ul (10mg/ml) of RNase A (derived from TaKaRa MiniBESTUniversal Genomic DNA Extraction Kit Ver.5.0 Code No.9765) were added and reacted at room temperature for 30 minutes to obtain a cleaved PB-GFP plasmid.

And adding DNA loading buffer into the cut PB-GFP plasmid, mixing, detecting by agarose gel electrophoresis, and judging whether the cutting is complete.

The cleaved PB-GFP plasmid was separated by agarose Gel, and the result is shown in FIG. 11 (Cas9 protein was not digested completely, which resulted in band lag and tailing, but the Gel was recovered without affecting the use, after recovery, a small amount of electrophoresis was available, which showed that the size of the cleavage product was correct and a single band), the linearized vector (i.e., the linearized PB-GFP vector) cleaved from Cas9/gRNA complex was purified and recovered by Gel recovery Kit (Novonopause FastSt Gel DNAextraction Mini Kit # DC301), and dissolved in 50ul ddH₂O at-20 ℃ for later use.

II, preparation of the insert

The insert fragment, i.e., the Puro expression cassette containing the homologous arms, is shown in FIG. 12, the sequence is shown in SEQ ID NO.14, and comprises the homologous arms (17 bp each of the left arm LR and the right arm RR, located at 1-17 and 1465-th 1481 of SEQ ID NO. 14) and the Puro expression cassette (loxp-SV40 promoter-Puro-SV 40 poly-identities-loxp, including the two loxp sequences located at 27-60 and 1423-th 1456 of SEQ ID NO.14, respectively) which are respectively homologous with both ends of the linearized vector, so as to facilitate later removal of the resistance gene by Cre recombinase, the SV40 promoter is located at 103-th and 432-th of SEQ ID NO.14, the SV 40A signal is located at 1257-th and 1378-th of SEQ ID NO.14, and is derived from pcDNA3.1 vector.

In order to amplify the puro expression frame containing the homologous arm, PCR is designed to be carried out by three sections respectively, meanwhile, the LR, RR and loxp sequences of the homologous arm are introduced by lengthening primer PCR, and the full-length sequence is obtained by splicing PCR. The method comprises the specific steps of respectively obtaining a P1 segment through PCR amplification (taking pcDNA3.1 as a template, carrying out PCR by using a primer P1-F/P1-R, taking the obtained PCR product as a template, carrying out PCR by using a primer P1-F1/P1-R, taking the obtained PCR product as a template, and obtaining a PCR product which is a P1 segment by using a primer P1-F2/P1-R for PCR); a P2 fragment (a PCR product obtained by carrying out PCR by using a primer P2-F/P2-R and taking a template LentiCRISPR V2 vector as a template, namely a P2 fragment); a P3 fragment (taking pcDNA3.1 as a template, performing PCR by using a primer P3-F/P3-R, taking the obtained PCR product as a template, performing PCR by using a primer P3-F/P3-R1, taking the obtained PCR product as a template, and performing PCR by using a primer P3-F/P3-R2 to obtain a PCR product, namely a P3 fragment); after obtaining P1, P2 and P3 fragments, 3 fragments were recovered separately, 1ul each was used as template, and the final full-length insert was obtained by PCR using the primers loxppuro-F/loxppuro-R gene splicing, the positions of which are shown in FIG. 13.

Wherein, the reaction system is as follows:

composition of	Volume ul
		ddH2O	To 50ul
2×Phanta Max Buffer	25ul
		dNTP(10mM)	1ul
DMSO	2ul
		Template plasmid (10ng/ul)/PCR product	1ul
F primer (10uM)	1ul
		R primer (10uM)	1ul
Phanta Max	1ul
		Total volume	50ul

The reaction conditions were as follows:

the primers are as follows:

obtaining the insert by splicing PCRAfter PCR, the PCR product was subjected to 1% agarose electrophoresis, and as a result, as shown in FIG. 14, the PCR product was separated, and the desired fragment, i.e., puro expression cassette containing the homology arm shown in SEQ ID NO.14, was recovered with a Gel recovery Kit (Novozae FastPull DNA Extraction Mini Kit # DC301), and dissolved in 50ul ddH₂O at-20 ℃ for later use.

Thirdly, obtaining a recombinant reaction product by adopting a homologous recombination cloning method

Homologous recombinant Cloning was performed on the prepared linearized vector (the linearized vector recovered after the cleavage of the Cas9/gRNA complex obtained in Step One) and the insert (the puro expression cassette containing the homology arms obtained in Step two) using a homologous recombinant Cloning Kit (nuo zan ClonExpress II One Step Cloning Kit # C112). The method comprises the following specific steps:

the components are added according to the following system, mixed and reacted for 30min at 37 ℃, and the mixture is immediately placed on ice after the reaction is finished and is converted to obtain a recombinant reaction product.

Wherein, the reaction system is as follows:

fourth, transformation and coating plate

1) 100 μ L of DH5 α chemically competent cells (Vazyme # C502) were placed in an ice bath;

2) adding 10 mu L of the recombinant reaction product obtained in the third step into a centrifuge tube filled with competent cells, uniformly mixing, and standing in an ice bath for 30 min;

3) placing the competent cells in ice bath for 30min in 42 deg.C water bath, heating for 90s, and rapidly transferring to ice bath to cool the cells for 3 min;

4) adding 300 μ L sterile LB culture medium (without antibiotic) into the centrifuge tube, mixing, and shake culturing at 37 deg.C with 220rpm shaking table for 60 min;

5) adding 100uL of cultured bacteria to LB solid agar medium containing corresponding antibiotics, and uniformly coating competent cells by using a sterile coating rod; and (3) inverting the LB solid agar culture medium coated with the competent cells into an incubator at 37 ℃ for culturing for 12-16 h to obtain a plate.

Fifth, clone identification and sending test

And (4) selecting and cloning the flat plate constructed in the fourth step, culturing, detecting bacterial liquid, and performing small extraction on correct cloning.

10 clones were picked from each of the constructed plates, cultured overnight at 37 ℃ in LB medium containing 300. mu.l of Amp resistance, and colony PCR was carried out the next day with primers P2-F/P2-R using Green Taq Mix (cat # P131) of Novozam.

Wherein, the reaction system is as follows:

ddH2O	to 20ul
		Green Taq Mix	10ul
Primer 1(10uM)	0.8ul
		Primer 2(10uM)	0.8ul
Template bacterial liquid	1ul
		Total volume	20ul

The reaction conditions were as follows:

the primer sequences are as follows:

after the PCR was completed, the PCR products of 10 clones were subjected to electrophoresis analysis, and 3. mu.l of the PCR products of each clone were subjected to 1% agarose gel electrophoresis, and the results are shown in FIG. 15, and the identification results showed that 2, 7, 8, 9, and 10 clones were positive clones.

1-10 clone bacterial liquid is sent to a general biology company for sequencing, sequencing primers P1-R, P2-F, P2-R, P3-F (the sequence is a corresponding PCR primer sequence) are compared with a theoretical sequence through a sequencing result, as shown in figure 16, two clones 8 and 10 are judged to be completely correct in sequencing, 6 clones have deletion of a repetitive sequence in SV40, and 2 clones have no sequencing result.

Cloning with correct sequencing result, respectively taking 20ul of bacterial liquid to a test tube containing 3ml of Amp LB for overnight culture, and performing plasmid extraction by using a plasmid miniprep kit on the second day to obtain a recombinant vector PB-GFP-puro (the structure is shown in figure 17, the sequence is shown in SEQ ID NO.15, and the 1727 th and 3171 th positions of SEQ ID NO.15 are puro expression frames), and storing at-20 ℃ for later use.

The final result shows that the method of using the Cas9/gRNA complex to replace the restriction enzyme has high success rate in constructing the vector, the effect is similar to that of the restriction enzyme, but the method is more flexible and applicable.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> Nanjing King Gene engineering Co., Ltd

<120> a novel plasmid vector construction method

<130>GNCFY200203

<160>15

<170>PatentIn version 3.5

<210>1

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ttactttttc ttttttgcct ggc 23

<210>2

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ttcctagagc tcgctgatca gcc 23

<210>3

<211>165

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60

taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120

ataggtaatt tctactgttg tagatctttt tcttttttgc ctggc 165

<210>4

<211>165

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60

taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120

ataggtaatt tctactgttg tagatctaga gctcgctgat cagcc 165

<210>5

<211>41

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

guaauuucua cuguuguaga ucuuuuucuu uuuugccugg c 41

<210>6

<211>41

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

guaauuucua cuguuguaga ucuagagcuc gcugaucagc c 41

<210>7

<211>1376

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>7

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro

1 5 10 15

Arg Gly Ser His Met Ala Ser Met Ser Ile Tyr Gln Glu Phe Val Asn

20 25 30

Lys Tyr Ser Leu Ser Lys Thr Leu Arg Phe Glu Leu Ile Pro Gln Gly

35 40 45

Lys Thr Leu Glu Asn Ile Lys Ala Arg Gly Leu Ile Leu Asp Asp Glu

50 55 60

Lys Arg Ala Lys Asp Tyr Lys Lys Ala Lys Gln Ile Ile Asp Lys Tyr

65 70 75 80

His Gln Phe Phe Ile Glu Glu Ile Leu Ser Ser Val Cys Ile Ser Glu

85 90 95

Asp Leu Leu Gln Asn Tyr Ser Asp Val Tyr Phe Lys Leu Lys Lys Ser

100 105 110

Asp Asp Asp Asn Leu Gln Lys Asp Phe Lys Ser Ala Lys Asp Thr Ile

115 120 125

Lys Lys Gln Ile Ser Glu Tyr Ile Lys Asp Ser Glu Lys Phe Lys Asn

130 135 140

Leu Phe Asn Gln Asn Leu Ile Asp Ala Lys Lys Gly Gln Glu Ser Asp

145 150 155 160

Leu Ile Leu Trp Leu Lys Gln Ser Lys Asp Asn Gly Ile Glu Leu Phe

165 170 175

Lys Ala Asn Ser Asp Ile Thr Asp Ile Asp Glu Ala Leu Glu Ile Ile

180 185 190

Lys Ser Phe Lys Gly Trp Thr Thr Tyr Phe Lys Gly Phe His Glu Asn

195 200 205

Arg Lys Asn Val Tyr Ser Ser Asn Asp Ile Pro Thr Ser Ile Ile Tyr

210 215 220

Arg Ile Val Asp Asp Asn Leu Pro Lys Phe Leu Glu Asn Lys Ala Lys

225 230 235 240

Tyr Glu Ser Leu Lys Asp Lys Ala Pro Glu Ala Ile Asn Tyr Glu Gln

245 250 255

Ile Lys Lys Asp Leu Ala Glu Glu Leu Thr Phe Asp Ile Asp Tyr Lys

260 265 270

Thr Ser Glu Val Asn Gln Arg Val Phe Ser Leu Asp Glu Val Phe Glu

275 280 285

Ile Ala Asn Phe Asn Asn Tyr Leu Asn Gln Ser Gly Ile Thr Lys Phe

290 295 300

Asn Thr Ile Ile Gly Gly Lys Phe Val Asn Gly Glu Asn Thr Lys Arg

305 310 315 320

Lys Gly Ile Asn Glu Tyr Ile Asn Leu Tyr Ser Gln Gln Ile Asn Asp

325 330 335

Lys Thr Leu Lys Lys Tyr Lys Met Ser Val Leu Phe Lys Gln Ile Leu

340 345 350

Ser Asp Thr Glu Ser Lys Ser Phe Val Ile Asp Lys Leu Glu Asp Asp

355 360 365

Ser Asp Val Val Thr Thr Met Gln Ser Phe Tyr Glu Gln Ile Ala Ala

370 375 380

Phe Lys Thr Val Glu Glu Lys Ser Ile Lys Glu Thr Leu Ser Leu Leu

385 390 395 400

Phe Asp Asp Leu Lys Ala Gln Lys Leu Asp Leu Ser Lys Ile Tyr Phe

405 410 415

Lys Asn Asp Lys Ser Leu Thr Asp Leu Ser Gln Gln Val Phe Asp Asp

420 425 430

Tyr Ser Val Ile Gly Thr Ala Val Leu Glu Tyr Ile Thr Gln Gln Ile

435 440 445

Ala Pro Lys Asn Leu Asp Asn Pro Ser Lys Lys Glu Gln Glu Leu Ile

450 455 460

Ala Lys Lys Thr Glu Lys Ala Lys Tyr Leu Ser Leu Glu Thr Ile Lys

465 470 475 480

Leu Ala Leu Glu Glu Phe Asn Lys His Arg Asp Ile Asp Lys Gln Cys

485 490 495

Arg Phe Glu Glu Ile Leu Ala Asn Phe Ala Ala Ile Pro Met Ile Phe

500 505 510

Asp Glu Ile Ala Gln Asn Lys Asp Asn Leu Ala Gln Ile Ser Ile Lys

515 520 525

Tyr Gln Asn Gln Gly Lys Lys Asp Leu Leu Gln Ala Ser Ala Glu Asp

530 535 540

Asp Val Lys Ala Ile Lys Asp Leu Leu Asp Gln Thr Asn Asn Leu Leu

545 550 555 560

His Lys Leu Lys Ile Phe His Ile Ser Gln Ser Glu Asp Lys Ala Asn

565 570 575

Ile Leu Asp Lys Asp Glu His Phe Tyr Leu Val Phe Glu Glu Cys Tyr

580 585 590

Phe Glu Leu Ala Asn Ile Val Pro Leu Tyr Asn Lys Ile Arg Asn Tyr

595 600 605

Ile Thr Gln Lys Pro Tyr Ser Asp Glu Lys Phe Lys Leu Asn Phe Glu

610 615 620

Asn Ser Thr Leu Ala Asn Gly Trp Asp Lys Asn Lys Glu Pro Asp Asn

625630 635 640

Thr Ala Ile Leu Phe Ile Lys Asp Asp Lys Tyr Tyr Leu Gly Val Met

645 650 655

Asn Lys Lys Asn Asn Lys Ile Phe Asp Asp Lys Ala Ile Lys Glu Asn

660 665 670

Lys Gly Glu Gly Tyr Lys Lys Ile Val Tyr Lys Leu Leu Pro Gly Ala

675 680 685

Asn Lys Met Leu Pro Lys Val Phe Phe Ser Ala Lys Ser Ile Lys Phe

690 695 700

Tyr Asn Pro Ser Glu Asp Ile Leu Arg Ile Arg Asn His Ser Thr His

705 710 715 720

Thr Lys Asn Gly Ser Pro Gln Lys Gly Tyr Glu Lys Phe Glu Phe Asn

725 730 735

Ile Glu Asp Cys Arg Lys Phe Ile Asp Phe Tyr Lys Gln Ser Ile Ser

740 745 750

Lys His Pro Glu Trp Lys Asp Phe Gly Phe Arg Phe Ser Asp Thr Gln

755 760 765

Arg Tyr Asn Ser Ile Asp Glu Phe Tyr Arg Glu Val Glu Asn Gln Gly

770 775 780

Tyr Lys Leu Thr Phe Glu Asn Ile Ser Glu Ser Tyr Ile Asp Ser Val

785790 795 800

Val Asn Gln Gly Lys Leu Tyr Leu Phe Gln Ile Tyr Asn Lys Asp Phe

805 810 815

Ser Ala Tyr Ser Lys Gly Arg Pro Asn Leu His Thr Leu Tyr Trp Lys

820 825 830

Ala Leu Phe Asp Glu Arg Asn Leu Gln Asp Val Val Tyr Lys Leu Asn

835 840 845

Gly Glu Ala Glu Leu Phe Tyr Arg Lys Gln Ser Ile Pro Lys Lys Ile

850 855 860

Thr His Pro Ala Lys Glu Ala Ile Ala Asn Lys Asn Lys Asp Asn Pro

865 870 875 880

Lys Lys Glu Ser Val Phe Glu Tyr Asp Leu Ile Lys Asp Lys Arg Phe

885 890 895

Thr Glu Asp Lys Phe Phe Phe His Cys Pro Ile Thr Ile Asn Phe Lys

900 905 910

Ser Ser Gly Ala Asn Lys Phe Asn Asp Glu Ile Asn Leu Leu Leu Lys

915 920 925

Glu Lys Ala Asn Asp Val His Ile Leu Ser Ile Asp Arg Gly Glu Arg

930 935 940

His Leu Ala Tyr Tyr Thr Leu Val Asp Gly Lys Gly Asn Ile Ile Lys

945 950 955 960

Gln Asp Thr Phe Asn Ile Ile Gly Asn Asp Arg Met Lys Thr Asn Tyr

965 970 975

His Asp Lys Leu Ala Ala Ile Glu Lys Asp Arg Asp Ser Ala Arg Lys

980 985 990

Asp Trp Lys Lys Ile Asn Asn Ile Lys Glu Met Lys Glu Gly Tyr Leu

995 1000 1005

Ser Gln Val Val His Glu Ile Ala Lys Leu Val Ile Glu Tyr Asn

1010 1015 1020

Ala Ile Val Val Phe Glu Asp Leu Asn Phe Gly Phe Lys Arg Gly

1025 1030 1035

Arg Phe Lys Val Glu Lys Gln Val Tyr Gln Lys Leu Glu Lys Met

1040 1045 1050

Leu Ile Glu Lys Leu Asn Tyr Leu Val Phe Lys Asp Asn Glu Phe

1055 1060 1065

Asp Lys Thr Gly Gly Val Leu Arg Ala Tyr Gln Leu Thr Ala Pro

1070 1075 1080

Phe Glu Thr Phe Lys Lys Met Gly Lys Gln Thr Gly Ile Ile Tyr

1085 1090 1095

Tyr Val Pro Ala Gly Phe Thr Ser Lys Ile Cys Pro Val Thr Gly

1100 1105 1110

Phe Val Asn Gln Leu Tyr Pro Lys Tyr Glu Ser Val Ser Lys Ser

1115 1120 1125

Gln Glu Phe Phe Ser Lys Phe Asp Lys Ile Cys Tyr Asn Leu Asp

1130 1135 1140

Lys Gly Tyr Phe Glu Phe Ser Phe Asp Tyr Lys Asn Phe Gly Asp

1145 1150 1155

Lys Ala Ala Lys Gly Lys Trp Thr Ile Ala Ser Phe Gly Ser Arg

1160 1165 1170

Leu Ile Asn Phe Arg Asn Ser Asp Lys Asn His Asn Trp Asp Thr

1175 1180 1185

Arg Glu Val Tyr Pro Thr Lys Glu Leu Glu Lys Leu Leu Lys Asp

1190 1195 1200

Tyr Ser Ile Glu Tyr Gly His Gly Glu Cys Ile Lys Ala Ala Ile

1205 1210 1215

Cys Gly Glu Ser Asp Lys Lys Phe Phe Ala Lys Leu Thr Ser Val

1220 1225 1230

Leu Asn Thr Ile Leu Gln Met Arg Asn Ser Lys Thr Gly Thr Glu

1235 1240 1245

Leu Asp Tyr Leu Ile Ser Pro Val Ala Asp Val Asn Gly Asn Phe

1250 1255 1260

Phe Asp Ser Arg Gln Ala Pro Lys Asn Met Pro Gln Asp Ala Asp

12651270 1275

Ala Asn Gly Ala Tyr His Ile Gly Leu Lys Gly Leu Met Leu Leu

1280 1285 1290

Gly Arg Ile Lys Asn Asn Gln Glu Gly Lys Lys Leu Asn Leu Val

1295 1300 1305

Ile Lys Asn Glu Glu Tyr Phe Glu Phe Val Gln Asn Arg Asn Asn

1310 1315 1320

Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys

1325 1330 1335

Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Tyr Pro Tyr

1340 1345 1350

Asp Val Pro Asp Tyr Ala Tyr Pro Tyr Asp Val Pro Asp Tyr Ala

1355 1360 1365

Leu Glu His His His His His His

1370 1375

<210>8

<211>870

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gatccggcgc aacaaacttc 60

tctctgctga aacaagccgg agatgtcgaa gagaatcctg gaccgatggt gagcaagggc 120

gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 180

cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 240

aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 300

acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 360

aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 420

aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 480

ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 540

tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 600

ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 660

aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 720

tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 780

accgccgccg ggatcactct cggcatggac gagctgtaca agtaagaatt cctagagctc 840

gctgatcagc ctcgactgtg ccttctagtt 870

<210>9

<211>9267

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360

agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420

aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480

ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840

ggggggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc 900

agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata 960

aaaagcgaag cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct 1020

ccgccgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 1080

gcgggcggga cggcccttct cctccgggct gtaattagct gagcaagagg taagggttta 1140

agggatggtt ggttggtggg gtattaatgt ttaattacct ggagcacctg cctgaaatca 1200

ctttttttca ggttggaccg gtgccaccat ggactataag gaccacgacg gagactacaa 1260

ggatcatgat attgattaca aagacgatga cgataagatg gccccaaaga agaagcggaa 1320

ggtcggtatc cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg 1380

caccaactct gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt 1440

caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct 1500

gttcgacagc ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata 1560

caccagacgg aagaaccgga tctgctatct gcaagagatc ttcagcaacg agatggccaa 1620

ggtggacgac agcttcttcc acagactgga agagtccttc ctggtggaag aggataagaa 1680

gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc acgagaagta 1740

ccccaccatc taccacctga gaaagaaact ggtggacagc accgacaagg ccgacctgcg 1800

gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1860

cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1920

caaccagctg ttcgaggaaa accccatcaa cgccagcggc gtggacgcca aggccatcct 1980

gtctgccaga ctgagcaaga gcagacggct ggaaaatctg atcgcccagc tgcccggcga 2040

gaagaagaat ggcctgttcg gaaacctgat tgccctgagc ctgggcctga cccccaactt 2100

caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 2160

cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 2220

cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 2280

caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2340

gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtacaaag agattttctt 2400

cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2460

ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2520

gctgaacaga gaggacctgc tgcggaagca gcggaccttc gacaacggca gcatccccca 2580

ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggaagatt tttacccatt 2640

cctgaaggac aaccgggaaa agatcgagaa gatcctgacc ttccgcatcc cctactacgt 2700

gggccctctg gccaggggaa acagcagatt cgcctggatg accagaaaga gcgaggaaac 2760

catcaccccc tggaacttcg aggaagtggt ggacaagggc gcttccgccc agagcttcat 2820

cgagcggatg accaacttcg ataagaacct gcccaacgag aaggtgctgc ccaagcacag 2880

cctgctgtac gagtacttca ccgtgtataa cgagctgacc aaagtgaaat acgtgaccga 2940

gggaatgaga aagcccgcct tcctgagcgg cgagcagaaa aaggccatcg tggacctgct 3000

gttcaagacc aaccggaaag tgaccgtgaa gcagctgaaa gaggactact tcaagaaaat 3060

cgagtgcttc gactccgtgg aaatctccgg cgtggaagat cggttcaacg cctccctggg 3120

cacataccac gatctgctga aaattatcaa ggacaaggac ttcctggaca atgaggaaaa 3180

cgaggacatt ctggaagata tcgtgctgac cctgacactg tttgaggaca gagagatgat 3240

cgaggaacgg ctgaaaacct atgcccacct gttcgacgac aaagtgatga agcagctgaa 3300

gcggcggaga tacaccggct ggggcaggct gagccggaag ctgatcaacg gcatccggga 3360

caagcagtcc ggcaagacaa tcctggattt cctgaagtcc gacggcttcg ccaacagaaa 3420

cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3480

ggtgtccggc cagggcgata gcctgcacga gcacattgccaatctggccg gcagccccgc 3540

cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3600

ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3660

gggacagaag aacagccgcg agagaatgaa gcggatcgaa gagggcatca aagagctggg 3720

cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3780

cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3840

gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3900

cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3960

cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 4020

tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 4080

taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 4140

acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 4200

agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 4260

ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4320

cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4380

ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4440

taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4500

ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4560

cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4620

gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4680

caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4740

cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4800

caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4860

cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4920

ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4980

aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 5040

tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 5100

tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 5160

gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 5220

cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 5280

gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5340

ccggaagagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5400

caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5460

ggccacgaaa aaggccggcc aggcaaaaaa gaaaaaggga tccggcgcaa caaacttctc 5520

tctgctgaaa caagccggag atgtcgaaga gaatcctgga ccgatggtga gcaagggcga 5580

ggagctgttc accggggtgg tgcccatcct ggtcgagctg gacggcgacg taaacggcca 5640

caagttcagc gtgtccggcg agggcgaggg cgatgccacc tacggcaagc tgaccctgaa 5700

gttcatctgc accaccggca agctgcccgt gccctggccc accctcgtga ccaccctgac 5760

ctacggcgtg cagtgcttca gccgctaccc cgaccacatg aagcagcacg acttcttcaa 5820

gtccgccatg cccgaaggct acgtccagga gcgcaccatc ttcttcaagg acgacggcaa 5880

ctacaagacc cgcgccgagg tgaagttcga gggcgacacc ctggtgaacc gcatcgagct 5940

gaagggcatc gacttcaagg aggacggcaa catcctgggg cacaagctgg agtacaacta 6000

caacagccac aacgtctata tcatggccga caagcagaag aacggcatca aggtgaactt 6060

caagatccgc cacaacatcg aggacggcag cgtgcagctc gccgaccact accagcagaa 6120

cacccccatc ggcgacggcc ccgtgctgct gcccgacaac cactacctga gcacccagtc 6180

cgccctgagc aaagacccca acgagaagcg cgatcacatg gtcctgctgg agttcgtgac 6240

cgccgccggg atcactctcg gcatggacga gctgtacaag taagaattcc tagagctcgc 6300

tgatcagcct cgactgtgcc ttctagttgc cagccatctg ttgtttgccc ctcccccgtg 6360

ccttccttga ccctggaagg tgccactccc actgtccttt cctaataaaa tgaggaaatt 6420

gcatcgcatt gtctgagtag gtgtcattct attctggggg gtggggtggg gcaggacagc 6480

aagggggagg attgggaaga gaatagcagg catgctgggg agcggccgca ggaaccccta 6540

gtgatggagt tggccactcc ctctctgcgc gctcgctcgc tcactgaggc cgggcgacca 6600

aaggtcgccc gacgcccggg ctttgcccgg gcggcctcag tgagcgagcg agcgcgcagc 6660

tgcctgcagg ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac 6720

cgcatacgtc aaagcaacca tagtacgcgc cctgtagcgg cgcattaagc gcggcgggtg 6780

tggtggttac gcgcagcgtg accgctacac ttgccagcgc cttagcgccc gctcctttcg 6840

ctttcttccc ttcctttctc gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg 6900

ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa aaacttgatt 6960

tgggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc cctttgacgt 7020

tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca ctcaactcta 7080

tctcgggcta ttcttttgat ttataaggga ttttgccgat ttcggtctat tggttaaaaa 7140

atgagctgat ttaacaaaaa tttaacgcga attttaacaa aatattaacg tttacaattt 7200

tatggtgcac tctcagtaca atctgctctg atgccgcata gttaagccag ccccgacacc 7260

cgccaacacc cgctgacgcg ccctgacggg cttgtctgct cccggcatcc gcttacagac 7320

aagctgtgac cgtctccggg agctgcatgt gtcagaggtt ttcaccgtca tcaccgaaac 7380

gcgcgagacg aaagggcctc gtgatacgcc tatttttata ggttaatgtc atgataataa 7440

tggtttctta gacgtcaggt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt 7500

tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc 7560

ttcaataata ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc gcccttattc 7620

ccttttttgc ggcattttgc cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa 7680

aagatgctga agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg 7740

gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag 7800

ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc 7860

gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta 7920

cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg 7980

cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca 8040

acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac 8100

caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat 8160

taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg 8220

ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata 8280

aatctggagc cggtgagcgt ggaagccgcg gtatcattgc agcactgggg ccagatggta 8340

agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa 8400

atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag 8460

tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg 8520

tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact 8580

gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg 8640

taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc 8700

aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata 8760

ctgttcttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 8820

catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc 8880

ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 8940

ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac 9000

agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 9060

taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt 9120

atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct 9180

cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg 9240

ccttttgctg gccttttgct cacatgt 9267

<210>10

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

gctcgtagat ggccagcagc tgg 23

<210>11

<211>225

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60

taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120

atagggctcg tagatggcca gcagcgtttt agagctagaa atagcaagtt aaaataaggc 180

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225

<210>12

<211>101

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ggcucguaga uggccagcag cguuuuagag cuagaaauag caaguuaaaa uaaggcuagu 60

ccguuaucaa cuugaaaaag uggcaccgag ucggugcuuu u 101

<210>13

<211>1454

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>13

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro

1 5 10 15

Arg Gly Ser His Met Ala Ser Met Asp Tyr Lys Asp His Asp Gly Asp

20 25 30

Tyr Lys Asp His Asp Ile Asp Tyr Lys Asp Asp Asp Asp Lys Met Ala

35 40 45

Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala Asp

50 55 60

Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly Trp

65 70 75 80

Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys Val

85 90 95

Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly Ala

100 105 110

Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr ArgLeu Lys Arg

115 120 125

Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr Leu

130 135 140

Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe Phe

145 150 155 160

His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His Glu

165 170 175

Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His Glu

180 185 190

Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser Thr

195 200 205

Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met Ile

210 215 220

Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp Asn

225 230 235 240

Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn Gln

245 250 255

Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys Ala

260 265 270

Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn LeuIle

275 280 285

Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu Ile

290 295 300

Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu

305 310 315 320

Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp Asp

325 330 335

Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu Phe

340 345 350

Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile Leu

355 360 365

Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met Ile

370 375 380

Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala Leu

385 390 395 400

Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp Gln

405 410 415

Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln Glu

420 425 430

Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly Thr

435 440 445

Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys Gln

450 455 460

Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly Glu

465 470 475 480

Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu Lys

485 490 495

Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr

500 505 510

Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met Thr

515 520 525

Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val

530 535 540

Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe

545 550 555 560

Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu

565 570 575

Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val

580 585 590

Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys

595 600 605

Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val Lys

610 615 620

Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser Val

625 630 635 640

Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr Tyr

645 650 655

His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn Glu

660 665 670

Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu Phe

675 680 685

Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His Leu

690 695 700

Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr Gly

705 710 715 720

Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys Gln

725 730 735

Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala Asn

740 745 750

Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys Glu

755 760 765

Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His Glu

770 775 780

His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu

785 790 795 800

Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg His

805 810 815

Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr

820 825 830

Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu Glu

835 840 845

Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val Glu

850 855 860

Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn

865 870 875 880

Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu Ser

885 890 895

Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp Asp

900 905 910

Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly Lys

915 920 925

Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn Tyr

930 935 940

Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe Asp

945 950 955 960

Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys Ala

965 970 975

Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys His

980 985 990

Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu Asn

995 1000 1005

Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys

1010 1015 1020

Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg

1025 1030 1035

Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala

1040 1045 1050

Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser

1055 1060 1065

Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met

1070 10751080

Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr

1085 1090 1095

Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr

1100 1105 1110

Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn

1115 1120 1125

Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala

1130 1135 1140

Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys

1145 1150 1155

Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu

1160 1165 1170

Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp

1175 1180 1185

Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr

1190 1195 1200

Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys

1205 1210 1215

Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg

1220 1225 1230

Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly

1235 1240 1245

Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr

1250 1255 1260

Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser

1265 1270 1275

Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys

1280 1285 1290

Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys

1295 1300 1305

Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln

1310 1315 1320

His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe

1325 1330 1335

Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu

1340 1345 1350

Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala

1355 1360 1365

Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro

1370 1375 1380

Ala Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr

1385 1390 1395

Thr Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser

1400 1405 1410

Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly

1415 1420 1425

Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys

1430 1435 1440

Lys Lys Lys Leu Glu His His His His His His

1445 1450

<210>14

<211>1481

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

aggcggaaag aaccagctgc cttaatataa cttcgtataa tgtatgctat acgaagttat 60

taggtctgaa gaggagttta cgtccagcca attctgtgga atgtgtgtca gttagggtgt 120

ggaaagtccc caggctcccc agcaggcaga agtatgcaaa gcatgcatct caattagtca 180

gcaaccaggt gtggaaagtc cccaggctcc ccagcaggca gaagtatgca aagcatgcat 240

ctcaattagt cagcaaccat agtcccgccc ctaactccgc ccatcccgcc cctaactccg 300

cccagttccg cccattctcc gccccatggc tgactaattt tttttattta tgcagaggcc 360

gaggccgcct ctgcctctga gctattccag aagtagtgag gaggcttttt tggaggccta 420

ggcttttgca aaaagctccc gggagcttgt atatccattt tcggcggccg cgccaccatg 480

accgagtaca agcccacggt gcgcctcgcc acccgcgacg acgtccccag ggccgtacgc 540

accctcgccg ccgcgttcgc cgactacccc gccacgcgcc acaccgtcga tccggaccgc 600

cacatcgagc gggtcaccga gctgcaagaa ctcttcctca cgcgcgtcgg gctcgacatc 660

ggcaaggtgt gggtcgcgga cgacggcgcc gcggtggcgg tctggaccac gccggagagc 720

gtcgaagcgg gggcggtgtt cgccgagatc ggcccgcgca tggccgagtt gagcggttcc 780

cggctggccg cgcagcaaca gatggaaggc ctcctggcgc cgcaccggcc caaggagccc 840

gcgtggttcc tggccaccgt cggagtctcg cccgaccacc agggcaaggg tctgggcagc 900

gccgtcgtgc tccccggagt ggaggcggcc gagcgcgccg gggtgcccgc cttcctggag 960

acctccgcgc cccgcaacct ccccttctac gagcggctcg gcttcaccgt caccgccgac 1020

gtcgaggtgc ccgaaggacc gcgcacctgg tgcatgaccc gcaagcccgg tgcctgagaa 1080

ttcgcgggac tctggggttc gaaatgaccg accaagcgac gcccaacctg ccatcacgag 1140

atttcgattc caccgccgcc ttctatgaaa ggttgggctt cggaatcgtt ttccgggacg 1200

ccggctggat gatcctccag cgcggggatc tcatgctgga gttcttcgcc caccccaact 1260

tgtttattgc agcttataat ggttacaaat aaagcaatag catcacaaat ttcacaaata 1320

aagcattttt ttcactgcat tctagttgtg gtttgtccaa actcatcaat gtatcttatc 1380

atgtctgtat accgctcgac tagagcttgc ggaaccctta atataacttc gtataatgta 1440

tgctatacga agttattagg tccgctggcc atctacgagc c 1481

<210>15

<211>7324

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

ggcgcgcccc agacccgggc ctggggggca agtcgggggg cggggggagg tcgggcaggg 60

tcccctggga ggatggggac gtgctgtgcc cctagcggcc accagagggc accaggacac 120

cactgcggtc ggctcagcgg ctcctgccct ggtcaggggg cgccaggtcc tgcccctcct 180

ggggagggcg gggggcgaga agggcgattg aaattctacc gggtagggga ggcgcttttc 240

ccaaggcagt ctggagcatg cgctttagca gccccgctgg gcacttggcg ctacacaagt 300

ggcctctggc ctcgcacaca ttccacatcc accggtaggc gccaaccggc tccgttcttt 360

ggtggcccct tcgcgccacc ttctactcct cccctagtca ggaagttccc ccccgccccg 420

cagctcgcgt cgtgcaggac gtgacaaatg gaagtagcac gtctcactag tctcgtgcag 480

atggacagca ccgctgagca atggaagcgg gtaggccttt ggggcagcgg ccaatagcag 540

ctttgctcct tcgctttctg ggctcagagg ctgggaaggg gtgggtccgg gggcgggctc 600

aggggcgggc tcaggggcgg ggcgggcgcc cgaaggtcct ccggaggccc ggcattctgc 660

acgcttcaaa agcgcacgtc tgccgcgctg ttctcctctt cctcatctcc gggcctttcg 720

acctcctagg gccaccatgg tgagcaaggg cgaggagctg ttcaccgggg tggtgcccat 780

cctggtcgag ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg gcgagggcga 840

gggcgatgcc acctacggca agctgaccct gaagttcatc tgcaccaccg gcaagctgcc 900

cgtgccctgg cccaccctcg tgaccaccct gacctacggc gtgcagtgct tcagccgcta 960

ccccgaccac atgaagcagc acgacttctt caagtccgcc atgcccgaag gctacgtcca 1020

ggagcgcacc atcttcttca aggacgacgg caactacaag acccgcgccg aggtgaagtt 1080

cgagggcgac accctggtga accgcatcga gctgaagggc atcgacttca aggaggacgg 1140

caacatcctg gggcacaagc tggagtacaa ctacaacagc cacaacgtct atatcatggc 1200

cgacaagcag aagaacggca tcaaggtgaa cttcaagatc cgccacaaca tcgaggacgg 1260

cagcgtgcag ctcgccgacc actaccagca gaacaccccc atcggcgacg gccccgtgct 1320

gctgcccgac aaccactacc tgagcaccca gtccgccctg agcaaagacc ccaacgagaa 1380

gcgcgatcac atggtcctgc tggagttcgt gaccgccgcc gggatcactc tcggcatgga 1440

cgagctgtac aagtaaggat ccgctgatca gcctcgactg tgccttctag ttgccagcca 1500

tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc 1560

ctttcctaat aaaatgagga aattgcatcg cattgtctga gtaggtgtca ttctattctg 1620

gggggtgggg tggggcagga cagcaagggg gaggattggg aagacaatag caggcatgct 1680

ggggatgcgg tgggctctat ggcttctgag gcggaaagaa ccagctgcct taatataact 1740

tcgtataatg tatgctatac gaagttatta ggtctgaaga ggagtttacg tccagccaat 1800

tctgtggaat gtgtgtcagt tagggtgtgg aaagtcccca ggctccccag caggcagaag 1860

tatgcaaagc atgcatctca attagtcagc aaccaggtgt ggaaagtccc caggctcccc 1920

agcaggcaga agtatgcaaa gcatgcatct caattagtca gcaaccatag tcccgcccct 1980

aactccgccc atcccgcccc taactccgcc cagttccgcc cattctccgc cccatggctg 2040

actaattttt tttatttatg cagaggccga ggccgcctct gcctctgagc tattccagaa 2100

gtagtgagga ggcttttttg gaggcctagg cttttgcaaa aagctcccgg gagcttgtat 2160

atccattttc ggcggccgcg ccaccatgac cgagtacaag cccacggtgc gcctcgccac 2220

ccgcgacgac gtccccaggg ccgtacgcac cctcgccgcc gcgttcgccg actaccccgc 2280

cacgcgccac accgtcgatc cggaccgcca catcgagcgg gtcaccgagc tgcaagaact 2340

cttcctcacg cgcgtcgggc tcgacatcgg caaggtgtgg gtcgcggacg acggcgccgc 2400

ggtggcggtc tggaccacgc cggagagcgt cgaagcgggg gcggtgttcg ccgagatcgg 2460

cccgcgcatg gccgagttga gcggttcccg gctggccgcg cagcaacaga tggaaggcct 2520

cctggcgccg caccggccca aggagcccgc gtggttcctg gccaccgtcg gagtctcgcc 2580

cgaccaccag ggcaagggtc tgggcagcgc cgtcgtgctc cccggagtgg aggcggccga 2640

gcgcgccggg gtgcccgcct tcctggagac ctccgcgccc cgcaacctcc ccttctacga 2700

gcggctcggc ttcaccgtca ccgccgacgt cgaggtgccc gaaggaccgc gcacctggtg 2760

catgacccgc aagcccggtg cctgagaatt cgcgggactc tggggttcga aatgaccgac 2820

caagcgacgc ccaacctgcc atcacgagat ttcgattcca ccgccgcctt ctatgaaagg 2880

ttgggcttcg gaatcgtttt ccgggacgcc ggctggatga tcctccagcg cggggatctc 2940

atgctggagt tcttcgccca ccccaacttg tttattgcag cttataatgg ttacaaataa 3000

agcaatagca tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt 3060

ttgtccaaac tcatcaatgt atcttatcat gtctgtatac cgctcgacta gagcttgcgg 3120

aacccttaat ataacttcgt ataatgtatg ctatacgaag ttattaggtc cgctggccat 3180

ctacgagcca aagactttca aatctttggc tgccttggcc agtaggaggc gacacgaagg 3240

atttgctgct gccttggggg atgggaagga acctgaaggc attttttcca gagtggtgca 3300

gtaccactga ggactgttgc tgtattgatt aggaaaagag acagagtaat ttgcagtttg 3360

tttgatttat actacgcgtt gatgcggccg ccataaaagt tttgttactt tatagaagaa 3420

attttgagtt tttgtttttt ttaataaata aataaacata aataaattgt ttgttgaatt 3480

tattattagt atgtaagtgt aaatataata aaacttaata tctattcaaa ttaataaata 3540

aacctcgata tacagaccga taaaacacat gcgtcaattt tacacatgat tatctttaac 3600

gtacgtcaca atatgattat ctttctaggg ttaatctagc tgcgtgttct gcagcgtgtc 3660

gagcatcttc atctgctcca tcacgctgta aaacacattt gcaccgcgag tctgcccgtc 3720

ctccacgggt tcaaaaacgt gaatgaacga ggcgcgctca ctggccgtcg ttttacaacg 3780

tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc cttgcagcac atcccccttt 3840

cgccagctgg cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag 3900

cctgaatggc gaatgggacg cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt 3960

tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt tcgctttctt 4020

cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc gggggctccc 4080

tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg attagggtga 4140

tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga cgttggagtc 4200

cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc ctatctcggt 4260

ctattctttt gatttataag ggattttgcc gatttcggcc tattggttaa aaaatgagct 4320

gatttaacaa aaatttaacg cgaattttaa caaaatatta acgcttacaa tttaggtggc 4380

acttttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat 4440

atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag 4500

agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt 4560

cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt 4620

gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga gagttttcgc 4680

cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta 4740

tcccgtattg acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac 4800

ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa 4860

ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg 4920

atcggaggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc 4980

cttgatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg 5040

atgcctgtag caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta 5100

gcttcccggc aacaattaat agactggatg gaggcggata aagttgcagg accacttctg 5160

cgctcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggt 5220

tcacgcggta tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc 5280

tacacgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt 5340

gcctcactga ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt 5400

gatttaaaacttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc 5460

atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag 5520

atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa 5580

aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg 5640

aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag 5700

ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg 5760

ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga 5820

tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc 5880

ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc 5940

acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga 6000

gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt 6060

cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg 6120

aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac 6180

atgttctttc ctgcgttatc ccctgattct gtggataacc gtattaccgc ctttgagtga 6240

gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag cgaggaagcg 6300

gaagagcgcc caatacgcaa accgcctctc cccgcgcgtt ggccgattca ttaatgcagc 6360

tggcacgaca ggtttcccga ctggaaagcg ggcagtgagc gcaacgcaat taatgtgagt 6420

tagctcactc attaggcacc ccaggcttta cactttatgc ttccggctcg tatgttgtgt 6480

ggaattgtga gcggataaca atttcacaca ggaaacagct atgaccatga ttacgccaag 6540

cgcgcccgcc gggtaactca cggggtatcc atgtccattt ctgcggcatc cagccaggat 6600

acccgtcctc gctgacgtaa tatcccagcg ccgcaccgct gtcattaatc tgcacaccgg 6660

cacggcagtt ccggctgtcg ccggtattgt tcgggttgct gatgcgcttc gggctgacca 6720

tccggaactg tgtccggaaa agccgcgacg aactggtatc ccaggtggcc tgaacgaaca 6780

gttcaccgtt aaaggcgtgc atggccacac cttcccgaat catcatggta aacgtgcgtt 6840

ttcgctcaac gtcaatgcag cagcagtcat cctcggcaaa ctctttccat gccgcttcaa 6900

cctcgcggga aaaggcacgg gcttcttcct ccccgatgcc cagatagcgc cagcttgggc 6960

gatgactgag ccggaaaaaa gacccgacga tatgatcctg atgcagctag attaacccta 7020

gaaagatagt ctgcgtaaaa ttgacgcatg cattcttgaa atattgctct ctctttctaa 7080

atagcgcgaa tccgtcgctg tgcatttagg acatctcagt cgccgcttgg agctcccgtg 7140

aggcgtgctt gtcaatgcgg taagtgtcac tgattttgaa ctataacgac cgcgtgagtc 7200

aaaatgacgc atgattatct tttacgtgac ttttaagatt taactcatac gataattata 7260

ttgttatttc atgttctact tacgtgataa cttattatat atatattttc ttgttataga 7320

tatc 7324

Claims (7)

1. A method of constructing a recombinant vector containing an exogenous DNA molecule of interest, comprising: the method is a CRISPR/Cpf1 method or a CRISPR/Cas9 method;

wherein, the CRISPR/Cpf1 method comprises the following steps:

1) obtaining a skeleton vector, wherein the skeleton vector is a vector containing a PAM sequence identified by Cpf1 protein, and the PAM sequence identified by Cpf1 protein is named as Cpf 1-PAM;

2) preparing crRNA by taking the downstream DNA sequence of the Cpf1-PAM in the skeleton vector as a target sequence;

3) cutting the skeleton vector by using the crRNA and the Cpf1 protein to obtain a linearized vector;

4) respectively adding homologous arms which are respectively homologous with the two ends of the linearized vector to the two ends of the exogenous target DNA molecule, and then connecting the linearized vector and the exogenous target DNA molecule by a homologous recombination cloning method to obtain a recombinant vector containing the exogenous target DNA molecule;

the CRISPR/Cas9 method comprises the following steps:

1) obtaining a framework vector, wherein the framework vector is a vector containing a PAM sequence identified by a Cas9 protein, and the PAM sequence identified by the Cas9 protein is named as Cas 9-PAM;

2) preparing gRNA by taking an upstream DNA sequence of the Cas9-PAM in the framework vector as a target sequence;

3) cutting the framework vector by using the gRNA and the Cas9 protein to obtain a linearized vector;

4) and respectively adding homologous arms which are respectively homologous with the two ends of the linearized vector to the two ends of the exogenous target DNA molecule, and then connecting the linearized vector and the exogenous target DNA molecule by a homologous recombination cloning method to obtain the recombinant vector containing the exogenous target DNA molecule.

2. The method of claim 1, wherein: the length of the downstream DNA sequence of the Cpf1-PAM is 17-30 bp; the length of the upstream DNA sequence of the Cas9-PAM is 17-30 bp.

3. The method according to claim 1 or2, characterized in that: the Cpf1-PAM is 5 '-YTN-3'; the Cas9-PAM is 5 '-NGG-3'; wherein Y represents T or C, and N represents A, T, G or C.

4. A kit of parts, characterized by: the reagent set is a reagent A or a reagent B;

wherein, the reagent A comprises crRNA and Cpf1 protein;

the agent B includes gRNA and Cas9 proteins.

5. The kit of claim 4, wherein: the reagent A in the kit also comprises a skeleton carrier A, wherein the skeleton carrier A contains a PAM sequence of Cpf1 protein, the PAM sequence recognized by the Cpf1 protein is named as Cpf1-PAM, and the crRNA is specifically bound with a DNA sequence downstream of the Cpf1-PAM in the skeleton carrier;

the reagent B in the kit also comprises a framework vector B, wherein the framework vector B contains a PAM sequence of a Cas9 protein, the PAM sequence recognized by the Cas9 protein is named as Cas9-PAM, and the gRNA is specifically combined with an upstream DNA sequence of the Cas9-PAM in the framework vector.

6. The kit of claim 4 or 5, wherein: the Cpf1-PAM is 5 '-YTN-3'; the Cas9-PAM is 5 '-NGG-3'; wherein Y represents T or C, and N represents A, T, G or C.

7. Use of a kit of parts according to any one of claims 4 to 6 for the construction of a recombinant vector containing an exogenous DNA molecule of interest.

Images