CN110938648B

CN110938648B - Fungus secretion expression vector, construction method and application thereof

Info

Publication number: CN110938648B
Application number: CN201911247436.XA
Authority: CN
Inventors: 王丹; 仝征; 彭存智; 常丽丽; 徐兵强
Original assignee: Institute of Tropical Bioscience and Biotechnology Chinese Academy of Tropical Agricultural Sciences
Current assignee: Institute of Tropical Bioscience and Biotechnology Chinese Academy of Tropical Agricultural Sciences
Priority date: 2019-12-09
Filing date: 2019-12-09
Publication date: 2021-11-05
Anticipated expiration: 2039-12-09
Also published as: CN110938648A

Abstract

The invention provides a fungus secretion expression vector, a construction method and application thereof, wherein the fungus secretion expression vector is a fungus secretion type expression vector 74HSP with signal peptide of Six1d secretion protein N end 23aa (MAPHYSMVLLGALLGALSILGFGAYAQE) inserted into 4665bp of a pCT74 vector.

Description

Fungus secretion expression vector, construction method and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a fungus secretion expression vector, a construction method and application thereof.

Background

The traditional plant transgenic technology can identify the function of plant genes, construct a secretory expression vector by utilizing a signal peptide to express exogenous genes, secrete target proteins to the outside of cells and is beneficial to the effective identification of the functions of the plant genes, but the existing transgenic technology is complicated in the construction process of the secretory expression vector and has certain limitation, and the work is difficult to develop for immature plants such as bananas and the like in a transgenic system. At present, in the process of constructing an expression vector, protein shearing and secretion which cannot be effectively performed are easy to occur, or a long sequence is left at the N end of a target protein, so that the function of the target protein is influenced, and the target protein cannot be successfully expressed in fungi and secreted into plants. Therefore, a novel secretory expression vector is constructed, the target protein is expressed in fungi and secreted into plants, the rapid identification of plant gene functions is realized, and the method has important significance in providing technical support for the research of plant fungal disease resistance mechanisms.

Disclosure of Invention

Therefore, the invention provides a fungus secretory expression vector, a construction method and application thereof, successfully constructs the fungus secretory expression vector capable of effectively secreting plant protein to the exterior of pathogenic bacteria, and realizes that the target protein is effectively expressed in fungi and secreted into plants in the infection process, thereby realizing the rapid identification of plant gene functions.

The technical scheme of the invention is realized as follows:

a fungus secretion expression vector, a fungus secretion type expression vector 74HSP of extracellular signal peptide of Six1d secretion protein N end 23aa (MAPHYSMVLLGALLGALSILGFGAYAQE) is inserted into 4665bp of pCT74 vector.

Further, the nucleotide sequence of the extracellular signal peptide 23aa at the N end of the Six1d secretory protein is as follows: ATGGCGCCCTATAGCATGGTACTCCTTGGCGCCCTCTCAATCCTTGGGTTTGGGGCTTATGCTCAAGAG are provided.

Further, the fungus secretory expression vector 74HSP also contains a short enzyme cutting site sequence, and the nucleotide sequence of the short enzyme cutting site sequence is as follows: GATATCCATATGGCTAGCAGGCCT are provided.

Further, an exogenous EGFP gene is connected into a short sequence of the enzyme cutting site to form a 74HSP-EGFP recombinant vector.

Further indicates that the sequence of the 74HSP-EGFP recombinant vector is shown as the nucleotide sequence of a sequence 3 in a sequence table.

A construction method of a fungus secretion expression vector comprises the following steps:

(1) determining that a secretory signal peptide sequence is an extracellular signal peptide of 23aa at the N end of the Six1d protein through signal peptide analysis, and designing a short sequence of a restriction enzyme site; the restriction enzyme site short sequence comprises four restriction enzyme sites of EcoRV, NdeI, NheI and StuI;

(2) synthesizing a vector sequence containing a signal peptide and a short sequence of an enzyme cutting site by using a nucleic acid synthesizer;

(3) and connecting the vector sequence containing the signal peptide and the enzyme cutting site short sequence to a pCT74 vector through T4-DNA ligase to obtain the fungus secretory expression vector 74 HSP.

A construction method of a fungus secretion expression exogenous gene system comprises the following steps:

(1) connecting an exogenous EGFP gene into a fungus secretion type expression vector 74HSP in a short sequence of a restriction enzyme cutting site through NheI and StuI restriction enzyme to obtain a complete 74HSP-EGFP recombinant vector;

(2) and transforming the 74HSP-EGFP recombinant vector into fusarium oxysporum Foc4 to obtain FOC4 transformed bacteria of the pCT74-S secretion type vector.

An application of fungus secretion expression carrier in expressing exogenous protein.

Compared with the prior art, the invention has the beneficial effects that: according to the invention, the extracellular signal peptide of 23aa at the N end of the Six1d protein is determined through signal peptide analysis, and a short sequence containing an enzyme cutting site is designed behind the sequence, so that a fungus secretory expression vector 74HSP capable of effectively secreting plant protein to the outside of pathogenic bacteria is successfully constructed, the purpose of expressing target protein in fungus and secreting the target protein into plants in the infection process is realized through genetic transformation of Fusarium oxysporum Foc4, the purpose of rapidly identifying the plant gene function is achieved, and the successful construction of the vector can provide technical support for the research of the fungal disease resistance mechanism.

Drawings

FIG. 1 is a schematic diagram of a pCT74 vector embodying the present invention;

FIG. 2 is a schematic diagram of a fungus secretory expression vector 74HSP-EGFP containing an extracellular signal peptide of 23aa at the N end of a Six1d secretory protein, which is implemented by the invention;

FIG. 3 is a graph showing the effects of culturing liquid media of F4-O, F4-I and F4 strains according to the practice of the present invention;

FIG. 4 is a graph showing the effects of culturing solid media of F4-O, F4-I and F4 strains according to the practice of the present invention;

FIG. 5 is a graph of a signal peptide prediction using the sequence of 23aa from the N-terminus alone, as performed in the present invention;

FIG. 6 is a graph of a signal peptide prediction using the sequence of 30aa from the N-terminus alone, as predicted by an analysis of the signal peptide;

FIG. 7 is a signal peptide analysis prediction graph using the sequence of 40aa from the N-terminus alone, in accordance with the practice of the present invention;

FIG. 8 is a graph of a signal peptide prediction using the sequence of the N-terminal 50aa alone in the analysis of the present invention;

FIG. 9 is a signal peptide analysis prediction graph using the sequence of 23aa at the N-terminus and a short sequence of a cleavage site, performed in accordance with the present invention;

FIG. 10 is a signal peptide analysis prediction graph using the sequence of 23aa at the N-terminus and a short sequence of a cleavage site as practiced in the present invention;

FIG. 11 is a signal peptide analysis prediction graph using the sequence of 23aa at the N-terminus and a short sequence of a cleavage site, as practiced in the present invention;

in the figure, F4: FOC4 wild type (Fusarium oxysporum Guba specialization type No. 4 microspecies wild type)

F4-O: FOC4 transformant transformed with pCT74-S secretory vector

F4-I: FOC4 transformed bacteria transformed with pCT74 non-secretory vector.

Detailed Description

In order to better understand the technical content of the invention, specific examples are provided below to further illustrate the invention.

The experimental methods used in the examples of the present invention are all conventional methods unless otherwise specified.

The materials, reagents and the like used in the examples of the present invention can be obtained commercially without specific description.

Example 1 determination of extracellular Signal peptides and design of short sequences comprising cleavage sites

1. According to the invention, a secreted protein Six1d with high abundance is identified from fusarium oxysporum f.sp.cubense No. one small species (Foc1) through secretory proteomics, and signal peptide analysis predicts that 1 signal peptide of 21aa exists at the N end of the protein sequence, protein shearing and secretion can be realized between 21aa and 22aa, and effective shearing cannot be predicted when the 23aa and even 30aa of the N end are singly used, although protein shearing and secretion can be realized by using the sequences of 40aa and 50aa at the N end of the protein, when a carrier constructed by using the sequences of 40aa or 50aa, a long sequence is left at the N end of a target protein, so that the function of the target protein is influenced.

2. The specific experiment is as follows:

(1) using the sequence of 23aa from N-terminus alone (MAPYSMVLLG ALSILGFGAY AQE), splicing and secretion could not be predicted, as shown in FIG. 5;

(2) using the 30aa sequence from the N-terminus alone (MAPYSMVLLG ALSILGFGAY AQEAAVEEPQ), splicing and secretion could not be predicted, as shown in FIG. 6;

(3) using the sequence of N-terminal 40aa alone (MAPYSMVLLG ALSILGFGAY AQEAAVEEPQ IFFNLTYTEY), weaker shear can be predicted, as shown in fig. 7;

(4) the cleavage and secretion can be predicted by using the N-terminal 50aa sequence alone (MAPYSMVLLG ALSILGFGAY AQEAAVEEPQ IFFNLTYTEY LDKVAASHGS), but when the 50aa sequence is applied to a vector, the cleavage only occurs at the positions 21aa-22aa, so that a longer sequence is reserved at the N-terminal of the target protein, and the function of the target protein is influenced, as shown in FIG. 8;

(5) according to the results, the invention finally determines the sequence of extracellular signal peptide using 23aa (MAPOSS MVLLGALLGALSIFGFG AYACE) at the N end of Six1d protein, designs a short sequence containing enzyme cutting sites after the sequence, and constructs 74HSP of the fungus secretion expression vector. The short sequence of the enzyme cutting site not only effectively prevents the integrity of the carrier from being damaged in the enzyme cutting reaction process, but also realizes effective shearing after the secretory signal peptide is expressed, ensures the successful secretion of the target protein, and has the advantages of low cost and the like. The short sequence comprising the cleavage site is:

by this design, it was further found that, regardless of the insertion of the target gene from StuI: (as shown in FIG. 9)

Also inserted from NheI is the gene of interest: (as shown in FIG. 10)

Or inserting the target gene from NdeI (as shown in FIG. 11)

Efficient and stable cleavage and secretion of the target protein can be effectively predicted.

Example 2-a method for constructing a fungal secretory expression vector, comprising the steps of:

(1) by signal peptide analysis, the secretory signal peptide sequence is determined to be the extracellular signal peptide of 23aa (MAPOSMVLLGALLSILGFGAYAQE) at the N end of Six1d protein, and the nucleotide sequence is as follows: ATGGCGCCCTATAGCATGGTACTCCTTGGCGCCCTCTCAATCCTTGGGTTTGGGGCTT ATGCTCAAGAG, respectively; and designing a short sequence of the enzyme cutting site, wherein the nucleotide sequence is as follows: GATATCCATATGGCTAGCAGGCCT, respectively; the restriction enzyme site short sequence comprises four restriction enzyme sites of EcoRV, NdeI, NheI and StuI;

Example 3-a method for constructing a system for secretory expression of exogenous genes in fungi, comprising the steps of:

Example 4 construction and fluorescent Signal analysis of a fungal secretory expression foreign Gene System:

1. construction of the vector: by signal peptide analysis, the secretory signal peptide sequence is determined to be the extracellular signal peptide of 23aa (MAPOSMVLLGALLSILGFGAYAQE) at the N end of Six1d protein, and the nucleotide sequence is as follows: ATGGCGCCCTATAGCATGGTACTCCTTGGCGCCCTCTCAATCCTTGGGTTTGGGGCTTATGCTCAAGAG, respectively; meanwhile, a short sequence of enzyme cutting sites is designed behind the sequence, and the nucleotide sequence is as follows: GATATCCATATGGCTAGCAGGCCT, respectively; the restriction enzyme site short sequence comprises four restriction enzyme sites of EcoRV, NdeI, NheI and StuI;

2. synthesizing a vector sequence containing a signal peptide and a short sequence of an enzyme cutting site by using a nucleic acid synthesizer;

3. inserting a vector sequence containing a signal peptide and a short sequence of an enzyme cutting site into a pCT74 vector at 4665bp through T4-DNA ligase, and modifying the pCT74 vector to obtain a fungus secretory expression vector 74 HSP;

4. connecting an exogenous EGFP gene into the constructed fungus secretion type expression vector 74HSP in a short sequence of a restriction enzyme cutting site through NheI and StuI restriction enzyme to obtain a complete 74HSP-EGFP recombinant vector, as shown in figure 2;

5. respectively transforming a 74HSP-EGFP recombinant vector (secretory type) and a pCT74 vector (non-secretory type) into a Foc4 strain to obtain F4-O (secretory type) and F4-I (non-secretory type) expression strains;

6. F4-O (secreted) and F4-I (non-secreted) expressing strains were subjected to subsequent analysis of GFP fluorescence signals, comprising the following steps:

(1) liquid culture medium is prepared for culturing F4-O, F4-I and F4 strains

a. Liquid culture medium: cutting potato at a ratio of 200g/L, boiling for 15min, filtering with 4 layers of gauze, and collecting filtrate; 20g/L of glucose; diluting to 1L, and sterilizing at 121 deg.C for 20 min.

Liquid culture of F4-O and F4-I: 30mL of the liquid medium was added with hygromycin at a final concentration of 90. mu.L (final concentration of 3mL/L), inoculated with a strain having a diameter of 0.5cm, and cultured at 28 ℃ and 200rpm for 72 hours.

And c, F4 liquid culture: inoculating 30mL of liquid culture medium with strain with diameter of 0.5cm, culturing at 28 deg.C and 200rpm for 72 h.

d. 5mL of the shaken bacterial solution is taken, centrifuged at 13000rpm for 15min at room temperature, and photographed under the white light and fluorescence conditions respectively. The test results are as follows: under the white light condition, all thalli and bacterial liquid have no green fluorescent signals; under the fluorescent condition, both the F4 thallus and the bacterial liquid have no green fluorescent signals; the green fluorescent signal of the F4-O strain appeared in the supernatant (secreted); the green fluorescence signal of F4-I strain appeared in the bacterial cells (non-secreted type), as shown in FIG. 3.

(2) Preparing solid culture medium for culturing F4-O, F4-I and F4 strains

a. Solid medium: cutting potato at a ratio of 200g/L, boiling for 15min, filtering with 4 layers of gauze, and collecting filtrate; 20g/L of glucose; adding agar 20g/L, and sterilizing at 121 deg.C for 20 min.

Solid culture of F4-O and F4-I: adding hygromycin with the final concentration of 3mL/L into the solid culture medium which is not solidified after sterilization; using culture dishes with the diameter of 6cm, pouring 15mL of culture medium into each culture dish, after solidification, adding 10 mu L of F4-O and F4-I bacterial liquid cultured for 72 hours in the graph 2 into the center of each culture dish, and after the bacterial liquid is air-dried, performing inverted culture at 28 ℃ for 72 hours.

And c, F4 solid culture: taking the solid culture medium which is not solidified after sterilization, using culture dishes with the diameter of 6cm, pouring 15mL of culture medium into each culture dish, after solidification, adding 10 microliters of F4 bacterial liquid which is cultured for 72 hours in the graph 2 into the center of each culture dish, and after the bacterial liquid is air-dried, carrying out inverted culture at 28 ℃ for 72 hours.

d. After 72h incubation, the colonies on the plates were photographed under white light and fluorescence, respectively. The test results are as follows: under the white light condition, all strains have no green fluorescent signals; under the fluorescent condition, no green fluorescent signal exists in hypha and culture medium of the F4 strain; the green fluorescent signal of F4-O strain appeared in the medium (secreted); the green fluorescent signal of F4-I strain appeared in the hyphae (non-secreted) as shown in FIG. 4.

The tests show that the fungus secretory expression vector 74HSP-EGFP constructed by the invention is used for transforming fusarium oxysporum Foc4, the green fluorescent protein EGFP exists only in a culture solution and does not exist in thalli, which shows that the 74HSP-EGFP can effectively secrete foreign proteins to the outside of cells, and furthermore Foc4 carrying the 74HSP-EGFP is used for infecting bananas, and the green fluorescent protein can be detected in the bananas.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> research institute of tropical biotechnology of Chinese tropical academy of agricultural sciences

<120> fungal secretion expression vector, construction method and application thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggcgccct atagcatggt actccttggc gccctctcaa tccttgggtt tggggcttat 60

gctcaagag 69

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gatatccata tggctagcag gcct 24

<210> 3

<211> 5836

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gagctccaat tcgccctata gtgagtcgta ttacaattca ctggccgtcg ttttacaacg 60

tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc cttgcagcac atcccccttt 120

cgccagctgg cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag 180

cctgaatggc gaatgggacg cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt 240

tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt tcgctttctt 300

cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc gggggctccc 360

tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg attagggtga 420

tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga cgttggagtc 480

cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc ctatctcggt 540

ctattctttt gatttataag ggattttgcc gatttcggcc tattggttaa aaaatgagct 600

gatttaacaa aaatttaacg cgaattttaa caaaatatta acgcttacaa tttaggtggc 660

acttttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat 720

atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag 780

agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt 840

cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt 900

gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga gagttttcgc 960

cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta 1020

tcccgtattg acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac 1080

ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa 1140

ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg 1200

atcggaggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc 1260

cttgatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg 1320

atgcctgtag caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta 1380

gcttcccggc aacaattaat agactggatg gaggcggata aagttgcagg accacttctg 1440

cgctcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggg 1500

tctcgcggta tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc 1560

tacacgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt 1620

gcctcactga ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt 1680

gatttaaaac ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc 1740

atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag 1800

atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa 1860

aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg 1920

aaggtaactg gcttcagcag agcgcagata ccaaatactg ttcttctagt gtagccgtag 1980

ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg 2040

ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga 2100

tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc 2160

ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc 2220

acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga 2280

gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt 2340

cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg 2400

aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac 2460

atgttctttc ctgcgttatc ccctgattct gtggataacc gtattaccgc ctttgagtga 2520

gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag cgaggaagcg 2580

gaagagcgcc caatacgcaa accgcctctc cccgcgcgtt ggccgattca ttaatgcagc 2640

tggcacgaca ggtttcccga ctggaaagcg ggcagtgagc gcaacgcaat taatgtgagt 2700

tagctcactc attaggcacc ccaggcttta cactttatgc ttccggctcg tatgttgtgt 2760

ggaattgtga gcggataaca atttcacaca ggaaacagct atgaccatga ttacgccaag 2820

ctcgaaatta accctcacta aagggaacaa aagctggtac cgggcccccc ctcgaggtcg 2880

acgttaactg gttcccggtc ggcatctact ctattccttt gccctcggac gagtgctggg 2940

gcgtcggttt ccactatcgg cgagtacttc tacacagcca tcggtccaga cggccgcgct 3000

tctgcgggcg atttgtgtac gcccgacagt cccggctccg gatcggacga ttgcgtcgca 3060

tcgaccctgc gcccaagctg catcatcgaa attgccgtca accaagctct gatagagttg 3120

gtcaagacca atgcggagca tatacgcccg gaggcgcggc gatcctgcaa gctccggatg 3180

cctccgctcg aagtagcgcg tctgctgctc catacaagcc aaccacggcc tccagaagag 3240

gatgttggcg acctcgtatt gggaatcccc gaacatcgcc tcgctccagt caatgaccgc 3300

tgttatgcgg ccattgtccg tcaggacatt gttggagccg aaatccgcat gcacgaggtg 3360

ccggacttcg gggcagtcct cggcccaaag catcagctca tcgagagcct gcgcgacgga 3420

cgcactgacg gtgtcgtcca tcacagtttg ccagtgatac acatggggat cagcaatcgc 3480

gcatatgaaa tcacgccatg tagtgtattg accgattcct tgcggtccga atgggccgaa 3540

cccgctcgtc tggctaagat cggccgcagc gatcgcatcc atggcctccg cgaccggctg 3600

gagaacagcg ggcagttcgg tttcaggcag gtcttgcaac gtgacaccct gtgcacggcg 3660

ggagatgcaa taggtcaggc tctcgctgaa ctccccaatg tcaagcactt ccggaatcgg 3720

gagcgcggcc gatgcaaagt gccgataaac ataacgatct ttgtagaaac catcggcgca 3780

gctatttacc cgcaggacat atccacgccc tcctacatcg aagctgaaag cacgagattc 3840

ttcgccctcc gagagctgca tcaggtcgga gacgctgtcg aacttttcga tcagaaactt 3900

ctcgacagac gtcgcggtga gttcaggctt tttcatttgg atgcttgggt agaataggta 3960

agtcagattg aatctgaaat aaagggagga agggcgaact taagaaggta tgaccgggtc 4020

gtccacttac cttgcttgac aaacgcacca agttatcgtg caccaagcag cagatgataa 4080

taatgtcctc gttcctgtct gctaataaga gtcacacttc gagcgccgcc gctactgcta 4140

caagtggggc tgatctgacc agttgcctaa atgaaccatc ttgtcaaacg acacaaattt 4200

tgtgctcacc gcctggacga ctaaaccaaa ataggcattc attgttgacc tccactagct 4260

ccagccaagc ccaaaaaatg ctccttcaat atcagttaac gtcgacggta tcgattggaa 4320

tgcatggagg agttctgtac gcgcaattcc gctctccgta aggatgcttc ggaggtgcac 4380

atggtctcat acatgtaggc ccgacgagga tcgagtcggt tccgaagtag gatcgtctcg 4440

attgttgggc atcattgcat ggacattcag agggcctact gatacctgga atccgcaccg 4500

tccggctacc tagcaataag attctgtgta tataaagggc taaggtgtcc gtccttgata 4560

aaaccaccac cctcaacaac ttacctcgac tatcagcatc ccgtcctatc taacaatcgt 4620

ccatcggtat ccaactccaa ctctattcgc agggtcctag aatcgatggc gccctatagc 4680

atggtactcc ttggcgccct ctcaatcctt gggtttgggg cttatgctca agaggatatc 4740

catatggcta gcaggatggt gagcaagggc gaggagctgt tcaccggggt ggtgcccatc 4800

ctggtcgagc tggacggcga cgtaaacggc cacaagttca gcgtgtccgg cgagggcgag 4860

ggcgatgcca cctacggcaa gctgaccctg aagttcatct gcaccaccgg caagctgccc 4920

gtgccctggc ccaccctcgt gaccaccctg acctacggcg tgcagtgctt cagccgctac 4980

cccgaccaca tgaagcagca cgacttcttc aagtccgcca tgcccgaagg ctacgtccag 5040

gagcgcacca tcttcttcaa ggacgacggc aactacaaga cccgcgccga ggtgaagttc 5100

gagggcgaca ccctggtgaa ccgcatcgag ctgaagggca tcgacttcaa ggaggacggc 5160

aacatcctgg ggcacaagct ggagtacaac tacaacagcc acaacgtcta tatcatggcc 5220

gacaagcaga agaacggcat caaggtgaac ttcaagatcc gccacaacat cgaggacggc 5280

agcgtgcagc tcgccgacca ctaccagcag aacaccccca tcggcgacgg ccccgtgctg 5340

ctgcccgaca accactacct gagcacccag tccgccctga gcaaagaccc caacgagaag 5400

cgcgatcaca tggtcctgct ggagttcgtg accgccgccg ggatcactct cggcatggac 5460

gagctgtaca agaaggccta atcagatctg cggccgcccg gctgcagatc gttcaaacat 5520

ttggcaataa agtttcttaa gattgaatcc tgttgccggt cttgcgatga ttatcatata 5580

atttctgttg aattacgtta agcatgtaat aattaacatg taatgcatga cgttatttat 5640

gagatgggtt tttatgatta gagtcccgca attatacatt taatacgcga tagaaaacaa 5700

aatatagcgc gcaaactagg ataaattatc gcgcgcggtg tcatctatgt tactagatcc 5760

gatgataagc tgtcaaacat gagaattcct gcagcccggg ggatccacta gttctagagc 5820

ggccgccacc gcggtg 5836

<210> 4

<211> 23

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Met Ala Pro Tyr Ser Met Val Leu Leu Gly Ala Leu Ser Ile Leu Gly

1 5 10 15

Phe Gly Ala Tyr Ala Gln Glu

20

<210> 5

<211> 30

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Ala Pro Tyr Ser Met Val Leu Leu Gly Ala Leu Ser Ile Leu Gly

1 5 10 15

Phe Gly Ala Tyr Ala Gln Glu Ala Ala Val Glu Glu Pro Gln

20 25 30

<210> 6

<211> 40

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Ala Pro Tyr Ser Met Val Leu Leu Gly Ala Leu Ser Ile Leu Gly

1 5 10 15

Phe Gly Ala Tyr Ala Gln Glu Ala Ala Val Glu Glu Pro Gln Ile Phe

20 25 30

Phe Asn Leu Thr Tyr Thr Glu Tyr

35 40

<210> 7

<211> 50

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Met Ala Pro Tyr Ser Met Val Leu Leu Gly Ala Leu Ser Ile Leu Gly

1 5 10 15

Phe Gly Ala Tyr Ala Gln Glu Ala Ala Val Glu Glu Pro Gln Ile Phe

20 25 30

Phe Asn Leu Thr Tyr Thr Glu Tyr Leu Asp Lys Val Ala Ala Ser His

35 40 45

Gly Ser

50

<210> 8

<211> 239

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Phe Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys

225 230 235

<210> 9

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Asp Ile His Met Ala Ser Arg Pro

1 5

<210> 10

<211> 7

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Asp Ile His Met Ala Ser Arg

1 5

<210> 11

<211> 5

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 11

Asp Ile His Met Ala

1 5

<210> 12

<211> 3

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 12

Asp Ile His

1

Claims

1. A fungal secretion expression vector, characterized in that: the 23aa sequence of the N end of the Six1d secretory protein is inserted into 4665bp position of the pCT74 vector: MAPYSMVLLGALSILGFGAYAQE, and a section of enzyme cutting site short sequence is connected behind the sequence, wherein the nucleotide sequence of the enzyme cutting site short sequence is as follows: GATATCCATATGGCTAGCAGGCCT, constructing the obtained fungus secretory expression vector 74 HSP.

2. A fungal secretion expression vector according to claim 1, wherein: the nucleotide sequence of the 23aa extracellular signal peptide at the N end of the Six1d secretory protein is as follows: ATGGCGCCCTATAGCATGGTACTCCTTGGCGCCCTCTCAATCCTTGGGTTTGGGGCTTATGCTCAAGAG are provided.

3. A fungal secretion expression vector according to claim 1, wherein: and connecting an exogenous EGFP gene into the short sequence of the enzyme cutting site to form a 74HSP-EGFP recombinant vector.

4. A fungal secretion expression vector according to claim 3, wherein: the sequence of the 74HSP-EGFP recombinant vector is shown in a sequence table as SEQ ID NO: 3.

5. A method for constructing a fungal secretion expression vector according to any one of claims 1 to 4, wherein the method comprises the steps of: the method comprises the following steps:

(1) through signal peptide analysis, the sequence of the secretion signal peptide is determined to be 23aa sequence at the N end of Six1d protein: MAPYSMVLLGALSILGFGAYAQE, and designing a short sequence of enzyme cutting sites, wherein the nucleotide sequence is: GATATCCATATGGCTAGCAGGCCT, the restriction enzyme site short sequence comprises four restriction enzyme sites of EcoRV, NdeI, NheI and StuI;

(3) and connecting a vector sequence containing a signal peptide and a short sequence of the enzyme cutting site to a pCT74 vector through T4-DNA ligase, and connecting the short sequence of the enzyme cutting site to a nucleotide sequence of the extracellular signal peptide to obtain the fungus secretory expression vector 74 HSP.

6. A method for constructing a fungal secretion expression exogenous gene system according to claim 5, wherein the method comprises the following steps: the method comprises the following steps:

7. Use of a fungal secretion expression vector according to any one of claims 1 to 4 for the expression of a foreign protein.