CN111205996A

CN111205996A - Wine malic acid-lactic acid fermentation strain and application thereof

Info

Publication number: CN111205996A
Application number: CN201911131195.2A
Authority: CN
Inventors: 杨学山; 祝霞; 赵丹丹; 王璐璐; 刘琦; 王诗; 韩舜愈
Original assignee: Gansu Agricultural University
Current assignee: Gansu Agricultural University
Priority date: 2019-11-19
Filing date: 2019-11-19
Publication date: 2020-05-29
Anticipated expiration: 2039-11-19
Also published as: CN111205996B

Abstract

The invention discloses a malic acid-lactic acid fermentation strain for wine and application thereof, which is classified and named as Oenococcus oeni (O.oeni) GS-1 and is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number as follows: CGMCC 18682, with the preservation date of 2019, 10 months and 14 days, inoculating wine coccus oeni, O.oeni) GS-1 into a wine sample after the alcoholic fermentation is finished, starting the fermentation within 24 hours at the fermentation temperature of 18-20 ℃, completing malic acid-lactic acid fermentation within 9-10 days, having strong acid reduction capability and excellent fermentation performance, being capable of obviously improving the total amount of aroma compounds of the variety in the fermented wine sample, enriching flavor components, brewing dry red wine with a typical style, and having good economic benefit and application prospect.

Description

Wine malic acid-lactic acid fermentation strain and application thereof

Technical Field

The invention relates to the technical field of bioengineering, in particular to a malic acid-lactic acid fermentation strain for wine and application thereof.

Background

Malolactic fermentation (MLF) of wine refers to a fermentation process of converting L-malic acid into L-lactic acid using Oenococcus oeni, o.oeni, among lactic acid bacteria. The good MLF can improve and optimize the taste and quality of the wine, so that the wine has increasingly complex aroma, softer taste and fuller and more harmonious wine body. In recent years, in order to highlight the characteristics and regional characteristics of the producing area, the screening and identification of the local excellent O.oeni strain and the related research on the improvement of the vinosity and the appearance of the microbial weathered soil of the producing area become the focus of industrial attention.

Under proper conditions, MLF can be naturally started, and some excellent floras with good genetic stability, strong stress resistance and acidity reducing capability and unique flavor can survive and accumulate. About 40 kinds of lactic acid bacteria in naturally fermented wine-like products are mainly classified into Lactobacillus (Lactobacillus) and Streptococcus (Streptococcus) families, including Lactobacillus (Lactobacillus), Oenococcus (Oenococcus), Leuconostoc (Leuconostoc) and Pediococcus (Pediococcus). Naturally started MLF is difficult to predict and control, and has the problems of long time consumption, high risk, high wine uncertainty and the like, so that pure fermentation is one of the main means for controlling the smooth proceeding of MLF. Among the wide variety of lactic acid bacteria, the superior o.oeni strain is generally capable of high SO at low pH, high alcoholic strength₂The quality concentration and the survival in the wine environment with low fermentation temperature are the main strains for leading the MLF.

The wine production area of the Hexi corridor in Gansu is positioned between 36-40 degrees of north latitude, has a very special geographical ecological environment, is long and narrow in east and west, rich in light energy resources, large in day and night temperature difference, rich in soil mineral content, and has the natural advantages of producing high-quality wine-making grapes and wine. In actual production, MLF process control is one of the most concerned problems for brewers, and strain and process parameter selection is usually carried out in a targeted manner according to the characteristics of grapes, so that wine with typical style and outstanding features is brewed. However, at present, no local o.oeni is popularized and sold in China, and wine enterprises either do not perform MLF or only select commodity leaven imported from abroad to perform fermentation in the production process, so that the problems of standardization and homogenization of the produced wine are very serious. Therefore, production enterprises urgently need good fermentation strains capable of performing MLF (MLF) by adopting manual inoculation to brew high-quality wine with the characteristics of wind and soil improvement in production areas.

Disclosure of Invention

The invention aims to solve the defects in the prior art and provide a malic acid-lactic acid fermentation lactobacillus strain which can be used for rapidly starting fermentation and has good acid reduction performance and application thereof.

In order to achieve the purpose, the invention is implemented according to the following technical scheme:

a malic acid-lactic acid fermentation lactobacillus strain is classified and named as Oenococcus oeni (O.oeni) GS-1, and is preserved in the China general microbiological culture Collection center (CGMCC), with the preservation address as follows: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, with the deposit number: CGMCC 18682, with preservation date of 2019, 10 months and 14 days.

The malic acid-lactic acid fermentation lactic acid bacteria strain is applied to brewing of wine, and the Oenococcus oeni (O.oeni) GS-1 is used for brewing of wine; the wine coccus oenni (O.oeni) GS-1 is inoculated in a wine sample after the alcoholic fermentation is finished, the malic acid-lactic acid fermentation is started within 24 hours under the condition that the fermentation temperature is 18-20 ℃, and the malic acid-lactic acid fermentation is finished within 9-10 days.

Compared with the prior art, the wine coccus oenni (O.oeni) GS-1 is inoculated in a wine sample after the alcoholic fermentation is finished, the fermentation can be started within 24 hours at the fermentation temperature of 18-20 ℃, malic acid-lactic acid fermentation can be finished within 9-10 days, the acid reducing capability is strong, the fermentation performance is excellent, the total amount of aroma compounds in the fermented wine sample can be obviously improved, the flavor composition is enriched, and dry red wine with a typical style is brewed, so that the dry red wine has good economic benefit and application prospect.

Drawings

FIG. 1 is a graph showing the gram stain results of Oenococcus oeni (O.oeni) GS-1 of the present invention.

FIG. 2 is a morphological diagram of the colony of the present invention of Oenococcus oeni (O.oeni) GS-1.

FIG. 3 is a growth curve of the Oenococcus oeni (O.oeni) GS-1 strain of example 2 of the present invention.

FIG. 4 is a graph showing the content of L-malic acid in a fermented wine sample according to example 3 of the present invention.

FIG. 5 shows the types and total contents of volatile aroma compounds in the fermented wine sample of example 4 of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. The specific embodiments described herein are merely illustrative of the invention and do not limit the invention.

Example 1

The malic acid-lactic acid fermentation lactic acid bacterial strain GS-1 is obtained by separating and screening a naturally started malic acid-lactic acid fermentation wine sample in a wine production area of a corridor in Hexi of Gansu, and the specific separation and screening method is to collect a cabernet sauvignon sample naturally started to be subjected to malic acid-lactic acid fermentation in a production enterprise, and dilute the cabernet sauvignon sample to 10 degrees by using sterilized normal saline^-1-10^-8Shaking, absorbing 0.1mL of the solution, spreading the solution on an ATB separation medium for separation culture, and performing anaerobic culture at 28 ℃ for 5-7 days. Observing the form of the formed colony, and selecting a white single colony which is small (the diameter is less than 1mm) and smooth and moist in surface to repeatedly streak and separate on an ATB separation culture medium until the colony is purified. Respectively inoculating the primary screening bacteria into 48-pore plates containing 3 secondary screening culture mediums, carrying out anaerobic culture at 28 ℃ for 3-5d, and detecting the capacity of separating and purifying strains for converting malic acid into lactic acid: detecting the malic acid conversion capability of the strain by using a 48-pore plate lactic acid chromogenic reaction system from 3d, uniformly mixing bacterial liquid in each pore by using a sterilization toothpick on a superclean bench, and then respectively using bacteria liquid in each poreSucking 10-50 μ L of bacteria liquid into a new autoclaved empty 48-well plate by a row gun to obtain a culture solution, sequentially adding a chromogenic reagent, fully mixing, putting into a 37 ℃ water bath or an incubator, reacting for 20-60 min, observing color change and recording: using blank culture medium without bacteria liquid as contrast, using plus to represent that the color development is most obvious, + -to represent that the color development is more obvious, + - "to represent that the color development is available, and minus to represent that the color is not changed, and selecting the strain with the most obvious color development plus as the primary screening strain by detecting the L-lactic acid production amount in the culture liquid;

re-screening strains: after the strains obtained by primary screening are subjected to slant surface activation by an ATB separation culture medium, 3 single colonies of each strain are selected and respectively inoculated into a deep pore plate containing three proliferation culture media, a plurality of pores are reserved for not inoculating the strains, the control group is used, 3 repeated pore plates are arranged for each strain, the inoculated porous plates are placed in an anaerobic culture box for culturing for 3-5d at the temperature of 25-28 ℃, after obvious strain precipitation exists at the bottom of a 48 pore plate, a 48 pore plate lactic acid chromogenic reaction system is used for detection, and a strain GS-1 with optimal lactic acid production capacity is screened;

and (3) strain identification: the strain GS-1 is preliminarily identified by a physicochemical experiment, and the strain is finally identified by a molecular biological method, which comprises the following steps:

morphological characteristics:

as shown in FIG. 1, the gram stain of the strain GS-1 was positive, the cell morphology was circular or oval, the cells did not move, and the cells were arranged in pairs, chains or clusters.

Characteristics of culture

After anaerobic culture at 28 ℃ for 5-7 days, milky white colonies with smooth, moist, uniform size and shape and diameter of about 1mm can be observed on an ATB solid medium, the center of the colonies is raised, and the edges are relatively regular, as shown in FIG. 2.

Catalase assay

The catalase test was carried out on the strain GS-1, and no air bubbles were generated around all the strains on the slide glass, and the result was shown to be a catalase-negative strain.

Genetic characterization (Strain 16S rDNA sequence)

The invention determines the 16S rDNA sequence of the strain GS-1, and the 16S rDNA sequencing result of the strain is searched, compared and analyzed by a BLAST method to a GenBank database, and the result shows that the strain is the Oenococcus oeni (O.oeni). 16S rDNA sequencing of the strain GS-1 (Wuhan division, Kyoto Liu He Hua Dagene technology Co., Ltd., Beijing) results:

TAGCGTGAGACCCTTAGAGTGAGATCGTGTCACGCGAGTCACCGCGG TGACCCCATAGGTGAAGTGAGGCAATGACTATAGTGGCGAACTGGTGAGT AACACGTAAGAAACCTGCCCTTTAGTGGGGGATAACATTTGGAAACAGAT GCTAATACCGCGTAACAACAAATCACACATGTGATCTGTTTGAAAGGTCCT TTTGGATCGCTAGAGGATGGTCTTGCGGCGTATTAGCTTGTTGGTAGGGTA GAAGCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGGCCGGCC ACATTGGGACTGAGACACTGCCCAAACTCCTACGGGAGGCTGCAGTAGGG AATTTTCCGCAATGCACGAAAGTGTGACGGAGCGACGCCGCGTGTGTGAT GAAGGCTTTCGGGTCGTAAAGCACTGTTGTAAGGGAAGAATAACTGAATT CAGAGAAAGTTTTCAGCTTGACGGTACCTTACCAGAAAGGGATGGCTAAA TACGTGCCAGCAGCCGCGGTAATACGTATGTCCCGAGCGTTATCCGGATTTA TTGGGCGTAAAGCGAGCGCAGACGGTTTATTAAGTCTGATGTGAAATCCCG AGGCCCAACCTCGGAACTGCATTGGAAACTGATTTACTTGAGTGCGATAGA GGCAAGTGGAACTCCATGTGTAGCGGTGAAATGCGTAGATATGTGGAAGA ACACCAGTGGCGAAAGCGGCTTGCTAGATCGTAACTGACGTTGAGGCTCG AAAGTATGGGTAGCAAACGGGATTAGATACCCCGGTAGTCCATACCGTAAA CGATGGGTGCTAGTTGTTAAGAGGTTTCCGCCTCCTAGTGACGTAGCAAAC GCATTAAGCACCCCGCCTGAGGAGTACGGCCGCAAGGCTAAAACTTAAAG GAATTGACGGGGACCCGCACAAGCGGTGGAGCATGTGGGTTTAATTCGAA GATACGCGAAAAACCTTACCAGGTCTTGACATACCAATGATCGCTTTTGTAT GAAAGCTTTTCTTCGAACATTGGAAAACAGGTGGTGCATGGTCGTCGTCA GCTCGTGTCGTGAGAA。

the above-mentioned wine coccus (Oenococcus oeni, o.oeni) GS-1 is preserved in China general microbiological culture Collection center (CGMCC), with the preservation number: CGMCC 18682, with preservation date of 2019, 10 months and 14 days.

In addition, the present example also provides analysis of fermentation tolerance of the strain GS-1, and the specific analysis process is as follows:

in the wine fermentation process, a plurality of factors inhibiting the growth of the O.oeni strain exist, and under the combined action of the factors, the MLF can be delayed or stopped. After the GS-1 strain is subjected to ATB slant culture and ATB liquid medium activation, the test bacteria in logarithmic growth phase are subjected toThe plant is as follows 10⁷Inoculating CFU/mL to different initial pH values, alcohol degrees and SO₂Fermenting at constant temperature of 20 ℃ in the wine simulation juice with mass concentration. As shown in Table 1, the strains proliferated under different combinations of treatments, especially at pH 3.2, alcohol content 14% and SO₂Can grow even under extreme culture conditions with a mass concentration of 40mg/L, OD₆₀₀The value reaches 0.431, and the fermentation tolerance is good.

Simulated wine juice: 1g/L glucose, 1g/L fructose, 1g/L trehalose, 1g/L, L tartaric acid, 3g/L malic acid, 1g/L citric acid, 0.14g/L sodium acetate, 4.0g/L yeast extract powder, and 2.5 g/L, KH casein hydrolysate₂PO₄0.3g/L, KCl0.22g/L, L-form cysteine 0.5g/L, MgSO₄·7H₂O 0.065 g/L、MnSO₄·4H₂O 0.015g/L、CaCl₂0.065g/L。

TABLE 1 Complex tolerance results

Example 2

The growth curve of the wine coccus (Oenococcus oeni, o.oeni) GS-1 in the simulated wine juice was determined, in this example, the wine coccus (Oenococcus oeni, o.oeni) GS-1 was used as a test strain, and the commercial strain VP41 was used as a control, and the specific application process was as follows:

strain activation:

and (3) taking the cryopreserved wine coccus strain GS-1, placing the wine coccus strain GS-1 at room temperature for 2 hours, then selecting 2 rings from a slant culture medium to inoculate into a prepared liquid culture medium, and culturing in an incubator at 28 ℃ for later use.

Activating with sterile distilled water, weighing the strain of Oenococcus oenotus VP41 refrigerated in refrigerator at an amount of 0.02g/L, and activating at 25 deg.C for 20 min.

Biomass determination:

the O.oeni activated to logarithmic growth phase is inoculated to a 150 mL conical flask filled with wine simulation juice by 4 percent of inoculum concentration, 3 times of each strain is set, the strain is placed in an incubator at 28 ℃ for anaerobic culture, the strain suspension is sucked every 4 hours, the OD600 value of the strain suspension is measured by a spectrophotometer, and an O.oeni growth curve is drawn by taking the OD600 value of the strain as the ordinate and the culture time as the abscissa.

And (4) analyzing results:

FIG. 3 is a graph showing the growth of 2 strains of Alcoholic cocci in ATB medium. As can be seen, the first 12h is the growth adaptation phase of each strain, then GS-1 and VP41 rapidly enter the logarithmic growth phase (12h and 24h), and after 84h, the strain GS-1 enters the growth stationary phase; VP41 grows longer and reaches the stationary phase after about 108 h.

Example 3

In this example, the test strain of the s.cerevisiae (Oenococcus oeni, o.oeni) GS-1 was used as a test strain, and the commercial strain VP41 was used as a control, and the specific application process was as follows:

strain activation:

Activating with sterile distilled water, weighing the Oenococcus oenotus strain refrigerated in refrigerator according to the addition amount of 0.02g/L, and activating at 25 deg.C for 20 min.

L-malic acid determination:

after completing alcohol fermentation of the cabernet sauvignon grapes collected from the Mugao grape planting base in Gansu province in 2018 by referring to the dry red wine production process, the cabernet sauvignon grapes are respectively filled into 2.5L fermentation bottles. And then taking the activated test O.oeni strain as an activated bacterial liquid by 4 percent of inoculation amount, centrifuging at 3000r/min for 10min, discarding supernatant, washing the precipitate into a fermentation bottle by using a wine sample, and taking the wine sample without the O.oeni as a control. And (4) putting the mixture at 20 ℃ to start MLF, and finishing fermentation when the consumption of the L-malic acid in the wine sample is finished or the content of the L-malic acid in the wine sample is not changed any more.

In the MLF fermentation process, samples are taken every 24 hours, the content of the L-malic acid is determined according to the method recommended by an L-malic acid detection kit of Megazyme in Ireland, and the change of the content of the L-malic acid in a wine sample is analyzed. The content of L-malic acid is calculated according to the following formula:

malic acid content (g/L) 0.4980 × [ (a4-A3) - (a2-a1) ] × dilution times.

And (4) analyzing results:

as can be seen from FIG. 4, the content of L-malic acid in all the wine samples except the control group which did not contain the MLF fermented wine sample (CK) was decreased. GS-1 is the strain entering the logarithmic growth phase (12h) fastest (figure 3), the L-malic acid content in the wine induced by fermentation is also reduced fastest, the L-malic acid content is rapidly reduced from 3.378g/L to 2.649g/L at 24h, and the acid reduction rate is highest compared with other strains. When the L-malic acid concentration was reduced to about 0.200g/L, the deacidification rate became slow for all strains. After MLF 9d, only 0.008g/L of malic acid is left in the GS-1 wine sample, and fermentation is completed firstly; while 14d of VP-41, the content of wine-like malic acid of the control group without inoculation is almost unchanged, and the result shows that the GS-1 strain (CGMCC 18682) has good L-malic acid degradation capability.

Example 4

The application of the strain GS-1 of Oenococcus oenni (O.oeni) to the brewing of the dry red wine with cabernet sauvignon, in this example, the strain GS-1 of Oenococcus oenni (O.oeni) is used as a test strain, and the commercial strain VP41 is used as a control, and the specific application process is as follows:

1) removing stems of grapes and crushing: manually sorting the grapes, removing green fruits, rotten fruits and fruit stalks, uniformly mixing and crushing;

2) canning: mixing manually crushed grape juice (with skin), and filling into a 5L brown wide-mouth bottle according to 80% liquid loading amount;

3)SO₂and addition of pectinase: adding 40mg/L SO to the fermenter₂When added, the solution was dissolved in an appropriate amount of grape juice, added to a large bottle and shaken up. Dissolving pectinase in appropriate amount of distilled water, activating for 20min, adding 30mg/L into grape juice, and soaking at 25 deg.C for 48 hr;

4) activation of saccharomyces cerevisiae: according to the method and the dosage recommended by the instruction, the saccharomyces cerevisiae strain V is addedAdding 50mLdd H into dry powder R₂O, activating in 37 ℃ water bath for 15min, then adding into 50mL of grape juice, activating in 30 ℃ water bath for 15min, and inoculating the activated yeast strain into the grape juice according to the addition of 200 mg/L;

5) alcohol fermentation: controlling the temperature at 25 deg.C, shaking the tank at regular time during fermentation, pressing in "wine cap" in time, monitoring the content of total sugar, terminating alcohol fermentation when the total sugar is less than or equal to 4.0g/L (generally 4-6 days), and separating out the tank;

6) malic acid-lactic acid fermentation: after the alcohol is finished, the fermentation temperature is reduced to 20 ℃, and the wine coccus GS-1 strain is inoculated for malic acid-lactic acid fermentation. Expanding ATB culture medium to GS-1 strain 6000r/min in logarithmic growth phase (OD600 ≈ 1.0), centrifuging for 15min, and ddH₂Washing for 2 times by using O, and inoculating into the wine sample to be fermented according to the inoculation amount of 5%. Monitoring the content of the L-malic acid in the MLF process, and ending the malic acid-lactic acid fermentation when the content of the L-malic acid is less than or equal to 0.3 g/L;

7) and (3) fermentation post-treatment: supplementing SO according to the dosage of 50mg/L after MLF is finished₂Sealing the full tank for storage, and periodically pouring the tank to remove wine lees until the wine sample is clear;

8) measuring physical and chemical indexes of the fermented wine sample: the samples of the cabernet sauvignon dry red wine are basically detected in a physicochemical way, and the results all meet the requirements of national standard GB/T15037-2006, which is shown in Table 2.

TABLE 2 physical and chemical indexes of wine samples before and after malic acid-lactic acid fermentation

Physical and chemical indexes	MLF Pre-liquor sample	VP41	GS-1
				pH	3.41	3.59	3.64
Residual sugar (g/L)	2.10	1.90	1.80
				Alcohol content (%)	12.30	12.20	12.10
Total acid (g/L)	9.42	6.89	6.86
				Volatile acid (g/L)	0.20	0.35	0.39
Total SO₂(mg/L)	28.25	35.40	34.25

In addition, the volatile aroma compounds of the fermented wine sample are determined by performing qualitative and quantitative analysis of the volatile aroma compounds of the cabernet sauvignon dry red wine after MLF fermentation and the non-MLF fermented wine sample (CK) by GC-MS, from FIG. 5, 81 aroma substances are detected in the experiment, wherein 18 types of alcohols, 36 types of esters, 10 types of acids, 12 types of terpenes and 5 types of other aroma substances are detected in the VP41 strain fermented wine sample, wherein the total content is 14.36mg/L, 69 types of aroma substances (the total content is 14.02mg/L) and 58 types of aroma substances (the total content is 12.87 mg/L) are detected in the GS-1 strain and the non-MLF wine sample respectively, the types and the content of terpene compounds detected in the wine sample of the strain GS-1 are the highest, and 12 types (the total content is 0.27mg/L) are 12 types (the total content is 0.27mg/L), and the terpene compounds detected in the wine samples have significant difference (P <0.05), and the main terpene compounds detected in the wine samples are 84- β, farnesene compounds and the wine sample has no fragrance of fruits, and the fragrance of the wine sample has no fragrance of the fragrance of.

And then measuring the fermented wine sample ethyl carbamate and the biogenic amine: and (3) detecting the contents of Ethyl Carbamate (EC), biogenic amine putrescine with high harm, histamine and tyramine in the cabbagate dry red wine after MLF fermentation and the wine sample without MLF fermentation. The results show that the differences of the detection results of EC and biogenic amine in the GS-1 strain and the commercial strain VP41 fermented wine sample are not obvious (Table 3, P is more than 0.05).

TABLE 3 wine-like Ethyl carbamate, Primary biogenic amine indices before and after malic acid-lactic acid fermentation

Measurement index	Liquor sample without MLF	VP41	GS-1
				EC(μg/L)	10.05±0.10^a	15.35±0.10^b	15.73±0.06^b
Putrescine (mg/L)	0.71±0.01^a	0.44±0.00^b	0.42±0.01^b
				Histamine (mg/L)	0.03±0.01^a	0.03±0.01^a	0.03±0.01^a
Tyramine (mg/L)	0.01±0.00^a	0.01±0.00^a	0.01±0.00^a

Note: different lowercase letters after the same row of data indicate significance of difference in the level P < 0.05.

The technical solution of the present invention is not limited to the limitations of the above specific embodiments, and all technical modifications made according to the technical solution of the present invention fall within the protection scope of the present invention.

SEQUENCE LISTING

<110> university of agriculture in Gansu province

<120> wine malic acid-lactic acid fermentation strain and application thereof

<130>2019

<160>1

<170>PatentIn version 3.3

<210>1

<211>1073

<212>DNA

<213> s.cerevisiae (Oenococcus oeni, O. oeni) GS-1

<400>1

tagcgtgaga cccttagagt gagatcgtgt cacgcgagtc accgcggtga ccccataggt 60

gaagtgaggc aatgactata gtggcgaact ggtgagtaac acgtaagaaa cctgcccttt 120

agtgggggat aacatttgga aacagatgct aataccgcgt aacaacaaat cacacatgtg 180

atctgtttga aaggtccttt tggatcgcta gaggatggtc ttgcggcgta ttagcttgtt 240

ggtagggtag aagcctacca aggcaatgat gcgtagccga gttgagagac tggccggcca 300

cattgggact gagacactgc ccaaactcct acgggaggct gcagtaggga attttccgca 360

atgcacgaaa gtgtgacgga gcgacgccgc gtgtgtgatg aaggctttcg ggtcgtaaag 420

cactgttgta agggaagaat aactgaattc agagaaagtt ttcagcttga cggtacctta 480

ccagaaaggg atggctaaat acgtgccagc agccgcggta atacgtatgt cccgagcgtt 540

atccggattt attgggcgta aagcgagcgc agacggttta ttaagtctga tgtgaaatcc 600

cgaggcccaa cctcggaact gcattggaaa ctgatttact tgagtgcgat agaggcaagt 660

ggaactccat gtgtagcggt gaaatgcgta gatatgtgga agaacaccag tggcgaaagc 720

ggcttgctag atcgtaactg acgttgaggc tcgaaagtat gggtagcaaa cgggattaga 780

taccccggta gtccataccg taaacgatgg gtgctagttg ttaagaggtt tccgcctcct 840

agtgacgtag caaacgcatt aagcaccccg cctgaggagt acggccgcaa ggctaaaact 900

taaaggaatt gacggggacc cgcacaagcg gtggagcatg tgggtttaat tcgaagatac 960

gcgaaaaacc ttaccaggtc ttgacatacc aatgatcgct tttgtatgaa agcttttctt 1020

cgaacattgg aaaacaggtg gtgcatggtc gtcgtcagct cgtgtcgtga gaa 1073

Claims

1. A malic acid-lactic acid fermenting lactic acid bacterial strain, which is characterized in that: the wine coccus (Oenococcus oeni, O.oeni) GS-1 is classified and named as Oenococcus oeni, is preserved in the China general microbiological culture Collection center, and has the preservation number of: CGMCC 18682, with preservation date of 2019, 10 months and 14 days.

2. Use of a strain of lactic acid fermenting malic acid according to claim 1 wherein: the wine coccus (Oenococcus oeni, O.oeni) GS-1 is used for brewing wine.

3. Use of a strain of lactic acid fermenting malic acid according to claim 2 characterized in that: the said wine coccus (Oenococcus oeni, O.oeni) GS-1 is inoculated in the wine sample after the alcohol fermentation is finished, and the malic acid-lactic acid fermentation is carried out under the condition of 18-20 deg.C.