CN111172322A - Real-time fluorescent quantitative PCR detection method for four pear virus pathogens - Google Patents

Abstract

The invention relates to a real-time fluorescent quantitative PCR detection method for four pear virus pathogens. Primers are designed according to the CP genes of the apple stem groove virus, the apple stem pox virus and the apple chlorotic leaf spot virus published by GenBank and the conserved sequence of the whole genome of the apple russet, and a method for SYBR Green fluorescent quantitative PCR detection of the four viruses and negative and positive judgment is established. The method has the characteristics of strong specificity, accurate detection, good repeatability, low cost and the like. Compared with the conventional reverse transcription polymerase chain amplification reaction detection technology, the detection sensitivity is improved by more than 100 times.

Description

Real-time fluorescent quantitative PCR detection method for four pear virus pathogens

Technical Field

The invention relates to a real-time fluorescent quantitative PCR detection method for four pear virus pathogens, namely Apple Stem Groove Virus (ASGV), Apple Stem Pox Virus (ASPV), Apple Chlorotic Leaf Spot Virus (ACLSV) and apple rust virus (ASSVd).

Background

The pear virus disease is one of the main reasons for weakening the growth vigor of fruit trees and sharp reduction of fruit yield, the average virus carrying rate of the fruit trees in main pear producing areas in China reaches 86.3 percent, and the main virus disease pathogens comprise four kinds of Apple Stem Groove Virus (ASGV), Apple Stem Pox Virus (ASPV), Apple Chlorotic Leaf Spot Virus (ACLSV) and apple rust fruit virus (ASSVd), which seriously affect the pear production.

The pathogen detection method of pear virus is mainly an RT-PCR method, and the method cannot carry out quantitative detection on the virus. Compared with the RT-PCR method, the real-time fluorescence quantitative PCR method can detect the virus more accurately, simply and quantitatively. Real-time fluorescence quantitative PCR is divided into a dye method and a probe method, and the probe method needs to design a fluorescence-labeled probe and is expensive, so that the method is not favorable for detecting a large number of samples. The SYBR Green dye method is adopted, has the characteristics of accurate quantification and low price of the real-time fluorescence quantitative PCR method, is suitable for detecting a large number of samples, provides a judgment basis for the occurrence condition of the virus diseases of the pear trees, and has important significance in the aspects of virus prevention and control and production of non-toxic seedlings.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide a quantitative detection method for main virus pathogens of four pear trees.

The invention aims at four main viruses of apple stem furrow virus (ASGV), Apple Stem Pox Virus (ASPV), Apple Chlorotic Leaf Spot Virus (ACLSV) and apple rusty fruit virus (ASSVd) infected with pear, and primer design is carried out according to conserved region sequences of the apple stem furrow virus (ASGV), Apple Stem Pox Virus (ASPV), Apple Chlorotic Leaf Spot Virus (ACLSV) and apple rusty fruit virus (ASSVd) published on NCBI, so that a method for detecting the apple stem furrow virus (ASGV), the Apple Stem Pox Virus (ASPV), the Apple Chlorotic Leaf Spot Virus (ACLSV) and the apple rusty fruit virus (ASSVd) by SYBR Green fluorescent quantitative PCR and carrying out negative and positive judgment is established, and the quantitative detection of the four viruses is realized.

In order to achieve the above purposes, the technical scheme adopted by the invention is as follows:

the real-time fluorescence quantitative PCR detection method for four viruses infecting pear, namely apple stem furrow virus (ASGV), Apple Stem Pox Virus (ASPV), Apple Chlorotic Leaf Spot Virus (ACLSV) and apple rust virus (ASSVd), comprises the following steps:

(1) designing SYBR Green I fluorescent quantitative PCR primers of Apple Stem Groove Virus (ASGV), Apple Stem Pox Virus (ASPV), Apple Chlorotic Leaf Spot Virus (ACLSV) and apple rust virus (ASSVd);

(2) carrying out primer screening, and carrying out PCR amplification at different annealing temperatures according to the screened primers so as to confirm the optimal reaction conditions;

(3) construction of the Standard Curve

According to the primer screened in the step (2), performing real-time fluorescent quantitative amplification by taking the CP gene of Apple Stem Groove Virus (ASGV), Apple Stem Pox Virus (ASPV), Apple Chlorotic Leaf Spot Virus (ACLSV) and whole genome cDNA of apple rust fruit virus (ASSVd) as templates, and drawing a fluorescent quantitative standard curve;

(4) and the experiment is established standard

Positive and negative controls were set up for each experiment. If the negative control has no Ct value and is a random amplification curve, and meanwhile, the Ct value of the positive control is less than 35.0, and the amplification curve and the melting curve are normal, the experiment is established. If the negative and positive controls do not meet the above conditions, the experiment is considered to be ineffective.

(5) Negative and positive judgment criteria

Under the condition that the experiment is established, if the Ct value of the sample to be tested is less than 35.0 and the amplification curve and the melting curve are similar to the positive control, the sample is judged to be positive; and if the sample to be detected has no Ct value or is more than 35 and the amplification curve and the melting curve are different from the positive control, judging the sample to be detected to be negative.

On the basis of the scheme, in the step (1), according to the Apple Stem Groove Virus (ASGV), Apple Stem Pox Virus (ASPV), Apple Chlorotic Leaf Spot Virus (ACLSV) CP gene sequences and the whole genome sequence of apple rust virus (ASSVd), sequence alignment is carried out through Bioedit software, a conserved region of the gene sequences is determined, and according to the conserved region, a fluorescence quantitative primer is designed by using PrimerPremier 6 software;

the name of each virus detection primer is as follows:

apple stem groove virus detection primers: an upstream primer: ASGV-F; a downstream primer: ASGV-R;

apple stem poxvirus detection primers: an upstream primer: ASPV-F; a downstream primer: ASPV-R;

detection primers of the apple chlorotic leaf spot virus: an upstream primer: ACLSV-F; a downstream primer: ACLSV-R;

detection primers of apple rust viroid: an upstream primer: ASSVd-F; a downstream primer: ASSVd-R;

the primer sequences are as follows:

ASGV-F：5’CCACTTCTAGGCAGAACTCTTTGAACGA 3’；

ASGV-R：5’TGAAGAAATTCACGAGCCAAATCAGCAA 3’；

ASPV-F：5’GAGAGAGTAGCCAATGCCACGAGCAA 3’；

ASPV-R：5’CACCAAAATTCACAGCTTGGGTACC 3’；

ACLSV-F：5’TGAGAGGCTCTATTCACATCTTG 3’；

ACLSV-R：5’CAATTGGAATATCCCCTTCTGCGAT 3’；

ASSVd-F：5’TCGACGAAGGCCGGTGAGAAAGGAG 3’；

ASSVd-R：5’TTGTAGGCGAACCCACAGCGGAACT 3’。

on the basis of the scheme, in the step (2), the positive control of each virus is taken as a template, different primers are used for PCR amplification, amplification products are subjected to gel electrophoresis to detect amplification specificity and amplification efficiency, meanwhile, annealing steps are carried out at different temperatures, the primers with strong specificity and high amplification efficiency are screened, and the optimal annealing temperature is determined to be 58 ℃.

On the basis of the above scheme, the PCR reaction procedure in step (2) is as follows: 2min at 95 ℃; 30s at 95 ℃, 30s at 53-63 ℃, 30s at 72 ℃ and x 40 for circulation; 10min at 72 ℃; 10min at 4 ℃.

Based on the above protocol, real-time fluorescence quantitative PCR reaction was performed using TaKaRa Premix Ex Taq (RR420A) kit, and the reaction system is shown in Table 1 below.

TABLE 1 fluorescent quantitative PCR reaction System

On the basis of the scheme, an ABI 7500System fluorescent quantitative PCR instrument is used for real-time fluorescent quantitative PCR reaction, and the reaction program is as follows: 5min at 95 ℃; fluorescence signals were collected at 95 ℃ for 5s, 58 ℃ for 15s, 72 ℃ for 20s, 40 cycles, and 72 ℃.

On the basis of the scheme, a pear cDNA template which is detected to be positive by RT-PCR is selected as a positive control, and a healthy pear cDNA template without virus is selected as a negative control.

If the positive result is judged, the sample contains the virus to be detected; if the result is negative, the sample does not contain the virus to be detected.

Has the advantages that:

the fluorescent quantitative PCR detection primer designed by the invention is verified by multiple sequence analysis and multiple experiments, has the characteristics of good specificity, high accuracy, good sensitivity and the like, provides a specific and feasible experimental method for quantitative detection of pear virus, and has important production significance.

Drawings

The invention has the following drawings:

FIGS. 1(1) and (2) are graphs showing the results of amplification of four pairs of primers of the present invention at different annealing temperatures;

FIG. 2(1) alignment chart of ASGV primer sequences;

(2) ASGV fluorescence quantitative amplification curve graphs with different copy numbers;

(3) ASGV fluorescence quantitative melting curve diagram;

FIG. 3(1) alignment chart of ASPV primer sequences;

(2) ASPV fluorescence quantitative amplification curves of different copy numbers;

(3) ASPV fluorescence quantitative melting curve diagram;

FIG. 4(1) alignment chart of the ACLSV primer sequences;

(2) the fluorescent quantitative amplification curve graphs of the ACLSV with different copy numbers;

(3) an ACLSV fluorescence quantitative melting curve diagram;

FIG. 5(1) alignment chart of ASSVd primer sequences;

(2) ASSVd fluorescence quantitative amplification plots of different copy numbers;

(3) ASSVd fluorescence quantitative melting profile.

Detailed Description

The present invention is described in further detail below with reference to figures 1-5.

Example 1 target selection, primer design and primer screening

(1) Target selection and primer design

The http:// www.ncbi.nlm.nih.gov/blast website is used to search the CP gene sequences of the various isolates of the released Apple Stem Groove Virus (ASGV), Apple Stem Pox Virus (ASPV) and the whole genome sequences of the various isolates of the Apple Chlorotic Leaf Spot Virus (ACLSV) and apple rusty fruit virus (ASSVd), and the sequences are aligned by using ClustalWmultiplex alignment method through Bioedit software. Marking hosts of different virus isolates, finding out the pear-derived virus isolate and designing primers aiming at conserved regions of gene sequences. The sequences of the primers are shown in Table 2, and the conservative alignment chart of the primers and the sequences of the virus isolates from different sources is shown in FIGS. 2, 3, 4 and 5;

TABLE 2 ASGV, ASPV, ACLSV, ASSVd primer sequences

(2) Primer screening

And (3) taking the positive control of each virus as a template, carrying out PCR amplification by using different primers, detecting the amplification specificity and the amplification efficiency of an amplification product through gel electrophoresis, simultaneously carrying out annealing steps at different temperatures, screening out the primers with strong specificity and high amplification efficiency, and determining the optimal annealing temperature for carrying out subsequent experiments. The PCR amplification system is shown in Table 3.

TABLE 3 PCR amplification System

The PCR reaction program is: 2min at 95 ℃; 30s at 95 ℃, 30s at 53-63 ℃, 30s at 72 ℃ and x 40 for circulation; 10min at 72 ℃; 10min at 4 ℃.

and carrying out agarose gel electrophoresis on the amplification product, cutting and recovering the gel, connecting a T vector, transforming the amplification product to a DH5 α competent agrobacterium strain, carrying out overnight culture at 37 ℃ on an LB culture medium containing ampicillin resistance, and selecting a single strain to be sent to a biological company for sequencing.

BLAST alignment of the sequencing results confirmed that the amplified products were fragments on the respective viral genomes. Meanwhile, according to the amplification results at different annealing temperatures, the annealing temperature of the q-PCR is set to be 58 ℃.

Measuring real-time fluorescence quantitative PCR amplification curve, melting curve and standard curve of Apple Stem Groove Virus (ASGV), Apple Stem Pox Virus (ASPV), Apple Chlorotic Leaf Spot Virus (ACLSV) and apple rust fruit virus (ASSVd).

The concentration of each virus plasmid is measured by a Nanodrop micro ultraviolet spectrophotometer, and then the virus plasmid is diluted to 1 × 10 according to a 10-fold gradient⁹、1×10⁸、1×10⁷、1×10⁶、1×10⁵、1×10⁴Copy number of plasmid was used as template for fluorescent quantitative PCR amplification (see tables 4-7) according to the method described above, and the results were analyzed according to the criteria described above to obtain amplification curves and melting curves for each virus as shown in FIGS. 2-5.

TABLE 4 Ct values for different copy numbers of ASGV primers

Number of copies	Ct value
			1×109	7.88
1×108	11.5
		1×107	14.74
1×106	18.58
		1×105	21.57
1×104	25.07

TABLE 5 Ct values for different copy numbers of ASPV primers

Number of copies	Ct value
			1×109	9.38
1×108	12.98
		1×107	16.42
1×106	19.89
		1×105	23.08
1×104	26.72

TABLE 6 Ct values for different copy numbers of the ACLSV primers

Number of copies	Ct value
			1×109	7.9
1×108	11.54
		1×107	14.95
1×106	18.42
		1×105	21.7
1×104	25

TABLE 7 Ct values for different copy numbers of ASSVd primers

Number of copies	Ct value
			1×109	9.8
1×108	12.9
		1×107	16.49
1×106	19.91
		1×105	23.08
1×104	26.45

Repeatability verification of fluorescent quantitative PCR detection method

The positive control was selected as a template to evaluate the reproducibility of SYBR Green fluorescent quantitative PCR. 3 parallel experiments were performed and the Ct values of each parallel control group were observed. The results are shown in Table 8.

TABLE 8 Ct value repeatability of four viruses q-PCR

The standard deviation of Ct values of 3 parallel tubes in the same experiment is less than 0.5, which shows that the system has good repeatability.

Those not described in detail in this specification are within the skill of the art.

Sequence listing

<110> university of agriculture in China

<120> real-time fluorescence quantitative PCR detection method for four pear virus pathogens

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>28

<212>DNA

<213> Artificial sequence ()

<400>1

ccacttctag gcagaactct ttgaacga 28

<210>2

<211>28

<212>DNA

<213> Artificial sequence ()

<400>2

tgaagaaatt cacgagccaa atcagcaa 28

<210>3

<211>26

<212>DNA

<213> Artificial sequence ()

<400>3

gagagagtag ccaatgccac gagcaa 26

<210>4

<211>25

<212>DNA

<213> Artificial sequence ()

<400>4

caccaaaatt cacagcttgg gtacc 25

<210>5

<211>23

<212>DNA

<213> Artificial sequence ()

<400>5

tgagaggctc tattcacatc ttg 23

<210>6

<211>25

<212>DNA

<213> Artificial sequence ()

<400>6

caattggaat atccccttct gcgat 25

<210>7

<211>25

<212>DNA

<213> Artificial sequence ()

<400>7

tcgacgaagg ccggtgagaa aggag 25

<210>8

<211>25

<212>DNA

<213> Artificial sequence ()

<400>8

ttgtaggcga acccacagcg gaact 25

Claims (6)

1. The real-time fluorescence quantitative PCR detection method of four viruses infecting pear, namely apple stem groove virus, apple stem pox virus, apple chlorotic leaf spot virus and apple rust viroid, is characterized in that: the method comprises the following steps:

(1) designing SYBRGreen I fluorescent quantitative PCR primers of apple stem groove virus, apple stem pox virus, apple chlorotic leaf spot virus and apple rust viroid;

(2) carrying out primer screening, and carrying out PCR amplification at different annealing temperatures according to the screened primers so as to confirm the optimal reaction conditions;

(3) construction of the Standard Curve

According to the primers screened out in the step (2), performing real-time fluorescence quantitative PCR by taking the CP genes of the apple stem groove virus, the apple stem pox virus and the apple chlorotic leaf spot virus and the whole genome cDNA of the apple rust viroid as templates, and drawing a fluorescence quantitative standard curve;

(4) and the experiment is established standard

Positive and negative controls were set for each experiment; if the negative control has no Ct value and is a random amplification curve, and meanwhile, the Ct value of the positive control is less than 35.0, and the amplification curve and the melting curve are normal, the experiment is established; if the negative and positive controls do not meet the above conditions, the experiment is considered to be invalid;

(5) negative and positive judgment criteria

Under the condition that the experiment is established, if the Ct value of the sample to be tested is less than 35.0 and the amplification curve and the melting curve are similar to the positive control, the sample is judged to be positive; and if the sample to be detected has no Ct value or is more than 35 and the amplification curve and the melting curve are different from the positive control, judging the sample to be detected to be negative.

2. The real-time fluorescent quantitative PCR detection method of claim 1, characterized in that: according to the CP gene sequences of the apple stem groove virus, the apple stem pox virus and the apple chlorotic leaf spot virus and the whole genome sequence of the apple russet virus in the step (1), sequence comparison is carried out through Bioedit software to determine a conserved region of the gene sequence, and a PrimerPremier 6 software is used for designing a fluorescent quantitative primer according to the conserved region;

the name of each virus detection primer is as follows:

apple stem groove virus detection primers: an upstream primer: ASGV-F; a downstream primer: ASGV-R;

apple stem poxvirus detection primers: an upstream primer: ASPV-F; a downstream primer: ASPV-R;

detection primers of the apple chlorotic leaf spot virus: an upstream primer: ACLSV-F; a downstream primer: ACLSV-R;

detection primers of apple rust viroid: an upstream primer: ASSVd-F; a downstream primer: ASSVd-R;

the primer sequences are as follows:

ASGV-F：5’CCACTTCTAGGCAGAACTCTTTGAACGA 3’；

ASGV-R：5’TGAAGAAATTCACGAGCCAAATCAGCAA 3’；

ASPV-F：5’GAGAGAGTAGCCAATGCCACGAGCAA 3’；

ASPV-R：5’CACCAAAATTCACAGCTTGGGTACC 3’；

ACLSV-F：5’TGAGAGGCTCTATTCACATCTTG 3’；

ACLSV-R：5’CAATTGGAATATCCCCTTCTGCGAT 3’；

ASSVd-F：5’TCGACGAAGGCCGGTGAGAAAGGAG 3’；

ASSVd-R：5’TTGTAGGCGAACCCACAGCGGAACT 3’。

3. the real-time fluorescent quantitative PCR detection method of claim 1, characterized in that: in the step (2), the positive control of each virus is taken as a template, different primers are used for PCR amplification, amplification products are subjected to gel electrophoresis to detect the amplification specificity and the amplification efficiency, meanwhile, the annealing step is carried out at different temperatures, the primers with strong specificity and high amplification efficiency are screened, and the optimal annealing temperature is determined to be 58 ℃.

4. The real-time fluorescent quantitative PCR detection method of claim 1, characterized in that: the PCR reaction procedure in the step (2) is as follows: 2min at 95 ℃; 30s at 95 ℃, 30s at 53-63 ℃, 30s at 72 ℃ and x 40 for circulation; 10min at 72 ℃; 10min at 4 ℃.

5. The real-time fluorescent quantitative PCR detection method of claim 1, characterized in that: the real-time fluorescent quantitative PCR reaction uses an ABI 7500System fluorescent quantitative PCR instrument, and the reaction program is as follows: 5min at 95 ℃; fluorescence signals were collected at 95 ℃ for 5s, 58 ℃ for 15s, 72 ℃ for 20s, 40 cycles, and 72 ℃.

6. The real-time fluorescent quantitative PCR detection method of claim 1, characterized in that: selecting a pear cDNA template which is detected to be positive by RT-PCR as a positive control, and selecting a healthy virus-free pear cDNA template as a negative control;

if the positive result is judged, the sample contains the virus to be detected; if the result is negative, the sample does not contain the virus to be detected.

Images