CN111172293A - Kit for detecting hepatitis B virus drug-resistant gene mutation site by Sanger method and detection method - Google Patents
Kit for detecting hepatitis B virus drug-resistant gene mutation site by Sanger method and detection method Download PDFInfo
- Publication number
- CN111172293A CN111172293A CN202010102331.1A CN202010102331A CN111172293A CN 111172293 A CN111172293 A CN 111172293A CN 202010102331 A CN202010102331 A CN 202010102331A CN 111172293 A CN111172293 A CN 111172293A
- Authority
- CN
- China
- Prior art keywords
- pcr amplification
- sanger
- kit
- hepatitis
- resistant gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit and a detection method for detecting a hepatitis B virus drug-resistant gene mutation site by a Sanger method, wherein the kit comprises the following primers and reagents: (1) common PCR amplification primers: pre-amplification primer: TGGTGGACTTCTCTCAATTTTCTAGG, respectively; post amplification primer: AGGAGTTCCGCAGTATGGATCG, respectively; (2) sanger method PCR amplification primers: ATGTGTCTGCGGCGTTTTATCA, respectively; (3) conventional reagents in the kit: HiDi, BigDye, ddH2And O. The kit can detect the hepatitis B virus drug-resistant gene mutation site, and the detection method is suitable for detecting the clinical hepatitis B virus drug-resistant gene mutation, has mature and stable technology, and has good development and application prospects.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a kit and a detection method for detecting a hepatitis B virus drug-resistant gene mutation site by a Sanger method.
Background
the Chronic Hepatitis B (CHB) infection is one of the most common liver diseases in the world, 3.9% of the global population is influenced by 2016, China is the most main hepatitis B major country, according to the hepatitis B serum epidemiological survey result of Chinese population in 2006, the hepatitis B surface antigen carrying rate of people 1-59 years old in China is 7.18%, chronic viral hepatitis B patients are about 3000 ten thousand, at present, nucleoside (acid) analogues and alpha interferon are recognized effective Hepatitis B Virus (HBV) resisting drugs, the nucleoside (acid) analogues are widely applied due to the characteristics of convenience, small adverse reaction, wide adaptation disease and the like, but the nucleoside (acid) analogues are likely to generate drug-resistant mutation after being taken for a long time, most of the drug-resistant mutation is the main obstacle for treating chronic hepatitis B, 5 common nucleoside hepatitis B treatment drugs comprise lamivudine, adefovir dipivoxil, entecavir, tebivudine, tenofovir primary drug, primary drug-resistant mutation, certain drugs are not suitable for treating chronic hepatitis B, the traditional PCR detection method is not suitable for detecting the PCR (PCR) resistant mutation, and the PCR detection method is not suitable for detecting the PCR (PCR) of the PCR) resistant gene mutation, and the detection of the PCR detection of the traditional PCR detection method, and the detection of the traditional PCR detection of the traditional medicine, the traditional detection of the traditional medicine.
Disclosure of Invention
One of the purposes of the invention is to provide a kit for detecting the drug-resistant gene mutation site of hepatitis B virus by a Sanger method, which can accurately and quickly detect the drug-resistant gene mutation site of hepatitis B virus and can be popularized and used.
The invention also aims to provide a detection method for detecting the hepatitis B virus drug-resistant gene mutation site by the Sanger method, the kit is adopted to detect the hepatitis B virus drug-resistant gene mutation site, the detection is convenient and efficient, the accurate mutation site can be detected, and the technical support is provided for the clinical application of hepatitis B drugs.
One of the purposes of the invention adopts the following technical scheme:
a kit for detecting hepatitis B virus drug-resistant gene mutation sites by a Sanger method comprises the following primers and reagents:
(1) common PCR amplification primers:
pre-amplification primer (HBV-WF): TGGTGGACTTCTCTCAATTTTCTAGG, respectively;
post amplification primer (HBV-WR): AGGAGTTCCGCAGTATGGATCG, respectively;
(2) sanger method PCR amplification primers:
sanger method PCR amplification inner primer (HBV-182 WF): ATGTGTCTGCGGCGTTTTATCA, respectively;
(3) conventional reagents in the kit: HiDi, BigDye, ddH2O。
The second purpose of the invention is realized by adopting the following technical scheme:
a detection method for detecting hepatitis B virus drug-resistant gene mutation sites by a Sanger method adopts a kit for detecting hepatitis B virus drug-resistant gene mutation sites by the Sanger method to carry out detection, and comprises the following steps:
(1) extracting human genome DNA;
(2) general PCR amplification system and procedure:
(2.1) preparing a 20 mu L common PCR reaction system, which comprises the following components in percentage by weight:
(2.2) general PCR amplification procedure:
2min at 95 ℃; sequentially carrying out 35 cycles at 95 ℃ for 15s, 60 ℃ for 10s and 72 ℃ for 40 s; stretching at 72 ℃ for 5 min; preserving the heat at 4 ℃ to obtain a common PCR amplification product;
(3) and (3) purifying a common PCR amplification product:
adopting an enzymolysis purification method: adding 1 mu L of exonuclease I and 2 mu L of shrimp small intestine alkaline phosphatase into every 10 mu L of the common PCR amplification product obtained in the step (2); then carrying out enzyme reaction at 37 ℃ for 15 min; then carrying out enzyme inactivation for 15min at 85 ℃ to obtain a purified common PCR amplification product; the purification steps are all completed in a PCR instrument;
(4) sanger PCR amplification system and procedure:
(4.1) preparing a 10 mu LSanger method PCR amplification system, which comprises the following components in percentage by weight:
(4.2) Sanger PCR amplification procedure:
1min at 96 ℃; sequentially carrying out 25 cycles at 96 ℃ for 10s, 50 ℃ for 5s and 60 ℃ for 4 min; preserving the temperature at 4 ℃ to obtain a Sanger PCR amplification product;
(5) and (3) purifying PCR amplification products by a Sanger method and analyzing results:
adopting an EDTA-ethanol gradient elution method: adding 2 mu LEDTA and 50 mu L of absolute ethyl alcohol into the Sanger PCR amplification product obtained in the step (4), uniformly mixing, centrifuging at 4 ℃ of 12000rpm for 20min, throwing off the supernatant, reserving the precipitate, adding 150 mu L of 75% ethyl alcohol, uniformly mixing the precipitate, centrifuging at 4 ℃ of 12000rpm for 10min, throwing off the supernatant, placing in a metal bath for 5-10min, drying the sample, and finally adding 10 mu LHiDi to dissolve the sample to obtain a purified Sanger PCR amplification product; and detecting the mutation sites of the purified PCR amplification products by a gene analyzer.
The invention searches a hepatitis B virus genome sequence in a Genotyping database, finds out specific sites of HBV by combining with chronic hepatitis B control guidelines (2019 edition) in China, and designs common PCR amplification primers and Sanger PCR amplification primers. The common PCR amplification primers comprise: pre-amplification primer (HBV-WF): TGGTGGACTTCTCTCAATTTTCTAGG, respectively; post amplification primer (HBV-WR): AGGAGTTCCGCAGTATGGATCG are provided. The Sanger PCR amplification primer is a Sanger PCR amplification inner primer (HBV-182 WF): ATGTGTCTGCGGCGTTTTATCA are provided. The synthetic primer powder adopts ddH2O5. mu.M primer solution was prepared for use.
The Sanger method is a classical DNA sequence analysis technology, and compared with a sequence-specific primer-guided Polymerase chain reaction (PCR-SSP) and a sequence-specific oligonucleotide probe hybridization PCR (PCR-SSO), the Sanger method does not require electrophoresis, does not require fluorescent labeling of DNA fragments, prevents PCR contamination, and is currently recognized as the most accurate method for detecting single-gene mutation sites.
Compared with the prior art, the invention has the following beneficial effects:
the kit for detecting the drug-resistant gene locus of hepatitis B by the Sanger method provided by the invention has the advantages of accuracy, sensitivity, strong specificity, rapidness, small sample demand, pollution resistance and the like, realizes the rapid, simple, convenient, accurate, efficient, practical and economic detection of the drug-resistant gene locus of hepatitis B, can meet the requirements of clinical examination on actual work, and is beneficial to the individual use of the drug resistance of hepatitis B. When the kit is used for detection, the kit has the characteristics of simple and convenient operation, low detection cost, small required sample amount, rapidness, accuracy, high flux and the like, meets the detection requirement of large clinical samples, and plays a positive promoting role in clinical individualized treatment of the hepatitis B drug-resistant medicines.
Drawings
FIG. 1 is a diagram showing a wild type region at position 204 in example 2 of the present invention;
FIG. 2 is a diagram showing a 204-position mutation pattern in example 2 of the present invention;
FIG. 3 is a diagram showing a 204-position mutation pattern in example 2 of the present invention;
FIG. 4 is a diagram showing a 180-site mutation pattern in example 2 of the present invention;
FIG. 5 is a diagram showing a 180-site mutation pattern in example 2 of the present invention;
FIG. 6 is a diagram showing a wild type at position 202 in example 2 of the present invention;
FIG. 7 is a diagram showing a 202-site mutation pattern in example 2 of the present invention.
Detailed Description
The invention will be further described with reference to specific examples and figures, which are intended to be illustrative of the process of the invention and are not intended to limit the scope of the invention. The invention is not limited to the embodiments described herein.
The specific experimental conditions and methods not indicated in the following examples are generally in accordance with conventional conditions such as: joseph Sambrook, DavidW Russell, et al molecular cloning, A laboratory Manual (third edition), scientific Press, 1992.
Example 1 kit for detecting hepatitis B Virus drug resistance Gene mutation by Sanger method
The mutation site of HBV204 was found from the human HBV genomic sequence of Genotyping database (http:// iras. lib. whu. edu. cn:8080/rwt/401/https/P75YPLUPMNSGTLUPNSXT65UJNAYGP 55X/projects/Genotyping/format. cgi). Designing a specific PCR amplification primer in a conserved region: pre-amplification primer (HBV-WF): TGGTGGACTTCTCTCAATTTTCTAGG, post amplification primer (HBV-WR): AGGAGTTCCGCAGTATGGATCG and Sanger PCR amplification primers: sanger method PCR amplification inner primer (HBV-182 WF): ATGTGTCTGCGGCGTTTTATCA are provided. The length of the fragment to be amplified is 1028 bp. The primer powder is adopted as ddH2O5. mu.M primer solution was prepared for use.
The kit for detecting the drug-resistant gene mutation sites of the hepatitis B virus by the Sanger method comprises the following primers and reagents:
(1) common PCR amplification primers:
pre-amplification primer (HBV-WF): TGGTGGACTTCTCTCAATTTTCTAGG, respectively;
post amplification primer (HBV-WR): AGGAGTTCCGCAGTATGGATCG are provided.
(2) Sanger method PCR amplification primers:
sanger method PCR amplification inner primer (HBV-182 WF): ATGTGTCTGCGGCGTTTTATCA are provided.
(3) Other reagents Hidi, BigDye (sequencing reagent) and ddH in the kit2O, etc. are conventional reagents for general PCR and Sanger sequencing.
Example 2 method for detecting mutation site of drug-resistant gene of hepatitis B Virus by Sanger method
The kit for detecting the drug-resistant gene mutation site of the hepatitis B virus by adopting the Sanger method in the embodiment 1 comprises the following specific steps:
(1) human genome DNA extraction:
an automatic nucleic acid extractor is adopted to extract human whole genome DNA from 200 mu L of EDTA anticoagulated whole blood of a sample to be detected and 20 mu L of proteinase K, and finally, the concentration of the genome DNA is adjusted to be 10-100 ng/mu L.
(2) General PCR amplification system and procedure:
according to the following formula, a common PCR reaction system is prepared, and the total volume is 15 mu L. The method comprises the following specific steps:
TABLE 1 general PCR reaction composition System
Fully mixing the components, centrifuging for a short time after mixing to completely centrifuge the liquid on the tube wall to the tube bottom, and then subpackaging 15 mu L of amplification system into a PCR tube. And adding 5 mu L of the extracted DNA sample to be detected, the HBV negative quality control product, the HBV204 wild type positive quality control product, the HBV204 mutant type positive quality control product and the HBV204 mutant type positive quality control product into each PCR reaction tube. The total reaction system is 20mL per reaction tube. Tightly covering the tube cover, centrifuging at 8,000rpm for several seconds, placing the tube cover in a PCR reaction instrument, and performing common PCR amplification according to the following amplification program to obtain a common PCR amplification product, wherein the specific amplification program is as follows:
(3) purification of the general PCR amplification product:
after PCR amplification is finished, taking 5 mu LPCR product to carry out 1% -2% agar gel electrophoresis, observing whether purpose band amplification is carried out or not (the size of a target band is 1028bp), if an obvious single target band is observed, purifying the PCR product in time, carrying out electrophoresis identification on the purified product to determine the value (the concentration range of the PCR product is 10-50mg), and carrying out sequencing PCR or storing at-20 +/-5 ℃ for later use (the storage time is not more than 2 days)
(4) Enzymolysis and purification
1) mu.L of exonuclease I (Exou I) was added to 10. mu.L of the sample
2) Add 2. mu.L of shrimp small intestine alkaline phosphatase (SAP) per 10. mu.L of sample
3) Enzyme digestion is carried out for 15min at 37 ℃; inactivating enzyme at 85 deg.C for 15 min; can be directly carried out in a PCR instrument
(5) Sanger PCR amplification system and procedure:
according to the following formula, a Sanger PCR reaction system was prepared, and the total volume was 10. mu.L. The method comprises the following specific steps:
TABLE 2Sanger PCR reaction composition System
Placing the prepared system in the table 2 in a PCR reactor, and amplifying according to the following Sanger PCR amplification program to obtain Sanger PCR amplification products, wherein the specific amplification program is as follows:
(6) purification of Sanger PCR amplification products:
1) taking the PCR reaction tubes after the Sanger method PCR reaction is finished, and adding 2 mu L of 125mol/LEDTA into each PCR reaction tube to the bottom of the tube.
2) Then 50 mul of precooled 100% absolute ethyl alcohol is added, the tube cover is covered tightly, and the mixture is shaken for a short time.
3) Centrifuge at 12,000rpm for 20min at 4 ℃ and immediately carefully remove the supernatant.
4) Add 150. mu.L of pre-chilled 75% ethanol to each tube, centrifuge at 12,000rpm for 10min at 4 ℃ and carefully remove the supernatant immediately, and this step can be repeated once.
5) Standing at 70 deg.C for 5-10min (observing liquid at the bottom of the tube to volatilize 75% ethanol), sealing and keeping in dark at-20 + -5 deg.C for 5 days.
6) Adding 10 mu L of Hi-Di Formamide, dissolving DNA by short-time oscillation, and performing short-time centrifugation to completely centrifuge the liquid on the tube wall to the tube bottom
7) Preparation for sample loading electrophoresis
(7) Detecting the genotype of the purified Sanger PCR amplification product obtained in the step (6) by a gene analyzer:
(8) and (4) analyzing results:
1) and (5) running Sequence analysis software and adding a data file after running. Evaluating the kurtosis of each sample signal according to the Sequence;
2) pressing the Find shortcut finds the sequence "TGGCTTTCAG". If the sequence can not be found, the mutation of individual base of the sample sequence may occur, and the sequence can be corrected after manual search according to the position of the sequence.
3) Mutation analysis: the 5 th to 7 th bases from the found sequence are 204 sites, and the sequences of the three bases are analyzed: ATG is wild type, ATT is rtM204I, GTG is rtM 204V. The sequencing result is shown in the figures, and the results of the drug-resistant mutation sites of the common 6 types of hepatitis B treatment drugs are interpreted as follows:
TABLE 36 interpretation of drug-resistant mutation site results of hepatitis B therapeutic drugs
(9) The results were determined according to 2019EASL clinical practice guidelines: HBV genotype drug resistance and drug sensitivity, which are common in management of hepatitis B infection and '2019 infectious disease related individualized medical molecular detection technical guidelines':
TABLE 4 correlation of HBV genotype drug resistance and drug sensitivity
Note: lam, lamivudine; ldt. telbivudine; etv. entecavir; adv, adefovir dipivoxil; TDF/taf tenofovir disoproxil; s, sensitivity; I. is not sensitive; r. resistance (drug resistance).
Sequence listing
<110> Wuhan university
<120> kit for detecting hepatitis B virus drug-resistant gene mutation site by Sanger method and detection method
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
tggtggactt ctctcaattt tctagg 26
<210>2
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
aggagttccg cagtatggat cg 22
<210>3
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
atgtgtctgc ggcgttttat ca 22
Claims (2)
1. A reagent kit for detecting hepatitis B virus drug-resistant gene mutation sites by a Sanger method is characterized in that: the kit comprises the following primers and reagents:
(1) common PCR amplification primers:
HBV-WF：TGGTGGACTTCTCTCAATTTTCTAGG；
HBV-WR：AGGAGTTCCGCAGTATGGATCG；
(2) sanger method PCR amplification primers:
HBV-182WF：ATGTGTCTGCGGCGTTTTATCA；
(3) conventional reagents in the kit: HiDi, BigDye, ddH2O。
2. A method for detecting hepatitis B virus drug-resistant gene mutation sites by a Sanger method is characterized by comprising the following steps: the kit of claim 1 is used for detection, and comprises the following steps:
(1) extracting human genome DNA;
(2) general PCR amplification system and procedure:
(2.1) preparing a 20 mu L common PCR reaction system, which comprises the following components in percentage by weight:
(2.2) general PCR amplification procedure:
2min at 95 ℃; sequentially carrying out 35 cycles at 95 ℃ for 15s, 60 ℃ for 10s and 72 ℃ for 40 s; stretching at 72 ℃ for 5 min; preserving the heat at 4 ℃ to obtain a common PCR amplification product;
(3) and (3) purifying a common PCR amplification product:
adopting an enzymolysis purification method: adding 1 mu L of exonuclease I and 2 mu L of shrimp small intestine alkaline phosphatase into 10 mu L of the common PCR amplification product obtained in the step (2); then carrying out enzyme reaction at 37 ℃ for 15 min; then carrying out enzyme inactivation for 15min at 85 ℃ to obtain a purified common PCR amplification product; the purification steps are all completed in a PCR instrument;
(4) sanger PCR amplification system and procedure:
(4.1) preparing a 10 mu LSanger method PCR amplification system, which comprises the following components in percentage by weight:
(4.2) Sanger PCR amplification procedure:
1min at 96 ℃; sequentially carrying out 25 cycles at 96 ℃ for 10s, 50 ℃ for 5s and 60 ℃ for 4 min; preserving the temperature at 4 ℃ to obtain a Sanger PCR amplification product;
(5) and (3) purifying PCR amplification products by a Sanger method and analyzing results:
adopting an EDTA-ethanol gradient elution method: adding 2 mu L of EDTA and 50 mu L of absolute ethyl alcohol into the Sanger PCR amplification product obtained in the step (4), uniformly mixing, centrifuging at 4 ℃ of 12000rpm for 20min, throwing off the supernatant, leaving a precipitate, adding 150 mu L of 75% ethanol, uniformly mixing the precipitate, centrifuging at 4 ℃ of 12000rpm for 10min, throwing off the supernatant, placing in a metal bath for 5-10min, drying the sample, and finally adding 10 mu L of LHiDi to dissolve the sample to obtain a purified Sanger PCR amplification product; and detecting the mutation sites of the purified PCR amplification products by a gene analyzer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010102331.1A CN111172293A (en) | 2020-02-19 | 2020-02-19 | Kit for detecting hepatitis B virus drug-resistant gene mutation site by Sanger method and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010102331.1A CN111172293A (en) | 2020-02-19 | 2020-02-19 | Kit for detecting hepatitis B virus drug-resistant gene mutation site by Sanger method and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111172293A true CN111172293A (en) | 2020-05-19 |
Family
ID=70653094
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010102331.1A Pending CN111172293A (en) | 2020-02-19 | 2020-02-19 | Kit for detecting hepatitis B virus drug-resistant gene mutation site by Sanger method and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111172293A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112553313A (en) * | 2020-12-30 | 2021-03-26 | 武汉康圣达医学检验所有限公司 | Method for denaturing sequencing reaction product for Sanger method |
| CN116732243A (en) * | 2023-04-04 | 2023-09-12 | 赛立安生物技术(广州)有限公司 | Primer group, detection method and kit for detecting HBV pre-S/S region gene mutation |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6709812B1 (en) * | 1996-04-19 | 2004-03-23 | Innogenetics N.V. | Method for typing and detecting HBV |
| CN102230025A (en) * | 2011-06-08 | 2011-11-02 | 中国人民解放军第四军医大学 | Kit and method for detecting drug resistance mutation of hepatitis B virus genes |
| CN110257490A (en) * | 2019-07-05 | 2019-09-20 | 武汉大学 | The kit and its application method of Sanger method detection CNIs drug gene polymorphism |
-
2020
- 2020-02-19 CN CN202010102331.1A patent/CN111172293A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6709812B1 (en) * | 1996-04-19 | 2004-03-23 | Innogenetics N.V. | Method for typing and detecting HBV |
| CN102230025A (en) * | 2011-06-08 | 2011-11-02 | 中国人民解放军第四军医大学 | Kit and method for detecting drug resistance mutation of hepatitis B virus genes |
| CN110257490A (en) * | 2019-07-05 | 2019-09-20 | 武汉大学 | The kit and its application method of Sanger method detection CNIs drug gene polymorphism |
Non-Patent Citations (2)
| Title |
|---|
| NIDAA A. ABABNEH等: "Patterns of hepatitis B virus S gene escape mutants and reverse transcriptasemutations among genotype D isolates in Jordan", 《PEERJ》 * |
| 张惠琴等: "基因芯片法和测序法检测乙肝病毒基因分型的耐药突变比较", 《热带医学杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112553313A (en) * | 2020-12-30 | 2021-03-26 | 武汉康圣达医学检验所有限公司 | Method for denaturing sequencing reaction product for Sanger method |
| CN116732243A (en) * | 2023-04-04 | 2023-09-12 | 赛立安生物技术(广州)有限公司 | Primer group, detection method and kit for detecting HBV pre-S/S region gene mutation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mayerat et al. | Does hepatitis B virus (HBV) genotype influence the clinical outcome of HBV infection? | |
| King et al. | Genetic polymorphisms in interferon pathway and response to interferon treatment in hepatitis B patients: A pilot study | |
| Lee et al. | Durability of lamivudine-induced HBeAg seroconversion for chronic hepatitis B patients with acute exacerbation | |
| Fowler et al. | Integration of HBV-DNA may not be a prerequisite for the maintenance of the state of malignant transformation: An analysis of 110 liver biopsies | |
| CN111172293A (en) | Kit for detecting hepatitis B virus drug-resistant gene mutation site by Sanger method and detection method | |
| CN104450963A (en) | HBV DNA digital PCR quantitative detection kit and application thereof | |
| EP1507011A1 (en) | PCR primer set for detecting hepatitis B virus, method for detecting hepatitis b using the primer set, and hepatitis b virus detection kit including the primer set | |
| CN107022611B (en) | Method and special primer for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines | |
| CN115873993A (en) | Kit for detecting 9 genotypes of hepatitis B virus and application thereof | |
| CN111893173A (en) | Primer, method and kit for detecting PEAR1 SNP locus | |
| RU2640256C2 (en) | Means and methods of predicting response to treatment of hepatitis b | |
| CN112725535B (en) | Fluorescent quantitative PCR (polymerase chain reaction) kit for simultaneously detecting full-length and truncated HBV pgRNA (hepatitis B virus) and application thereof | |
| CN111635944A (en) | Specific primer, kit and PCR method for detecting liver cancer susceptibility locus rs73613962 | |
| CN114317832B (en) | Method for detecting HBV core protein allosteric modulator related drug resistance site | |
| CN109504763B (en) | Molecular marker for predicting efficacy of interferon-alpha for treating hepatitis B patients | |
| CN111961718B (en) | Clopidogrel medication gene detection kit and use method thereof | |
| CN110527721B (en) | Old tuberculosis marker and application thereof | |
| CN111944888B (en) | Application of IFITM3 SNP rs12252 genotype in predicting immune response intensity of testee | |
| US20160289778A1 (en) | Hcv genotyping algorithm | |
| CN116949223B (en) | Hepatitis B virus drug administration guidance system and application thereof | |
| CN107034312B (en) | Nucleotide composition, kit and application thereof | |
| US20140087388A1 (en) | Methods of Nucleic Acid Liquid-phase Extraction and Detection | |
| CN111979351A (en) | Hepatitis B virus nucleic acid quantitative detection method and kit | |
| CN102304589B (en) | Hepatitis B virus Adefovir dipivoxil drug-resistance nucleic acid quantitative detection reagent kit, detection method, primers and probes thereof | |
| Tanaka et al. | Prognostic indicators of breakthrough hepatitis during lamivudine monotherapy for chronic hepatitis B virus infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200519 |