CN111172181A - Gene for coding suberect spatholobus stem leucocyanidin reductase and application thereof - Google Patents

Abstract

The invention discloses a gene for coding spatholobus stem leucocyanidin reductase and application thereof, and fills the blank of separating and cloning leucocyanidin reductase gene in the traditional Chinese medicinal material of spatholobus stem in China. The leucocyanidin reductase gene provided by the invention has a nucleotide sequence shown in SEQ ID NO.1 or a homologous sequence with one or more nucleotides added, substituted, inserted or deleted or an allele thereof and a derived nucleotide sequence thereof. The protein coded by the gene has an amino acid sequence shown in SEQ ID NO.3 or a homologous sequence with one or more amino acids added, substituted, inserted or deleted. The gene is expressed in the root, stem, leaf, flower and fruit of spatholobus stem, and has high expression level in leaf and flower and low content in fruit. The colorless anthocyanin reductase provided by the invention is beneficial to improving the content of catechin in caulis spatholobi by utilizing a genetic engineering technology, and has good application prospect on the improvement of caulis spatholobi germplasm resources in future.

Description

Gene for coding suberect spatholobus stem leucocyanidin reductase and application thereof

Technical Field

The invention relates to the technical field of biology, relates to key enzymes in a biosynthesis pathway of active ingredient catechin of caulis spatholobi and coding genes thereof, and more particularly relates to a gene for coding colorless anthocyanin reductase of caulis spatholobi and application thereof.

Background

Caulis Spatholobi is derived from dried rattan of Spatholobus suberectus Dunn of Leguminosae (Leguminosae), is a common Chinese medicine, is bitter and sweet in taste, warm in nature, and enters liver and kidney meridians. Has effects of replenishing blood, promoting blood circulation, regulating menstruation, relieving pain, relaxing muscles and tendons, and activating collaterals. Can be used for treating menoxenia, dysmenorrhea, amenorrhea, rheumatalgia, numbness paralysis, and sallow complexion due to blood deficiency, and can be widely used in Chinese patent medicines for treating gynecological diseases and rheumatalgia. Research results show that the main active component of the suberect spatholobus stem is flavonoid, wherein catechin which is a flavonoid component with higher content plays a main role in promoting hematopoiesis and the like.

In the catechin synthesis pathway, leucocyanidin reductase (LAR) catalyzes the conversion of leucocyanidin into catechin.

However, the LAR gene of spatholobus stem has not been cloned at present, and the application of the LAR gene in improving the content of the phytocatechin has not been found.

Disclosure of Invention

It is an object of the present invention to address at least the above-mentioned deficiencies and to provide at least the advantages which will be described hereinafter.

The invention also aims to obtain the gDNA sequence, the cDNA sequence and the amino acid sequence of the gene of the spatholobus stem leucocyanidin reductase (SslAR for short) by gene cloning, thereby providing an important basis for improving the content of catechin in the effective part of the spatholobus stem by a biotechnology means.

To achieve these objects and other advantages in accordance with the present invention, there is provided gDNA encoding spatholobus stem leucocyanidin reductase in which is one of the following nucleotide sequences:

1) has a sequence shown as SEQ ID No. 1;

2) a nucleotide sequence which can code a protein which is added with, substituted with, inserted into or deleted from one or more amino acids in SEQ ID No.1 and has the activity of the leucocyanidin reductase of suberect spatholobus stem.

cDNA for coding suberect spatholobus stem leucocyanidin reductase, wherein the cDNA is one of the following nucleotide sequences:

1) has a sequence shown as SEQ ID No. 2;

2) DNA molecules which hybridize under stringent conditions with the cDNA sequence of SEQ ID No.2 and which encode a protein having the enzyme leucocyanidin reductase activity of suberect spatholobus stems;

3) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 3;

4) a nucleotide sequence which codes for a protein which is added with, substituted with, inserted with or deleted from one or more amino acids in SEQ ID No.3 and has the activity of the colorless anthocyanin reductase of suberect spatholobus stem.

The protein with the activity of the suberect spatholobus stem leucocyanidin reductase is one of the following amino acid sequences:

1) has an amino acid sequence shown as SEQ ID No. 3;

2) an amino acid sequence of SEQ ID No.3 with addition, substitution, insertion or deletion of one or more amino acids and having the activity of suberect spatholobus stem leucocyanidin reductase.

A primer for amplifying gDNA, wherein the sequence of the primer is shown as SEQ ID No.4 and SEQ ID No. 5.

A primer for amplifying cDNA, wherein the sequence of the primer is shown as SEQ ID No.6 and SEQ ID No. 7.

Application of gDNA or cDNA or protein or primer in increasing content of catechin in plant.

In particular to application of the method, which can greatly improve the content of catechin in leaves and flower parts of plants.

Recombinant vectors, such as prokaryotic vectors, eukaryotic vectors, and RNAi vectors, comprising the entire sequence or a partial sequence of the SslAR gene of the invention are within the scope of the invention.

Host cells comprising the entire sequence or a portion of the sequence of the SslAR gene of the invention, such as host cells comprising the recombinant vectors described above, are also within the scope of the invention.

The invention at least comprises the following beneficial effects:

the invention provides a spatholobus stem leucocyanidin reductase (SsLAR) protein and a gDNA sequence, a cDNA sequence and an amino acid sequence of a coding gene thereof aiming at the blank of the research aspect of the biosynthesis of the catechins of the spatholobus stem, and when the gDNA sequence, the cDNA sequence and the amino acid sequence are transformed into a plant through a plant expression vector, the content of the catechins in the obtained transgenic plant can be effectively improved, and meanwhile, the gene expression analysis of different tissue parts provides an important theoretical basis for improving the content of the catechins in the effective parts of the spatholobus stem by using a biotechnology means in the future, and the spatholobus stem leucocyanidin reductase.

Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention.

Drawings

FIG. 1 is a phylogenetic tree (NJ method) constructed by SslAR of the present invention and LAR genes of soybean, pigeon pea, Lotus japonicus, wild soybean, trefoil Meyer sedge, lupin, peanut;

FIG. 2 is a graph of the expression levels of SslAR according to the invention in different tissues and organs.

Detailed Description

The present invention is further described in detail below with reference to examples so that those skilled in the art can practice the invention with reference to the description.

Example 1

Sslar gene cloning

(1) Extraction of RNA and DNA: total RNA was extracted from fresh young leaves of spatholobus suberectus with Trizol reagent (Invitrogen, USA) and pre-treated with RNase Free DNase (Promega, USA) to eliminate genomic DNA contamination. RNA integrity was analyzed on a 1.5% agarose gel and RNA purity and concentration determined spectrophotometrically.

Total DNA was extracted from fresh young leaves of spatholobus stem using a plant DNA kit (TIANGEN).

Cloning genes: designing a Primer according to an LAR sequence in the genome of the suberect spatholobus stem, using DNA as a template, and designing a gene specific Primer by using Primer 5.0 software:

F1:CCCGTCCCTCATACCTACTCGC(SEQ ID NO：4)

R1:AAGACATTCTCCTGCAACAC(SEQ ID NO：5)

by PCR amplification, a gDNA sequence of 2025bp in length was obtained, as shown in SEQ ID NO: 1.

example 2

Sslar gene cloning

The RNA extracted in example 1 was subjected to reverse transcription (AMV first strand cDNA synthesis kit: Roche, Switzerland) using the first strand cDNA as a template and primers:

F1:ATGGTGACCGTGGAGGAAATCCG(SEQ ID NO：6)

R1:CCTTGGACCTCTTCCTCACC(SEQ ID NO：7)

and obtaining a cDNA sequence SEQ ID NO with the length of 1063bp through PCR amplification: 2.

example 3

The cDNA sequence according to example 2 was obtained after translation to encode an amino acid sequence having spatholobus stem leucocyanidin reductase (SsLAR) SEQ ID NO: 3.

example 4

Bioinformatic analysis of SslAR genes

Homology search is carried out on the open reading frame sequence of SsLAR and the amino acid sequence of the protein coded by the SsLAR at NCBI, and the gene has higher homology with other species, wherein the homology with the LAR gene of pigeon pea (Cajanus cajan) is the highest (shown in figure 1).

Example 5

Differential expression of SslAR genes in different tissues

(1) Preparing materials: collecting fresh caulis Spatholobi root, stem, leaf, flower, and fruit, wrapping with self-sealing bag, quick freezing with liquid nitrogen, and storing in a refrigerator at-80 deg.C.

(2) Total RNA was extracted from the roots, stems, leaves, flowers and fruits of spatholobus suberect spatholobus stem using Trizol reagent (Invitrogen, USA), and pre-treated with RNase Free DNase (Promega, USA) to eliminate genomic DNA contamination. RNA integrity was analyzed on a 1.5% agarose gel and RNA content was determined spectrophotometrically.

(3) Preparation of cDNA: cDNA was synthesized using AMV first strand cDNA Synthesis kit (Roche, Switzerland). .

(4) Designing a primer: 18S was chosen as the endogenous reference gene, and specific primers for qRT-PCR were designed using Primer 5.0 software:

LAR-F：ACCGAAGTCAAAGATCACGC(SEQ ID NO：8)

LAR-R：TCCTCGACCTGGTCCAGAAT(SEQ ID NO：9)

18S-F：CGTTCCCGCCAATATCTCAC(SEQ ID NO：10)

18S-R：TGTTCAATACCAGCCGCACC(SEQ ID NO：11)。

(5) qRT-PCR: the polymerase chain reaction was performed in a StepOnereal-time PCR system (ABI, USA) according to the instructions of SYBR Green Fast qPCR Master Mix (BBI, Canada), and the melting curve method was used to analyze the specific amplification of the target gene.

(6) By using 2^-ΔΔCTThe method calculates the expression level of the SsLAR gene in different tissues. The results showed that the SslAR gene was expressed in all roots, stems, leaves, flowers, and fruits, with the highest expression in leaves and the lowest expression in fruits (as shown in FIG. 2).

Example 6

Sslar gene function research and application

(1) Construction of plant expression vectors

Using caulis spatholobi cDNA as a template, and using primers SEQ ID NO: 6 and SEQ ID NO: 7 PCR amplification was performed, and the amplified product was digested with Bg1II and BstEII at 37 ℃ for 2 hours, and the digested product was purified using a recovery kit (Takara, China).

Meanwhile, the pCAMBIA1301 vector was digested with Bg1II and BstEII at 37 ℃ for 2h, and the digested product was purified using a recovery kit (Takara, China).

mixing the two recovered fragments, reacting for 12h at 16 ℃ under the action of DNA ligase, converting the ligation product into DH5 alpha competence, selecting a positive monoclonal to culture in an LB culture medium, performing shake culture for 8h at 37 ℃, taking 1 mu L of bacterial liquid to perform PCR identification, performing propagation on a strain containing the two fragments, and extracting a plasmid to obtain a constructed plant expression vector named as 131-35 s-YFP.

(2) Transformation into Nicotiana benthamiana

Cutting the Nicotiana benthamiana leaves into small blocks of about 1 x 1cm, placing the leaf blocks on an MS pre-culture medium with the front surfaces facing downwards, placing the leaf blocks into an agrobacterium suspension containing an expression vector after pre-culture for 2d, soaking for 5-10 min, sucking excess bacteria liquid with sterile paper, inoculating the leaf blocks to an MS solid culture medium with the front surfaces facing downwards, and performing dark culture for 2 d.

Transferring the co-cultured tobacco leaf blocks to MS screening culture medium, and replacing the culture medium every 15 days until green buds are generated. When the bud grows to about 2cm, the bud is transferred to an MS rooting culture medium for rooting induction. When the seedlings grow to 5-7 cm, hardening the seedlings and unearthing, extracting DNA of leaves for PCR identification, and screening positive plants to obtain the transgenic tobacco.

(3) Transgenic tobacco metabolite analysis

And measuring the content of catechin in the transgenic tobacco leaves by using an UPLC-ESI-MS/MS method. The result shows that the catechin content in the transgenic tobacco is 2.3 times of that of the non-transgenic tobacco, so that the gene can obtain obvious effect of improving the catechin content in plants.

The enzyme leuco anthocyanidin reductase acts as the last rate-limiting enzyme catalyzing the conversion of leuco anthocyanins to catechins. Its expression activity directly affects the synthesis of catechins. The gDNA sequence, the cDNA sequence and the amino acid sequence of the SsLAR gene are obtained by gene cloning, and an important basis is provided for improving the content of catechin of the effective part of the suberect spatholobus stem by a biotechnology means.

While embodiments of the invention have been disclosed above, it is not intended to be limited to the uses set forth in the specification and examples. It can be applied to all kinds of fields suitable for the present invention. Additional modifications will readily occur to those skilled in the art.

<110> Guangxi Zhuang autonomous region medicinal plant garden

<120> gene encoding spatholobus stem leucocyanidin reductase and application thereof

<160>11

<170>PatentIn version 3.3

<210>1

<211>2490

<212>DNA

<213> caulis Spatholobi (Spatholus subelectus Dunn)

<400>1

tatgtagttg agtgcgtgtt tggattcaca ttgattcatc tagaatcacg ttaaaatatc 60

agctaacgtg attttaagtt aatatttata tgtttgattt tatgataaag aattgatttt 120

gagtctagaa ttgattttga gctgaaataa ttttagataa cttctacgtt gaatttatac 180

taacttttat tactatcttg cttttagaat gaaaacatct aaacataaat cacattattt 240

taaaattaat tttaaccaaa attaattttg tataaccaat tttatttaaa atcaatttta 300

taaatactca cccaaatgca ctgaaatgtt acagaggttt ctgccatcag agtttgggca 360

cgatgtggac agggcagccc ctgtagagcc gggactcaga atgtacgaag agaagcgttc 420

aattaggcgt ctgactgagc aatatggggt tccttacacc aacatctgct gcaactccgt 480

tgcttcttgg ccttattatg acaattgtca tcccaccaag gtccccccac ctttggatcg 540

gtttcaaata tatggtgatg gcaacgtcaa aggtatgtat aagagtgtat atagttagaa 600

tgattttttt atacgagatt aagaatagta aatttatgtc acataactat gtatgaatga 660

tcaagattta aagttatata tgattactta aagaataagg tgacttgtaa aaaaattcac 720

atgacttata tattttgatt ttgactattc acaataaaat ttaataatta atatttattt 780

ttttattttt acataaaaaa ttcattagat attctctctc tctctctcgt tatatatata 840

tatgtaggaa acatatatag tgaaagaatc atctttatat gagatataaa tgtaagaaga 900

gtaaatctga gacgtacaat tatagatgga tagtcatgat ttaaagttat ataaccactt 960

aaaaagtcat ataacttttt aaaaaactcg catgacttta tatgttttaa tcttgactat 1020

tcatgacaag atctaatagt taatattcat ttttctcact ttcatataag gccttctcat 1080

ttgatacgtc ccatatatat atatatattc cagatatttt tattttggtt tctttttttt 1140

ttaggactat gttaaaaaat ttaaactttt tagaatatca tttaagctgt gtttggactg 1200

gggatagaac atgaagtgga aaggtatgaa gtggatgaag aaattatagc attggttgat 1260

tacggctaat tttgtgttgc gtttaattat gttaaaatta aatagaaaat tataagagaa 1320

aagatcgcag acgaaatgtc ctattatcgg aaccaattat cgttgaaaac ctgattgtga 1380

atagtttctt gtatgtgcag cttactttgt tgatggcaat gatattggaa agttcacaat 1440

gaaggccatt gatgatatca gaacactgaa caaaaatgtt cattttcgac cctcgggcaa 1500

ctgttattcc atcaacgacc ttgcttcttt atgggaaaag aaaattggtc gtacgattcc 1560

cagagtcacc gtaacagagg atgatcttct tgctaaagct gcaggttcga tcacatccct 1620

tcctactatt tttttttatc aagagtagtt tgattataca atacaagaaa tacgccacat 1680

acttaagaaa acattaatca ttggtattat ttctgttagt gtaactttta tctaatgtaa 1740

aaaagataaa aatatagata ttatcagtct atcctaatag catgatgtac ctctggtata 1800

tactaatgtt tacgaacaaa attgctcata atttgaaaat taatatacca acgaagctaa 1860

tattttctat caattttttt ttaaaggatg ttttatggtt tatgtattaa agtaataata 1920

tttttgatgt gtgcatctgc agaaaattgt atacctcaaa gtgttgtagc atccttcact 1980

catgatattt tcttcaaggg ttgccaagtt aacttcagca cagatggacc taatgatatt 2040

gagattaaca ttctctatcc agatgaaaaa ttccgatgca tggaggattg ttacgaggac 2100

tttgttccca tgatccatga caagattcat ggaggaacaa gtgaagagat taaggactta 2160

aagcctttgg tagagacagg accaaatgaa gaaattaagg acttaaagcc tttggtagag 2220

gcagtgccaa taacagctat gggctagttg aaaaagaacc accttaatat tttctgtgct 2280

cactgttcac gaactttggt gggggcagaa attcattaga ttcgtgaata attaatgaat 2340

tttatgcata aggagttgtg gaggatcagc ccgtttactt atgtattcag gtcaagctgt 2400

ttcatttcat ccaaataatt agttggattt taaaagcttg ttataaaagc tttcatggct 2460

ataataaatt cttatcactt ggtgctactc 2490

<210>2

<211>841

<212>DNA

<213> caulis Spatholobi (Spatholus subelectus Dunn)

<400>2

actctacctt cttgctcctc aggccagggc ctgtctctcc ttccaaggca ccaattgtca 60

aaacctttca agagaaaggt gctaaggtta tccatggtgc gatacgtgac aaggaattga 120

tggagaagat tttgaaggag tgtgagatag acgtcgtcat ttctcttgta ggaggcgaac 180

aagtgatgga tcaggttatg ttggtggagg ccataaaatc tgtgaagact gtcaagaggt 240

ttctgccatc agagtttggg cacgatgtgg acagggcagc ccctgtagag ccgggactca 300

gaatgtacga agagaagcgt tcaattaggc gtctgactga gcaatatggg gttccttaca 360

ccaacatctg ctgcaactcc gttgcttctt ggccttatta tgacaattgt catcccacca 420

aggtcccccc acctttggat cggtttcaaa tatatggtga tggcaacgtc aaagcttact 480

ttgttgatgg caatgatatt ggaaagttca caatgaaggc cattgatgat atcagaacac 540

tgaacaaaaa tgttcatttt cgaccctcgg gcaactgtta ttccatcaac gaccttgctt 600

ctttatggga aaagaaaatt ggtcgtacga ttcccagagt caccgtaaca gaggatgatc 660

ttcttgctaa agctgcagaa aattgtatac ctcaaagtgt tgtagcatcc ttcactcatg 720

atattttctt caagggttgc caagttaact tcagcacaga tggacctaat gatattgaga 780

ttaacattct ctatccagat gaaaaattcc gatgcatgga ggattgttac gaggactttg 840

t 841

<210>3

<211>841

<212>PRT

<213> caulis Spatholobi (Spatholus subelectus Dunn)

<400>3

Ala Cys Thr Cys Thr Ala Cys Cys Thr Thr Cys Thr Thr Gly Cys Thr

1 5 10 15

Cys Cys Thr Cys Ala Gly Gly Cys Cys Ala Gly Gly Gly Cys Cys Thr

20 25 30

Gly Thr Cys Thr Cys Thr Cys Cys Thr Thr Cys Cys Ala Ala Gly Gly

35 40 45

Cys Ala Cys Cys Ala Ala Thr Thr Gly Thr Cys Ala Ala Ala Ala Cys

50 55 60

Cys Thr Thr Thr Cys Ala Ala Gly Ala Gly Ala Ala Ala Gly Gly Thr

65 70 75 80

Gly Cys Thr Ala Ala Gly Gly Thr Thr Ala Thr Cys Cys Ala Thr Gly

85 90 95

Gly Thr Gly Cys Gly Ala Thr Ala Cys Gly Thr Gly Ala Cys Ala Ala

100 105 110

Gly Gly Ala Ala Thr Thr Gly Ala Thr Gly Gly Ala Gly Ala Ala Gly

115 120 125

Ala Thr Thr Thr Thr Gly Ala Ala Gly Gly Ala Gly Thr Gly Thr Gly

130 135 140

Ala Gly Ala Thr Ala Gly Ala Cys Gly Thr Cys Gly Thr Cys Ala Thr

145 150 155 160

Thr Thr Cys Thr Cys Thr Thr Gly Thr Ala Gly Gly Ala Gly Gly Cys

165 170 175

Gly Ala Ala Cys Ala Ala Gly Thr Gly Ala Thr Gly Gly Ala Thr Cys

180 185 190

Ala Gly Gly Thr Thr Ala Thr Gly Thr Thr Gly Gly Thr Gly Gly Ala

195 200 205

Gly Gly Cys Cys Ala Thr Ala Ala Ala Ala Thr Cys Thr Gly Thr Gly

210 215 220

Ala Ala Gly Ala Cys Thr Gly Thr Cys Ala Ala Gly Ala Gly Gly Thr

225 230 235 240

Thr Thr Cys Thr Gly Cys Cys Ala Thr Cys Ala Gly Ala Gly Thr Thr

245 250 255

Thr Gly Gly Gly Cys Ala Cys Gly Ala Thr Gly Thr Gly Gly Ala Cys

260 265 270

Ala Gly Gly Gly Cys Ala Gly Cys Cys Cys Cys Thr Gly Thr Ala Gly

275 280 285

Ala Gly Cys Cys Gly Gly Gly Ala Cys Thr Cys Ala Gly Ala Ala Thr

290 295 300

Gly Thr Ala Cys Gly Ala Ala Gly Ala Gly Ala Ala Gly Cys Gly Thr

305 310 315 320

Thr Cys Ala Ala Thr Thr Ala Gly Gly Cys Gly Thr Cys Thr Gly Ala

325 330 335

Cys Thr Gly Ala Gly Cys Ala Ala Thr Ala Thr Gly Gly Gly Gly Thr

340 345 350

Thr Cys Cys Thr Thr Ala Cys Ala Cys Cys Ala Ala Cys Ala Thr Cys

355 360 365

Thr Gly Cys Thr Gly Cys Ala Ala Cys Thr Cys Cys Gly Thr Thr Gly

370 375 380

Cys Thr Thr Cys Thr Thr Gly Gly Cys Cys Thr Thr Ala Thr Thr Ala

385 390 395 400

Thr Gly Ala Cys Ala Ala Thr Thr Gly Thr Cys Ala Thr Cys Cys Cys

405 410 415

Ala Cys Cys Ala Ala Gly Gly Thr Cys Cys Cys Cys Cys Cys Ala Cys

420 425 430

Cys Thr Thr Thr Gly Gly Ala Thr Cys Gly Gly Thr Thr Thr Cys Ala

435 440 445

Ala Ala Thr Ala Thr Ala Thr Gly Gly Thr Gly Ala Thr Gly Gly Cys

450 455 460

Ala Ala Cys Gly Thr Cys Ala Ala Ala Gly Cys Thr Thr Ala Cys Thr

465 470 475 480

Thr Thr Gly Thr Thr Gly Ala Thr Gly Gly Cys Ala Ala Thr Gly Ala

485 490 495

Thr Ala Thr Thr Gly Gly Ala Ala Ala Gly Thr Thr Cys Ala Cys Ala

500 505 510

Ala Thr Gly Ala Ala Gly Gly Cys Cys Ala Thr Thr Gly Ala Thr Gly

515 520 525

Ala Thr Ala Thr Cys Ala Gly Ala Ala Cys Ala Cys Thr Gly Ala Ala

530 535 540

Cys Ala Ala Ala Ala Ala Thr Gly Thr Thr Cys Ala Thr Thr Thr Thr

545 550 555 560

Cys Gly Ala Cys Cys Cys Thr Cys Gly Gly Gly Cys Ala Ala Cys Thr

565 570 575

Gly Thr Thr Ala Thr Thr Cys Cys Ala Thr Cys Ala Ala Cys Gly Ala

580 585 590

Cys Cys Thr Thr Gly Cys Thr Thr Cys Thr Thr Thr Ala Thr Gly Gly

595 600 605

Gly Ala Ala Ala Ala Gly Ala Ala Ala Ala Thr Thr Gly Gly Thr Cys

610 615 620

Gly Thr Ala Cys Gly Ala Thr Thr Cys Cys Cys Ala Gly Ala Gly Thr

625 630 635 640

Cys Ala Cys Cys Gly Thr Ala Ala Cys Ala Gly Ala Gly Gly Ala Thr

645 650 655

Gly Ala Thr Cys Thr Thr Cys Thr Thr Gly Cys Thr Ala Ala Ala Gly

660 665 670

Cys Thr Gly Cys Ala Gly Ala Ala Ala Ala Thr Thr Gly Thr Ala Thr

675 680 685

Ala Cys Cys Thr Cys Ala Ala Ala Gly Thr Gly Thr Thr Gly Thr Ala

690 695 700

Gly Cys Ala Thr Cys Cys Thr Thr Cys Ala Cys Thr Cys Ala Thr Gly

705 710 715 720

Ala Thr Ala Thr Thr Thr Thr Cys Thr Thr Cys Ala Ala Gly Gly Gly

725 730 735

Thr Thr Gly Cys Cys Ala Ala Gly Thr Thr Ala Ala Cys Thr Thr Cys

740 745 750

Ala Gly Cys Ala Cys Ala Gly Ala Thr Gly Gly Ala Cys Cys Thr Ala

755 760 765

Ala Thr Gly Ala Thr Ala Thr Thr Gly Ala Gly Ala Thr Thr Ala Ala

770 775 780

Cys Ala Thr Thr Cys Thr Cys Thr Ala Thr Cys Cys Ala Gly Ala Thr

785 790 795 800

Gly Ala Ala Ala Ala Ala Thr Thr Cys Cys Gly Ala Thr Gly Cys Ala

805 810 815

Thr Gly Gly Ala Gly Gly Ala Thr Thr Gly Thr Thr Ala Cys Gly Ala

820 825 830

Gly Gly Ala Cys Thr Thr Thr Gly Thr

835 840

<210>4

<211>22

<212>DNA

<213> caulis Spatholobi (Spatholus subelectus Dunn)

<400>4

tatgtagttg agtgcgtgtt tg 22

<210>5

<211>23

<212>DNA

<213> caulis Spatholobi (Spatholus subelectus Dunn)

<400>5

gagtagcacc aagtgataag aat 23

<210>6

<211>22

<212>DNA

<213> caulis Spatholobi (Spatholus subelectus Dunn)

<400>6

actctacctt cttgctcctc ag 22

<210>7

<211>22

<212>DNA

<213> caulis Spatholobi (Spatholus subelectus Dunn)

<400>7

acaaagtcct cgtaacaatc ct 22

<210>8

<211>20

<212>DNA

<213> caulis Spatholobi (Spatholus subelectus Dunn)

<400>8

taggcgtctg actgagcaat 20

<210>9

<211>20

<212>DNA

<213> caulis Spatholobi (Spatholus subelectus Dunn)

<400>9

gttacggtga ctctgggaat 20

<210>10

<211>20

<212>DNA

<213> caulis Spatholobi (Spatholus subelectus Dunn)

<400>10

cgttcccgcc aatatctcac 20

<210>11

<211>20

<212>DNA

<213> caulis Spatholobi (Spatholus subelectus Dunn)

<400>11

tgttcaatac cagccgcacc 20

Claims (6)

1. gDNA encoding a spatholobus stem leucocyanidin reductase characterised by one of the following nucleotide sequences:

1) has a sequence shown as SEQ ID No. 1;

2) a nucleotide sequence which can code a protein which is added with, substituted with, inserted into or deleted from one or more amino acids in SEQ ID No.1 and has the activity of the leucocyanidin reductase of suberect spatholobus stem.

2. The cDNA for coding the spatholobus stem leucocyanidin reductase is characterized by being one of the following nucleotide sequences:

1) has a sequence shown as SEQ ID No. 2;

2) DNA molecules which hybridize under stringent conditions with the cDNA sequence of SEQ ID No.2 and which encode a protein having the enzyme leucocyanidin reductase activity of suberect spatholobus stems;

3) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 3;

4) a nucleotide sequence which codes for a protein which is added with, substituted with, inserted with or deleted from one or more amino acids in SEQ ID No.3 and has the activity of the colorless anthocyanin reductase of suberect spatholobus stem.

3. The protein with the activity of the suberect spatholobus stem leucocyanidin reductase is characterized by being one of the following amino acid sequences:

1) has an amino acid sequence shown as SEQ ID No. 3;

2) an amino acid sequence of SEQ ID No.3 with addition, substitution, insertion or deletion of one or more amino acids and having the activity of suberect spatholobus stem leucocyanidin reductase.

4. A primer for amplifying gDNA of claim 1, wherein the sequence of said primer is as shown in SEQ ID No.4 and SEQ ID No. 5.

5. A primer for amplifying the cDNA of claim 2, wherein the sequence of the primer is shown as SEQ ID No.6 and SEQ ID No. 7.

6. Use of the gDNA of claim 1 or the cDNA of claim 2 or the protein of claim 3 or the primer of claim 4 or the primer of claim 5 as a means to increase the content of catechins in plants.

Images