CN111154864B - Methylation site combination of FOXO3 and TP53 and its application as a diagnostic marker for late-onset asthma - Google Patents

Abstract

The invention discloses the combination of methylation sites of FOXO3 and TP53 and its application as a diagnostic marker for late-onset asthma. The present invention discovers for the first time that the DNA methylation levels of FOXO3 and TP53 genes are related to asthma severity and late-onset asthma. The occurrence and development of asthma are related, which is of great significance for explaining the onset of delayed asthma; the invention provides a diagnostic product, which can realize the early non-invasive detection of delayed asthma by detecting the DNA methylation levels of FOXO3 and TP53 genes in peripheral blood. Diagnosis with a view to early treatment of late-onset asthma. The invention can be used for the assessment of the severity of clinical asthma patients and the early prediction of late-onset asthma by detecting the DNA methylation levels of FOXO3 and TP53 genes in peripheral blood. Compared with the existing detection methods, it has the advantages of less trauma, convenient detection, high sensitivity and high patient acceptance.

Description

Combination of methylation sites of FOXO3 and TP53 and their use as diagnostic markers for delayed asthma Application of Chronicles

technical field

The invention relates to an asthma diagnostic marker, in particular to a delayed asthma diagnostic marker. It belongs to the technical field of biological diagnosis.

Background technique

The Global Initiative for Asthma (GINA) clearly states that late-onset asthma is a subtype of asthma that does not develop persistent respiratory symptoms until adulthood. Compared with children with asthma, patients with late-onset asthma are often accompanied by rapid decline in lung function, poor response to standardized asthma treatment, poor prognosis and more likely to develop severe asthma. However, in the process of clinical diagnosis and treatment, delayed Paroxysmal asthma is often misdiagnosed or delayed in treatment. The research results of "China's Delayed Asthma Epidemic Situation, Risk Factors and Disease Management Status" show that there are about 45.7 million delayed asthma patients in China, of which nearly 70% are undiagnosed, and 95% have not been treated standardizedly, which has brought great harm to society and families. This has brought a huge burden of disease, which warns that my country urgently needs to strengthen the standardized diagnosis and treatment of delayed asthma. However, the pathogenesis of delayed asthma is still unclear, and early diagnosis is difficult. Once the diagnosis is confirmed, the effect of conventional treatment is usually not obvious. Therefore, it is of great significance to explore biomarkers for early risk screening and early clinical diagnosis of late-onset asthma through in-depth research on the pathogenesis and clinical characteristics of late-onset asthma.

A large number of clinical epidemiological data and research results have found that accelerated lung aging is an important risk factor and key pathological basis for late-onset asthma. With age, the decline of lung structure and function leads to increased susceptibility to lung diseases, more severe lung pathological phenotypes, and poor clinical prognosis. In patients with late-onset asthma, more pronounced senescence-associated molecular signals (such as telomere shortening, epigenetic alterations, ROS accumulation, and immunosenescence, etc.) were also observed, strongly suggesting abnormal expression and regulation of senescence-associated genes Involved in the occurrence and development of delayed asthma.

FOXO3 and TP53 are two classic genes regulating aging and lifespan, which have been confirmed to be related to the susceptibility to late-onset asthma, but the mechanism by which FOXO3 and TP53 are involved in the pathogenesis of late-onset asthma is still unclear. A series of recent lines of evidence suggests that epigenetic mechanisms may be the primary means by which age-related gene expression is regulated. DNA methylation is the earliest and most important modification method studied in epigenetic regulation. Studies have confirmed that DNA methylation can be used as a biomarker for early risk prediction of tumors, COPD and other diseases. In addition, the DNA methylation sequence exists in human serum in a highly stable form, which can resist the digestion of RNase and protease and various stress states of cells. It is a high-speed, sensitive and effective drug involved in various diseases. Biomarkers.

In summary, with the aging of the global population, the morbidity and mortality of late-onset asthma are increasing year by year, but there is no effective clinical risk prediction marker. Since serum is relatively easy to obtain, DNA methylation biomarkers of FOXO3 and TP53 in circulating serum are expected to be used as non-invasive risk markers for early diagnosis of late-onset asthma.

Contents of the invention

The purpose of the present invention is to overcome the shortcomings of the above-mentioned prior art, and provide a combination of methylation sites of FOXO3 and TP53 and its application as a diagnostic marker for delayed asthma.

To achieve the above object, the present invention adopts the following technical solutions:

1. The combination of methylation sites of FOXO3 and TP53, the site combination includes: site chr6: 108882977 of the FOXO3 gene and chr17: 7591672 of the TP53 gene.

2. The application of the combination of methylation sites of FOXO3 and TP53 as a diagnostic marker for delayed asthma.

Preferably, the diagnosis of delayed asthma includes: early risk screening and clinical early diagnosis.

3. The application of the combination of methylation sites of FOXO3 and TP53 mentioned above in the preparation of delayed asthma diagnosis products.

Preferably, the product is selected from any one of formulations, chips or kits.

Preferably, the diagnosis of delayed asthma includes: early risk screening and clinical early diagnosis.

4. A diagnostic marker for delayed asthma, which is a combination of the methylation sites of FOXO3 and TP53.

5. A late-onset asthma diagnosis product, comprising: a primer set for amplifying the combination of methylation sites of FOXO3 and TP53.

Preferably, the primer set comprises:

chr6: 108882977 upstream primer: 5'-TGTTGTTAGTTCTGGGGTGGGTA-3', as shown in SEQ ID NO.13;

Chr6: 108882977 downstream primer: 5'-CTACTACAACCTCAACAACCAGCTACCA-3', as shown in SEQ ID NO.14;

chr17: 7591672 upstream primer: 5'-AGGTAGAAAGATTTTCTGGGAGGAG-3', as shown in SEQ ID NO.15;

chr17: 7591672 downstream primer: 5'-ACAACCACAGAAAAACCCTAAAAC-3', as shown in SEQ ID NO.16.

6. A diagnostic kit for late-onset asthma, comprising: a primer set for amplifying the above combination of methylation sites of FOXO3 and TP53.

Preferably, the primer set comprises:

chr6: 108882977 upstream primer: 5'-TGTTGTTAGTTCTGGGGTGGGTA-3', as shown in SEQ ID NO.15 chr6: 108882977 upstream primer: 5'-TGTTGTTAGTTCTGGGGTGGGTA-3', as shown in SEQ ID NO.13;

Chr6: 108882977 downstream primer: 5'-CTACTACAACCTCAACAACCAGCTACCA-3', as shown in SEQ ID NO.14;

chr17: 7591672 upstream primer: 5'-AGGTAGAAAGATTTTCTGGGAGGAG-3', as shown in SEQ ID NO.15;

chr17: 7591672 downstream primer: 5'-ACAACCACAGAAAAACCCTAAAAC-3', as shown in SEQ ID NO.16.

Preferably, the kit also contains a Taq enzyme polymerase chain reaction system, specifically comprising: Taq enzyme, PCR buffer, dNTPs, ddH ₂ O.

7. A primer set for amplifying the combination of methylation sites of the above-mentioned FOXO3 and TP53, comprising:

chr6: 108882977 upstream primer: 5'-TGTTGTTAGTTCTGGGGTGGGTA-3', as shown in SEQ ID NO.13;

Chr6: 108882977 downstream primer: 5'-CTACTACAACCTCAACAACCAGCTACCA-3', as shown in SEQ ID NO.14;

chr17: 7591672 upstream primer: 5'-AGGTAGAAAGATTTTCTGGGAGGAG-3', as shown in SEQ ID NO.15;

chr17: 7591672 downstream primer: 5'-ACAACCACAGAAAAACCCTAAAAC-3', as shown in SEQ ID NO.16.

Beneficial effects of the present invention:

In order to obtain a non-invasive peripheral blood biomarker of late-onset asthma for early prediction of the risk of late-onset asthma (LOA), the applicant first assessed the late-onset asthma patients and healthy The expression levels of FOXO3 and TP53 and their DNA methylation levels in the peripheral blood of the control population, the results showed that the expression and methylation levels of FOXO3 and TP53 in the peripheral blood of patients with delayed asthma changed significantly, and further screened out the patients with delayed asthma Eight CpG sites differentially expressed in asthmatic patients. The correlation analysis of the methylation levels of the 8 differential CpG sites and the pulmonary function indicators of asthmatic patients showed that: FOXO3 and TP53 each have a differential CpG site (FOXO3: chr6: 108882977; TP53: chr17: 7591672) Methylation levels are associated with severity of late-onset asthma. ROC analysis and PCA analysis confirmed that the methylation levels of these two differential CpG sites can effectively distinguish patients with delayed asthma from healthy controls, and provide the possibility for early diagnosis of delayed asthma. details as follows:

1. The present invention discovered for the first time that the DNA methylation levels of FOXO3 and TP53 genes are related to the severity of asthma and the occurrence and development of delayed asthma, which is of great significance for explaining the onset of delayed asthma;

2. The present invention provides a diagnostic product. According to the experimental data of the present invention, the methylation levels of chr6: 108882977 (FOXO3) and chr17: 7591672 (TP53) in peripheral blood can be used as biomarkers for the preparation of delayed An early diagnosis kit for chronic asthma, by detecting the DNA methylation levels of FOXO3 and TP53 genes in peripheral blood, it can realize the early non-invasive diagnosis of late-onset asthma, so as to realize the early treatment of late-onset asthma.

3. The present invention provides the application of the product for detecting DNA methylation levels of FOXO3 and TP53 genes in the preparation of products for diagnosing delayed asthma. The product includes any gene expression detection product known in the art such as preparation, chip or kit.

4. The existing clinical diagnosis of delayed asthma relies on clinical manifestations, pulmonary function tests or peak flow measurement. Due to the significant heterogeneity of clinical manifestations of late-onset asthma, traditional diagnostic methods cannot diagnose the susceptibility and severity of late-onset asthma early and clearly. The invention is used for evaluating the severity of clinical asthma patients and early prediction of late-onset asthma by detecting the FOXO3 and TP53 gene DNA methylation levels in peripheral blood. Compared with the existing detection methods, it has the advantages of less trauma, convenient detection, high sensitivity and high patient acceptance.

5. The changes of DNA methylation levels of FOXO3 and TP53 genes were not only reflected in peripheral blood of asthmatic patients, but also in induced sputum cells of asthmatic patients. Therefore, in addition to peripheral blood, changes in DNA methylation levels of FOXO3 and TP53 genes can be detected in induced sputum cells, bronchoalveolar lavage fluid, blood, serum, plasma, or tissue biopsies (such as lung samples).

6. The changes in the DNA methylation levels of FOXO3 and TP53 genes can be detected not only by next-generation sequencing, but also by any method known in the art such as BSP and MSP.

Description of drawings

Figure 1 is the gene expression of FOXO3 and TP53 genes in the healthy control group and the experimental group, wherein, A is the expression level of FOXO3 in peripheral blood, and B is the expression level of TP53 in peripheral blood;

Figure 2 is the correlation analysis between the methylation level of chr6: 108882977 and chr17: 7591672 and lung function, in which, A is the correlation analysis between the methylation level of chr6: 108882977 (FOXO3) and FEV1%, and B is chr6: 108882977 Correlation analysis between (FOXO3) methylation level and PEF, C is the correlation analysis between chr17:7591672(TP53) methylation level and FEV1, D is the correlation analysis between chr17:7591672(TP53) methylation level and FVC Analysis, E is the correlation analysis between chr17: 7591672 (TP53) methylation level and PEF, F is the correlation analysis between chr17: 7591672 (TP53) methylation level and FEF25;

Figure 3 shows the diagnostic accuracy of the methylation levels of chr6: 108882977 and chr17: 7591672 to distinguish between LOA population and healthy population, where A is the ROC of chr6: 108882977 (FOXO3) methylation level combined with age to distinguish LOA population from healthy population Curve, B is the ROC curve of chr17: 7591672 (TP53) combined with age to distinguish LOA population and healthy population, C is the ROC curve of chr6: 108882977 (FOXO3), chr17: 7591672 (TP53) combined with age to distinguish LOA population and healthy population, D PCA cluster analysis for chr6: 108882977 (FOXO3), chr17: 7591672 (TP53) combined with age to distinguish the LOA population from the healthy population.

Detailed ways

The present invention will be further described below in conjunction with the accompanying drawings and embodiments. It should be noted that the following description is only for explaining the present invention and not limiting its content.

1. Collect peripheral blood from clinically diagnosed asthma patients and healthy control subjects

The subjects in the delayed asthma group were 43 people (age > 20 years old) who were diagnosed and met the diagnostic and exclusion criteria of Xiangya Hospital of Central South University. people (age >20 years). All subjects were informed of the purpose of enrollment, and all signed the informed consent, and no significant difference was found in gender, age, and height between the two groups. The cases were collected from October 2018 to January 2019.

Diagnostic criteria for bronchial asthma:

The definition, diagnosis, treatment and management of bronchial asthma in the guidelines for the prevention and treatment of bronchial asthma are as follows:

(1) Recurrent episodes of wheezing, shortness of breath, chest tightness, or coughing are mostly related to exposure to allergens, cold air, physical and chemical stimuli, viral upper respiratory tract infections, and exercise.

(2) Scattered or diffuse wheezing, mainly in the expiratory phase, can be heard in both lungs during the attack, and the expiratory phase is prolonged.

(3) The above symptoms can be relieved by treatment or relieved by themselves.

(4) Excluding wheezing, shortness of breath, chest tightness or cough caused by other diseases.

(5) Those with atypical clinical symptoms (such as no obvious wheezing or signs) should have at least one of the following positive tests:

a. Positive bronchial provocation test or exercise test;

b. Positive bronchodilation test (FEV1 increased by more than 15%, and the absolute value of FEV1 increased by >200ml);

c. PEF intraday variation rate or diurnal fluctuation rate ≥ 20%.

Those who meet the above 1 to 4 or 4 or 5 can be diagnosed as asthma.

According to the severity of asthma, asthma is divided into mild asthma, moderate asthma and severe asthma. For specific clinical standards, refer to "2019 Global Asthma Management and Prevention Strategy" (www.ginasthma.org.)

2. Determination of the expression levels of FOXO3 and TP53 in the peripheral blood of LOA patients and healthy control test subjects

(1) Collect 2ml of peripheral blood from LOA patients and healthy controls, 1ml of peripheral blood is used for RNA extraction, and 1ml of peripheral blood is used for DNA extraction;

(2) Extract RNA, the specific steps are as follows:

Take 1ml of peripheral blood and use the erythrocyte lysate to lyse the red blood cells in the peripheral blood. After centrifugation, suck out the upper liquid completely, and the lower layer is the white blood cell precipitate. Add 1ml Trizol and mix well, then transfer to a 1.5ml centrifuge tube. After standing at room temperature for 5 minutes, add 0.2 ml chloroform, shake vigorously for 15 seconds, and place at room temperature for 3 minutes. Centrifuge at 12000g for 15min at 4°C.

a. Take the upper aqueous phase, add 0.5ml of isopropanol, shake gently for 5 seconds, and place at room temperature for 10 minutes. Centrifuge at 12000g for 15min at 4°C.

b. Wash twice with 75% ethanol water solution by volume, and place at room temperature until dry. The RNA was dissolved in 50 μl nuclease-free water, and the concentration of RNA was measured with a UV spectrophotometer.

(3) RNA quality detection

a. The concentration and total amount of RNA: Qubit accurately quantifies the concentration;

b. RNA purity: the ratio of OD260/280 and 260/230 detected by Nanodrop;

c. RNA integrity: agarose gel electrophoresis and Agilent 2100Bioanalyzer to detect the degree of degradation of RNA;

The total amount of RNA sample was between 1-4 μg, and the 260/280 ratio was between 1.8-2.0.

(4) Reverse transcription: use the reverse transcription kit of Sigma Company to operate, the specific steps are as follows: take 1 μg RNA, calculate the RNA volume that needs to be added according to the above-mentioned measured RNA concentration, apply random primers 1 μl Oligo primer and non-nuclear Prepare a 12 μl reaction system with enzyme water, and denature at 65°C for 5 minutes. Apply 4 μl 5×Reaction Buffer, 2 μl dNTP mixture (10 mM), 1 μl AMV reverse transcriptase and 1 μl RNase inhibitor to perform reverse transcription reaction at 25°C for 5 min, 42°C for 60 min, and 70°C for 5 min.

(5) Real-Time qPCR:

a. Primer design: QPCR amplification primers were designed according to the sequences of FOXO3 gene, TP53 gene and β-actin coding gene in Genebank, and were synthesized by Shanghai Biotechnology Service Co., Ltd. The specific primer sequences are as follows:

FOXO3 gene:

The forward primer is: 5'-CGG ACA AAC GGC TCA CTC T-3', as shown in SEQ ID NO.1;

The reverse primer is: 5'-GGA CCC GCA TGA ATC GAC TAT-3', as shown in SEQ ID NO.2;

TP53 gene:

The forward primer is: 5'-AAG TCT GTG ACT TGC ACG TAC TCC-3', as shown in SEQ ID NO.3;

The reverse primer is: 5'-GTC ATG TGC TGT GAC TGC TTG TAG-3', as shown in SEQ ID NO.4;

β-actin gene:

The forward primer is: 5'-TTC CAG CCT TCC TTC CTG GG-3', as shown in SEQ ID NO.5;

The reverse primer is: 5'-TTG CGC TCA GGA GGA GCA AT-3', as shown in SEQ ID NO.6;

b. Configure a 25 μl reaction system: SYBR green Mix 12.5 μl, deionized water 8.5 μl, forward (reverse) primer 1 μl, template 2 μl, mix well. Among them, SYBR green Mix was purchased from TAKARA Company.

c. PCR reaction conditions: 95°C for 30s, 95°C for 5s, 60°C for 30s, 40 cycles. Using SYBR Green as a fluorescent marker, the PCR reaction was carried out on a fluorescent quantitative PCR instrument, and the relative quantification was carried out by the ΔΔCT method.

3. Results

The results are shown in Figure 1. Compared with healthy controls, the expression of FOXO3 gene in the peripheral blood of patients with mild LOA was up-regulated, and the expression of FOXO3 gene was decreased in patients with severe LOA. The difference was statistically significant (P<0.05); compared with healthy controls, TP53 The gene expression was up-regulated in mild LOA patients and severe LOA patients, and the difference was statistically significant (P<0.05).

4. Determination of DNA methylation levels of FOXO3 and TP53 in peripheral blood of LOA patients and healthy controls and analysis of differential CpG sites

(1) Next-generation methylation sequencing

a. Take 1ml of peripheral blood and extract DNA through the peripheral blood genomic DNA extraction kit.

b. Sample quality control

① The integrity of genomic DNA was detected by agarose gel electrophoresis: the electrophoresis bands were clearly visible, no obvious degradation, and no RNA contamination.

②Nanodrop 2000 to detect the quality of genomic DNA: concentration ≥ 20ng/μL, total amount ≥ 1μg (for detection by 10 multiplex PCR panels), OD260/280=1.7～2.0, OD260/230≥1.8;

c. CpG island selection located in the proximal promoter of the target gene

①The minimum length is 200bp;

②GC content ≥ 50% or higher;

③ The ratio of observed/expected dinucleotide CpG is greater than or equal to 0.60.

d. Primer design and single-site PCR condition optimization

Sequencing primers were designed based on the software, and primers that could amplify a clear single band using the bisulfite-treated human genome as a template were selected for subsequent experiments.

e. Multiplex PCR primer panel optimization

Mix the primers optimized in step d into a multiplex PCR primer panel. And use the multiplex PCR technology to amplify with the standard human genome as the template. Based on the special method of capillary electrophoresis, it is judged whether each pair of primers in the multiplex system can amplify efficiently and specifically, and adjust accordingly to optimize the composition and concentration of primers in the multiplex PCR panel.

f. Bisulfite treatment

Use the EZ DNA Methylation-Gold Kit for sample processing to convert unmethylated cytosine C into thymine U in genomic DNA.

g. Multiplex PCR reaction of sample target fragment

Using the optimized multiplex PCR primer panel, the transformed sample genome is used as a template for multiplex PCR amplification. After quality control, the amplification products of all multiple PCR primer panels using the same sample genomic DNA as a template were mixed, and the amount of primer amplification products at each site was ensured to be equivalent.

h. Add specific tag sequence to the sample

Using primers with Index sequences, PCR amplification was used to introduce specific tag sequences compatible with the Illumina platform to the end of the library. The reaction uses a PCR program with 11 cycles to reduce the tendency of PCR as much as possible.

i. On-machine sequencing after quantification

The sample Index PCR amplification products were mixed in equal amounts and recovered by tapping to obtain the final MethylTarget sequencing library. The fragment length distribution of the library was verified by Agilent 2100 Bioanalyzer. After the molar concentration of the library was accurately quantified, high-throughput sequencing was finally performed on the Illumina Hiseq/Nextseq platform in a paired-end sequencing mode of 2×150bp to obtain FastQ data.

(2) Differential CpG site analysis

Analyze the sequencing results, compare the quality-controlled sequencing data with the reference genome, make statistics on the enrichment efficiency of the target fragment, the effective reads of the fragment and the salinization efficiency, and analyze the degree of methylation of each CpG site in the sample Proportion. For all the methylation results, according to the grouping information of the samples, a significant difference analysis is carried out. The analysis method is T test, univariate logistic regression and multivariate logistic regression. When p value<0.05, the methylation of the CpG site is considered to be significant differential expression.

5. Results

The results are shown in Table 1: Compared with healthy controls, there were 7 differential CpG sites in the FOXO3 gene and 1 differential CpG site in the TP53 gene. The methylation levels in the peripheral blood of LOA patients were significantly changed, and the difference was statistically significant. (P<0.05), the specific methylation primers of the 8 differential CpG sites are shown in Table 2.

Table 1 Differential CpG sites

Table 2 Methylation primers of differential CpG sites

6. Through the correlation analysis of the methylation level of the differential CpG sites of FOXO3 and TO53 genes and the clinical parameters of LOA patients, determine the DNA methylation biomarkers that distinguish the LOA population from the healthy population.

According to the grouping information of the samples, the Benjamin-Hochberg method was used to control the false discovery rate (FDR), and the Pearson correlation was used to evaluate the methylation levels of the 8 differential CpG sites and the lung function (FEV1(1 sec Forced expiratory flow), FEV1% predicted (FEV1 predicted value), FVC (forced vital capacity), FEV1/FVC (percentage of FEV1 occupied force vital capacity), PEF (maximum expiratory flow), FEF75 (forced expiratory 75% of vital capacity Correlation of FEF50 (expiratory flow at 50% of forced expiration) and FEF25 (expiratory flow at 25% of forced expiration)). Statistical analysis was done using R language and SPSS.19 software. p<0.05 was considered statistically significant.

7. Results

The results are shown in Figure 2: the methylation level of chr6: 108882977 (FOXO3) is negatively correlated with FEV1% and PEF; the methylation level of chr17: 7591672 (TP53) is positively correlated with FEV1, FVC, PEF and FEF25 . It is suggested that chr6: 108882977 (FOXO3) and chr17: 7591672 (TP53) can be used as biomarkers in the diagnosis and efficacy evaluation of clinical asthma severity and LOA.

8. The feasibility of determining the methylation level of two key differential CpG sites (chr6: 108882977 (FOXO3); chr17: 7591672 (TP53)) as a biomarker to distinguish LOA population from healthy population with a large sample size

(1) According to the method in 1, collect 215 samples of peripheral blood from patients with LOA, and 109 samples of peripheral blood from healthy control test subjects.

(2) Detect the methylation levels of two key differential CpG sites in peripheral blood according to the method in 4.

(3) ROC curve and PCA cluster analysis evaluated the diagnostic accuracy of two key differential CpG loci in distinguishing LOA population from healthy population.

9. Results

The results are shown in Figure 3 and Table 1: the AUC of the methylation level of a single key differential CpG site combined with age to distinguish the LOA population from the healthy population was 0.878 and 0.898; the methylation level of 2 differential CpG sites combined with age The AUC for distinguishing the LOA population from the healthy population was 0.924; PCA analysis also showed that the methylation levels of the two differential CpG sites combined with age can accurately distinguish the LOA population from the healthy population, suggesting that chr6: 108882977 (FOXO3) and chr17: 7591672 (TP53 ) can be used as a biomarker in the early diagnosis and curative effect evaluation of clinical asthma severity and LOA.

10. Establishment of LOA-related methylation profiling kits

According to the above results, the applicant prepared a kit that can be used for early diagnosis of LOA, which contains Taq enzyme polymerase chain reaction system and methylated PCR primers for amplifying the two methylated sites Yes, the Taq polymerase chain reaction system includes: Taq enzyme 0.2 μl, 10×PCR buffer 2.5 μl, dNTPs 1.5 μl, ddH ₂ O 14.8 μl. The kit can be used to detect the methylation levels of the two methylation sites in the genomic DNA of the sample after bisulfite modification, so as to perform early diagnosis of LOA.

Although the specific implementation of the present invention has been described above in conjunction with the accompanying drawings, it does not limit the protection scope of the present invention. On the basis of the technical solution of the present invention, those skilled in the art can make various Modifications or variations are still within the protection scope of the present invention.

sequence listing

<110> Central South University

<120> The combination of methylation sites of FOXO3 and TP53 and its application as a diagnostic marker for late-onset asthma

<141> 2020-02-26

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212>DNA

<213> Artificial Sequence

<400> 1

cggacaaacg gctcactct 19

<210> 2

<211> 21

<212>DNA

<213> Artificial Sequence

<400> 2

ggacccgcat gaatcgacta t 21

<210> 3

<211> 24

<212>DNA

<213> Artificial Sequence

<400> 3

aagtctgtga cttgcacgta ctcc 24

<210> 4

<211> 24

<212>DNA

<213> Artificial Sequence

<400> 4

gtcatgtgct gtgactgctt gtag 24

<210> 5

<211> 20

<212>DNA

<213> Artificial Sequence

<400> 5

ttccagcctt ccttcctggg 20

<210> 6

<211> 20

<212>DNA

<213> Artificial Sequence

<400> 6

ttgcgctcag gaggagcaat 20

<210> 7

<211> 22

<212>DNA

<213> Artificial Sequence

<400> 7

aaggaaggag agagaggaga gg 22

<210> 8

<211> 22

<212>DNA

<213> Artificial Sequence

<400> 8

cagaacccta acagccccct ac 22

<210> 9

<211> 31

<212>DNA

<213> Artificial Sequence

<400> 9

tggatactga tgatattatt tgtttgtact g 31

<210> 10

<211> 30

<212>DNA

<213> Artificial Sequence

<400> 10

acaccaaaaa tctacacact aattcataaa 30

<210> 11

<211> 23

<212>DNA

<213> Artificial Sequence

<400> 11

tgggtagggt tatctgctgg tgt 23

<210> 12

<211> 29

<212>DNA

<213> Artificial Sequence

<400> 12

ccttctcaat tattcagaaa tctactctt 29

<210> 13

<211> 23

<212>DNA

<213> Artificial Sequence

<400> 13

tgttgttagt tctggggtgg gta 23

<210> 14

<211> 28

<212>DNA

<213> Artificial Sequence

<400> 14

ctactacaac ctcaacaacc agctacca 28

<210> 15

<211> 24

<212>DNA

<213> Artificial Sequence

<400> 15

aggtagaaga ttttctggga ggag 24

<210> 16

<211> 24

<212>DNA

<213> Artificial Sequence

<400> 16

acaaccacag aaaaacccta aaac 24

Claims (3)

1. Use of a primer set for amplifying a methylation site combination of FOXO3 and TP53 in the preparation of a diagnostic product for late-onset asthma, said site combination comprising: site chr6 of FOXO3 gene: site chr17 of 108882977 and TP53 genes: 7591672.

2. a diagnostic product for delayed asthma, comprising: a primer set for amplifying a methylation site combination of FOXO3 and TP 53; the primer set comprises:

and (2) chr6:108882977 upstream primer: 5 'and TGTTGTTAGTTCTGGGGTGGGTA-3' as shown in SEQ ID NO. 13;

and (2) chr6:108882977 downstream primer: 5 'CTACTACAACCTCAACCAGCTACCA-3' as shown in SEQ ID NO. 14;

and (2) chr17:7591672 upstream primer: 5 'AGGTAGAAGATTTTCTGGGAGGAGGAP-3', as shown in SEQ ID NO. 15;

and (2) chr17:7591672 downstream primer: 5' ACAACCACAGAAAAACCTAAAC-.

3. A diagnostic kit for delayed asthma, comprising: a primer set for amplifying a methylation site combination of FOXO3 and TP 53; the primer set comprises:

and (2) chr6:108882977 upstream primer: 5 'and TGTTGTTAGTTCTGGGGTGGGTA-3' as shown in SEQ ID NO. 13;

and (2) chr6:108882977 downstream primer: 5 'CTACTACAACCTCAACCAGCTACCA-3' as shown in SEQ ID NO. 14;

and (chr 17): 7591672 upstream primer: 5 'AGGTAGAAGATTTTCTGGGAGGAGGAP-3', as shown in SEQ ID NO. 15;

and (2) chr17:7591672 downstream primer: 5' ACAACCACAGAAAAACCTAAAC-.

Images