CN111154864B - Methylation site combination of FOXO3 and TP53 and application thereof as delayed asthma diagnosis marker - Google Patents

Abstract

The invention discloses a methylation site combination of FOXO3 and TP53 and application thereof as a diagnostic marker of delayed asthma, and the invention discovers that the DNA methylation level of FOXO3 and TP53 genes is related to the severity of asthma and the occurrence and development of delayed asthma for the first time and has important significance for explaining the attack of delayed asthma; the invention provides a diagnostic product, which realizes early noninvasive diagnosis of the delayed asthma by detecting the DNA methylation level of FOXO3 and TP53 genes in peripheral blood so as to realize early treatment of the delayed asthma. The invention is used for evaluating the severity of the disease condition of a clinical asthma patient and early predicting delayed asthma by detecting the DNA methylation level of FOXO3 and TP53 genes in peripheral blood. Compared with the existing detection means, the method has the advantages of small wound, convenience and rapidness in detection, high sensitivity and high patient acceptance.

Description

Methylation site combination of FOXO3 and TP53 and application thereof as delayed asthma diagnosis marker

Technical Field

The invention relates to an asthma diagnosis marker, in particular to a delayed asthma diagnosis marker. Belongs to the technical field of biological diagnosis.

Background

Global guidelines for Asthma prevention (GINA) specify that: delayed asthma is a subtype of asthma that does not present persistent respiratory symptoms until after adulthood. Delayed asthma patients often have a rapid decline in pulmonary function, respond poorly to standardized asthma treatments, have a poor prognosis and are more prone to develop severe asthma than childhood asthma patients, however delayed asthma is often misdiagnosed or treated with delay during clinical diagnosis and treatment. The research results of the Chinese epidemic status, risk factors and disease management status show that about 4570 ten thousands of patients with the delayed asthma exist in China, about 70% of the patients are not diagnosed, and about 95% of the patients are not treated in a standard way, so that great disease burden is brought to society and families, and the urgent need for strengthening the standard diagnosis and treatment of the delayed asthma is warned in China. However, the pathogenesis of late asthma is still unclear, early diagnosis is difficult, and once clearly diagnosed, the conventional treatment effect is usually not obvious. Therefore, the method has important significance for further searching for the biological markers for early risk screening and clinical early diagnosis of the delayed asthma through deep research on pathogenesis and clinical characteristics of the delayed asthma.

A large body of clinical epidemiological data and research results show that accelerated lung aging is an important risk factor and a key pathological basis for late-onset asthma. With the increase of age, the decrease of the structure and function of the lung of the organism leads to the increase of the susceptibility of the lung diseases, the more serious pathological phenotype of the lung and the poor clinical prognosis. In patients with delayed asthma, more obvious aging-related molecular signals (such as telomere shortening, epigenetic change, ROS accumulation and immune aging) are also observed, and the results strongly suggest that abnormal expression and regulation of aging-related genes are involved in the development of delayed asthma.

FOXO3 and TP53 are two classical genes regulating aging and longevity that have been shown to be associated with susceptibility to late-onset asthma, but the mechanisms by which FOXO3 and TP53 participate in the pathogenesis of late-onset asthma are unclear. A recent series of evidence suggests that epigenetic mechanisms may be the primary means of regulation of senescence-associated gene expression. DNA methylation is the earliest and most important modification in epigenetic regulation. It has been proved that DNA methylation can be used as a biomarker for early risk prediction of diseases such as tumors, COPD and the like. In addition, DNA methylation sequence exists in human serum in a highly stable form, can resist digestion of RNA enzyme and protease and various stress states of cells, and is an effective biomarker participating in high-speed and sensitive various diseases.

In conclusion, the incidence and mortality of late asthma have increased year by year with the progress of aging of the global population, but no clinically effective risk prediction marker has been available. Due to the relative easy availability of serum, the DNA methylation biomarkers of FOXO3 and TP53 in circulating serum are expected to be used as non-invasive risk markers for early diagnosis of delayed asthma.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a methylation site combination of FOXO3 and TP53 and application thereof as a diagnostic marker of delayed asthma.

In order to achieve the purpose, the invention adopts the following technical scheme:

1. a methylation site combination of FOXO3 and TP53, the site combination comprising: site chr6 of FOXO3 gene: site chr17 of 108882977 and TP53 genes: 7591672.

2. the FOXO3 and TP53 methylation site combination is used as a diagnosis marker of delayed asthma.

Preferably, the delayed asthma diagnosis comprises: early risk screening and early clinical diagnosis.

3. The FOXO3 and TP53 methylation site combination is applied to preparing a product for diagnosing delayed asthma.

Preferably, the product is selected from any one of a formulation, a chip or a kit.

Preferably, the delayed asthma diagnosis comprises: early risk screening and early clinical diagnosis.

4. A diagnostic marker for delayed asthma which is the methylation site combination of FOXO3 and TP53 described above.

5. A diagnostic product for delayed asthma comprising: a primer set for amplifying the methylation site combination of FOXO3 and TP53 described above.

Preferably, the primer set comprises:

and (chr 6): 108882977 upstream primer: 5 'and TGTTGTTAGTTCTGGGGTGGGTA-3' as shown in SEQ ID NO. 13;

and (2) chr6:108882977 downstream primer: 5 'CTACTACAACCTCCAACAACCAGCTACCA-3', as shown in SEQ ID NO. 14;

and (2) chr17:7591672 upstream primer: 5 'AGGTAGAAGATTTTCTGGGAGGAGGAP-3', as shown in SEQ ID NO. 15;

and (chr 17): 7591672 downstream primer: 5' ACAACCACAGAAAAACCTAAAC-.

6. A diagnostic kit for delayed asthma comprising: a primer set for amplifying the methylation site combination of FOXO3 and TP53 described above.

Preferably, the primer set comprises:

and (2) chr6:108882977 upstream primer: 5' and tgttgttagtctggggtggta-: 108882977 upstream primer: 5 'and TGTTGTTAGTTCTGGGGTGGGTA-3' as shown in SEQ ID NO. 13;

and (2) chr6:108882977 downstream primer: 5 'CTACTACAACCTCAACCAGCTACCA-3' as shown in SEQ ID NO. 14;

and (2) chr17:7591672 upstream primer: 5 'AGGTAGAAGATTTTCTGGGAGGAGGAP-3', as shown in SEQ ID NO. 15;

and (2) chr17:7591672 downstream primer: 5' ACAACCACAGAAAAACCTAAAC-.

Preferably, the kit further comprises a Taq enzyme polymerase chain reaction system, specifically comprising: taq enzyme, PCR buffer, dNTPs, ddH ₂ O。

7. A primer set for amplifying the methylation site combination of FOXO3 and TP53 described above, comprising:

and (2) chr6:108882977 upstream primer: 5 'and TGTTGTTAGTTCTGGGGTGGGTA-3' as shown in SEQ ID NO. 13;

and (2) chr6:108882977 downstream primer: 5 'CTACTACAACCTCCAACAACCAGCTACCA-3', as shown in SEQ ID NO. 14;

and (chr 17): 7591672 upstream primer: 5 'AGGTAGAAGATTTTCTGGGAGGAGGAP-3', as shown in SEQ ID NO. 15;

and (2) chr17:7591672 downstream primer: 5' ACAACCACAGAAAAACCTAAAC-.

The invention has the beneficial effects that:

in order to obtain a noninvasive peripheral blood biomarker of the delayed asthma for early prediction of the onset risk of the delayed asthma (LOA), the applicant firstly evaluates the expression amount of FOXO3 and TP53 in peripheral blood of delayed asthma patients and healthy control people and the DNA methylation level thereof, and the results show that the expression amount and the methylation level of FOXO3 and TP53 in the peripheral blood of the delayed asthma patients are remarkably changed, and further screens out 8 CpG sites which are differentially expressed in the delayed asthma patients. The methylation level of 8 different CpG sites and the lung function index of the asthma patient are subjected to correlation analysis, and the result shows that: the methylation level of FOXO3 and TP53 each have a distinct CpG site (FOXO 3: chr6:108882977, tp53: chr17. The methylation levels of the two different CpG sites can be effectively distinguished from a patient suffering from the delayed asthma and a healthy control through ROC analysis and PCA analysis, and the early diagnosis of the delayed asthma is possible. The method comprises the following specific steps:

1. the invention discovers that the DNA methylation level of FOXO3 and TP53 genes is related to the severity of asthma and the occurrence and development of delayed asthma for the first time, and has important significance for explaining the onset of the delayed asthma;

2. the invention provides a diagnostic product, according to the experimental data of the invention, chr6:108882977 (FOXO 3) and chr17:7591672 (TP 53) methylation level in peripheral blood can be used as a biomarker for preparing an early diagnosis kit of the delayed asthma, and the early noninvasive diagnosis of the delayed asthma is realized by detecting the DNA methylation level of FOXO3 and TP53 genes in the peripheral blood so as to realize early treatment of the delayed asthma.

3. The invention provides application of a product for detecting the DNA methylation level of FOXO3 and TP53 genes in preparing a product for diagnosing delayed asthma. The product includes any product known in the art for detecting gene expression, such as a formulation, chip or kit.

4. Current clinical diagnosis of late-onset asthma relies on clinical manifestations, lung function examination or peak flow rate measurements. Because of the significant heterogeneity of the clinical manifestations of late-onset asthma, traditional diagnostic methods fail to diagnose early and unequivocally the susceptibility and severity of late-onset asthma. The invention is used for evaluating the severity of the disease of a clinical asthma patient and early predicting delayed asthma by detecting the DNA methylation level of FOXO3 and TP53 genes in peripheral blood. Compared with the existing detection means, the method has the advantages of small wound, convenience and rapidness in detection, high sensitivity and high patient acceptance.

5. The changes of the DNA methylation levels of FOXO3 and TP53 genes are reflected not only in the peripheral blood of asthma patients, but also in the induced sputum cells of the asthma patients. Thus, in addition to peripheral blood, changes in the DNA methylation levels of FOXO3 and TP53 genes can be detected in induced sputum cells, bronchoalveolar lavage fluid, blood, serum, plasma, or tissue biopsies (e.g., lung samples).

6. Changes in the DNA methylation levels of FOXO3 and TP53 genes can be detected not only by secondary sequencing, but also by any method known in the art, such as BSP and MSP.

Drawings

FIG. 1 shows the gene expression of FOXO3 and TP53 genes in healthy control and experimental groups, wherein A is the expression level of FOXO3 in peripheral blood and B is the expression level of TP53 in peripheral blood;

fig. 2 is chr6:108882977 and chr17:7591672 analysis of the correlation of methylation levels with lung function, wherein A is chr6:108882977 Correlation analysis of (FOXO 3) methylation levels with FEV1%, chr6:108882977 Correlation analysis of (FOXO 3) methylation levels with PEF, C chr17:7591672 (TP 53) correlation analysis of methylation levels with FEV1, D is chr17:7591672 (TP 53) correlation of methylation levels with FVC, E is chr17:7591672 (TP 53) correlation of methylation levels to PEF, F is chr17:7591672 (TP 53) correlation analysis of methylation levels with FEF 25;

fig. 3 is chr6:108882977 and chr17:7591672 methylation levels differentiate the diagnostic accuracy of a population of LOA from a healthy population, wherein A is chr6:108882977 (FOXO 3) methylation levels ROC curve that distinguishes LOA from healthy population in combination with age, B being chr17:7591672 (TP 53) ROC curve for age-coupled differentiation of LOA population from healthy population, C chr6:108882977 (FOXO 3), chr17:7591672 (TP 53) ROC curve for age-coupled differentiation of LOA population from healthy population, D is chr6:108882977 (FOXO 3), chr17:7591672 (TP 53) PCA Cluster analysis in combination with age-discrimination between LOA and healthy populations.

Detailed Description

The present invention will be further described with reference to the accompanying drawings and examples, which are provided for the purpose of illustration only and are not intended to limit the scope of the invention.

1. Peripheral blood was collected from patients with clear clinical diagnosis of asthma and healthy control subjects

The delayed asthma group was selected from 43 patients (aged >20 years) who were diagnosed in the Xiangya hospital at the university of Central south China and who met the diagnosis criteria and exclusion criteria, and the control group was selected from 60 patients (aged >20 years) who had no significant abnormalities in the medical examination in the Xiangya hospital at the university of Central south China. All subjects informed the purpose of group entry, and signed an informed consent, and compared sex, age, height between the two groups to find no significant difference. The time to collect the cases ranged from 10 months 2018 to 01 months 2019.

Diagnostic criteria for bronchial asthma:

the scheme for defining, diagnosing, treating and managing the bronchial asthma in the bronchial asthma prevention and treatment guideline specifically comprises the following steps:

(1) Recurrent wheezing, shortness of breath, chest distress or cough are often associated with allergen exposure, cold air, physical and chemical irritation, viral upper respiratory infection, exercise, etc.

(2) During attack, the wheeze sounds mainly in expiratory phase are heard and scattered or diffuse in both lungs, and the expiratory phase is prolonged.

(3) The above symptoms can be alleviated by therapy or by themselves.

(4) Except wheezing, shortness of breath, chest tightness or cough caused by other diseases.

(5) Those with atypical clinical symptoms (e.g., no apparent wheezing or signs) should have at least one of the following positive tests:

a. positive bronchial provocation test or exercise test;

b. positive in bronchorelaxation test (more than 15% increase in FEV1, and >200ml increase in FEV1 absolute);

the daily variation rate or day-night fluctuation rate of the PEF is more than or equal to 20 percent.

Those who meet the above 1-4 or 4, 5, can be diagnosed as asthma.

Asthma is classified into mild asthma, moderate asthma and severe asthma according to its severity. Specific clinical standards refer to the 2019 global asthma management and prevention strategy (www

2. Determination of FOXO3 and TP53 expression levels in peripheral blood of LOA patients and healthy control testers

(1) 2ml and 1ml of peripheral blood of an LOA patient and a healthy control are collected for RNA extraction, and 1ml of peripheral blood is used for DNA extraction;

(2) Extracting RNA, and the specific steps are as follows:

and (3) cracking erythrocytes in the peripheral blood by using 1ml of peripheral blood through an erythrocyte lysate, completely absorbing and removing upper-layer liquid after centrifugation to obtain leukocyte precipitates as lower layers, adding 1ml of Trizol, uniformly mixing, transferring to a 1.5ml centrifuge tube, standing at room temperature for 5 minutes, adding 0.2ml of chloroform, violently shaking for 15s, and standing at room temperature for 3min. Centrifuge at 12000g for 15min at 4 ℃.

a. And taking the upper aqueous phase, adding 0.5ml of isopropanol, slightly shaking for 5s, and standing at room temperature for 10min. Centrifuge at 12000g for 15min at 4 ℃.

b. The mixture was washed twice with 75% ethanol aqueous solution by volume and left to dry at room temperature. The RNA was dissolved in 50. Mu.l of ribozyme-free water, and the concentration of the RNA was determined by an ultraviolet spectrophotometer.

(3) RNA quality detection

Concentration and total amount of rna: the precise quantitative concentration of the Qubit;

purity of rna: the Nanodrop detects the ratio of OD260/280 and 260/230;

integrity of rna: agarose gel electrophoresis and Agilent 2100Bioanalyzer to detect the degradation degree of RNA;

the total amount of RNA sample was between 1-4. Mu.g, and the 260/280 ratio was between 1.8-2.0.

(4) Reverse transcription: the reverse transcription kit from Sigma was used for the procedure, which was as follows: taking 1 mu gRNA, calculating the volume of the RNA to be added according to the measured RNA concentration, preparing 12 mu l of reaction system by using 1 mu l of Oligo primer and ribozyme-free water as random primers, and denaturing for 5min at 65 ℃. Reverse transcription was performed using 4. Mu.l of 5 × Reaction Buffer, 2. Mu.l of dNTP mix (10 mM), 1. Mu.l of AMV reverse transcriptase and 1. Mu.l of RNase inhibitor at 25 ℃ for 5min,42 ℃ for 60min, and 70 ℃ for 5min.

(5)Real-Time qPCR：

a. Design of primers QPCR amplification primers are designed according to FOXO3 gene, TP53 gene and beta-actin encoding gene sequences in Genebank and synthesized by Shanghai Biotechnology service company Limited. The specific primer sequences are as follows:

FOXO3 gene:

the forward primer is: 5 'CGG ACA AAC GGC TCA CTC T-doped 3' as shown in SEQ ID NO. 1;

the reverse primer is: 5 'GGA CCC GCA TGA ATC GAC TAT-3' as shown in SEQ ID NO. 2;

TP53 gene:

the forward primer is: 5 'AAG TCT GTG ACT TGC ACG TAC TCC-3' as shown in SEQ ID NO. 3;

the reverse primer is: 5 'GTC ATG TGC TGT GAC TGC TTG TAG-3' as shown in SEQ ID NO. 4;

beta-actin gene:

the forward primer is: 5 'TTC CAG CCT TCC TTC CTG GG-3' as shown in SEQ ID NO. 5;

the reverse primer is: 5 'TTG CGC TCA GGA GGA GCA AT-3', as shown in SEQ ID NO. 6;

b. prepare 25. Mu.l reaction: 12.5. Mu.l SYBR green Mix, 8.5. Mu.l deionized water, 1. Mu.l forward (reverse) primer and 2. Mu.l template, and mixing uniformly. Wherein SYBR green Mix is available from TAKARA.

PCR conditions of 30s at 95 ℃, 5s at 95 ℃, 30s at 60 ℃ and 40cycles. SYBR Green is used as a fluorescent marker, PCR reaction is carried out on a fluorescent quantitative PCR instrument, and relative quantification is carried out by a delta-delta CT method.

3. Results

Results as shown in figure 1, FOXO3 gene expression was upregulated in peripheral blood of mild LOA patients and decreased in severe LOA patients relative to healthy controls, with statistical differences (P < 0.05); the TP53 gene was up-regulated in both mild and severe LOA patients relative to healthy controls, with statistical differences (P < 0.05).

4. Determination of the DNA methylation levels of FOXO3 and TP53 in peripheral blood of LOA patients and healthy control testers and analysis of differential CpG sites

(1) Second generation methylation sequencing

a. 1ml of peripheral blood was taken and subjected to DNA extraction by a peripheral blood genomic DNA extraction kit.

b. Sample quality control

(1) Agarose gel electrophoresis for genomic DNA integrity: the electrophoresis strip is clearly visible, has no obvious degradation and has no RNA pollution.

(2) Nanodrop 2000 detection of genomic DNA quality: the concentration is more than or equal to 20 ng/mu L, the total amount is more than or equal to 1 mu g (the total amount can be used for detecting 10 multiplex PCR panels), OD260/280= 1.7-2.0, and OD260/230 is more than or equal to 1.8;

c. CpG island selection in promoter proximal to target Gene

(1) The minimum length is 200bp;

(2) GC content is not less than 50% or higher;

(3) the observed/expected dinucleotide CpG ratio was equal to or greater than 0.60.

d. Primer design and Single-site PCR Condition optimization

Designing a sequencing primer based on software, selecting a primer which can obtain a clear single band by using a human genome treated by bisulfite as a template and amplifying the human genome for subsequent experiments.

e. Multiplex PCR primer panel optimization

And d, mixing the primers optimized in the step d into a multiplex PCR primer panel. And using multiplex PCR technology and using standard human genome as template to make amplification. Based on the special method of capillary electrophoresis, whether each pair of primers in the multiplex system is efficiently and specifically amplified is judged, and the composition and concentration of the primers in the multiplex PCR panel are optimized by adjusting the pair of primers.

f. Bisulfite treatment

Sample treatment with EZ DNA Methylation-Gold Kit converted cytosine C, which was not methylated in genomic DNA, to thymine U.

g. Multiplex PCR reaction of sample target fragment

And (3) performing multiplex PCR amplification by using the optimized multiplex PCR primer panel and using the transformed sample genome as a template. After quality control, the amplification products of all the multiple PCR primers panel using the same sample genomic DNA as a template are mixed, and the amount of the amplification product of each site primer is ensured to be equivalent.

h. Sample addition of specific tag sequences

Specific tag sequences compatible with the illumina platform were introduced to the ends of the library by PCR amplification using primers with Index sequences. The reaction adopts a PCR program with 11 cycles, and the PCR tendency is reduced as much as possible.

i. Quantitative post-processing sequencing

The sample Index PCR amplification products are mixed in equal quantity, and a final MethylTarget sequencing library is obtained through tapping recovery, and the fragment length distribution of the library is verified by an Agilent 2100 Bioanalyzer. After the molar concentration of the library is accurately quantified, high-throughput sequencing is finally carried out on an Illumina Hiseq/Nextseq platform in a 2 × 150bp double-end sequencing mode, and FastQ data are obtained.

(2) Differential CpG site analysis

Analyzing the sequencing result, comparing the sequencing data after quality control with a reference genome, counting the enrichment efficiency of the target fragment, the effective reads and salinization efficiency of the fragment, and analyzing the methylation proportion of each CpG locus in the sample. And (3) performing differential significance analysis on all methylation results according to grouping information of the samples by using a T test, univariate logistic regression and multivariate logistic regression, and considering that the methylation of the CpG sites is significantly and differentially expressed when the p value is less than 0.05.

5. Results

The results are shown in table 1: compared with healthy controls, the FOXO3 gene has 7 differential CpG sites, the TP53 gene has 1 differential CpG site, the methylation level of the peripheral blood of LOA patients is obviously changed, the differences have statistical differences (P is less than 0.05), and specific methylation primers of 8 differential CpG sites are shown in a table 2.

TABLE 1 differential CpG sites

TABLE 2 methylation primers for differential CpG sites

6. The DNA methylation biomarkers that distinguish the LOA population from the healthy population were determined by correlation analysis of the methylation levels of the FOXO3 and TO53 gene differential CpG sites with the clinical parameters of the LOA patients.

Based on the grouping information of the samples, the Benjamin-Hochberg method was used to control the False Discovery Rate (FDR), the pearson correlation was used to assess the methylation level of 8 differential CpG sites and the correlation of the lung function of asthmatics (FEV 1 (forced expiratory flow at 1 st second), FEV1% predicted (FEV 1 predicted value), FVC (forced vital capacity), FEV1/FVC (FEV 1 percentage of forced vital capacity), PEF (maximum expiratory flow), FEF75 (expiratory flow at 75% forced expiratory flow), FEF50 (expiratory flow at 50% forced expiratory flow) and FEF25 (expiratory flow at 25% forced expiratory flow)). Statistical analysis was done using the R language and spss.19 software. p <0.05 is considered statistically significant.

7. Results

The results are shown in FIG. 2: and (2) chr6:108882977 (FOXO 3) has a negative correlation between methylation level and FEV1% and PEF; and (chr 17): 7591672 The methylation level of (TP 53) is positively correlated with FEV1, FVC, PEF and FEF 25. Prompt, chr6:108882977 (FOXO 3) and chr17:7591672 (TP 53) can be used as a biomarker for clinical diagnosis and efficacy evaluation of asthma severity and LOA.

8. Feasibility of determining methylation levels of 2 key differential CpG sites (chr 6:108882977 (FOXO 3); chr17:7591672 (TP 53)) as biomarkers to distinguish LOA from healthy

(1) 215 parts of peripheral blood from LOA patients and 109 parts of peripheral blood from healthy control testers were collected according to the method described in 1.

(2) The methylation levels of 2 key differential CpG sites in peripheral blood were measured according to the method in 4.

(3) ROC curve and PCA cluster analysis evaluate the diagnosis accuracy of 2 key difference CpG sites for distinguishing LOA population from healthy population.

9. As a result, the

The results are shown in fig. 3 and table 1: the methylation level of a single key difference CpG locus is 0.878 and 0.898 respectively in combination with the AUC of an LOA population and a healthy population by age differentiation; the methylation level of 2 differential CpG sites combined with AUC for age-differentiated LOA populations from healthy populations was 0.924; PCA analysis also showed that methylation levels of 2 differential CpG sites combined with age could accurately distinguish LOA from healthy, suggesting chr6:108882977 (FOXO 3) and chr17:7591672 (TP 53) can be used as a biomarker for the clinical early diagnosis and curative effect evaluation of asthma severity and LOA.

10. Kit for establishing methylation spectrum related to LOA

According to the above results, the applicant prepared a kit for early diagnosis of LOA, which contains Taq enzyme polymerase chain reaction system and methylation PCR primer pairs for amplifying the 2 methylation sites, wherein the Taq enzyme polymerase chain reaction system comprises: taq enzyme 0.2. Mu.l, 10 XPCR buffer2.5μl，dNTPs 1.5μl，ddH ₂ O14.8. Mu.l. The kit can be used for detecting the methylation level of the 2 methylation sites in the genome DNA of the sample after bisulfite modification, thereby carrying out early diagnosis of LOA.

Although the embodiments of the present invention have been described with reference to the accompanying drawings, the scope of the present invention is not limited thereto, and various modifications and variations which do not require inventive efforts and which are made by those skilled in the art are within the scope of the present invention.

Sequence listing

<110> university of south-middle school

<120> methylation site combination of FOXO3 and TP53 and application thereof as delayed asthma diagnosis marker

<141> 2020-02-26

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 1

cggacaaacg gctcactct 19

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 2

ggacccgcat gaatcgacta t 21

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 3

aagtctgtga cttgcacgta ctcc 24

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 4

gtcatgtgct gtgactgctt gtag 24

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

ttccagcctt ccttcctggg 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 6

ttgcgctcag gaggagcaat 20

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 7

aaggaaggag agagaggaga gg 22

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 8

cagaacccta acagccccct ac 22

<210> 9

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 9

tggatactga tgatattatt tgtttgtact g 31

<210> 10

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 10

acaccaaaaa tctacacact aattcataaa 30

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 11

tgggtagggt tatctgctgg tgt 23

<210> 12

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 12

ccttctcaat tattcagaaa tctactctt 29

<210> 13

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 13

tgttgttagt tctggggtgg gta 23

<210> 14

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 14

ctactacaac ctcaacaacc agctacca 28

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 15

aggtagaaga ttttctggga ggag 24

<210> 16

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 16

acaaccacag aaaaacccta aaac 24

Claims (3)

1. Use of a primer set for amplifying a methylation site combination of FOXO3 and TP53 in the preparation of a diagnostic product for late-onset asthma, said site combination comprising: site chr6 of FOXO3 gene: site chr17 of 108882977 and TP53 genes: 7591672.

2. a diagnostic product for delayed asthma, comprising: a primer set for amplifying a methylation site combination of FOXO3 and TP 53; the primer set comprises:

and (2) chr6:108882977 upstream primer: 5 'and TGTTGTTAGTTCTGGGGTGGGTA-3' as shown in SEQ ID NO. 13;

and (2) chr6:108882977 downstream primer: 5 'CTACTACAACCTCAACCAGCTACCA-3' as shown in SEQ ID NO. 14;

and (2) chr17:7591672 upstream primer: 5 'AGGTAGAAGATTTTCTGGGAGGAGGAP-3', as shown in SEQ ID NO. 15;

and (2) chr17:7591672 downstream primer: 5' ACAACCACAGAAAAACCTAAAC-.

3. A diagnostic kit for delayed asthma, comprising: a primer set for amplifying a methylation site combination of FOXO3 and TP 53; the primer set comprises:

and (2) chr6:108882977 upstream primer: 5 'and TGTTGTTAGTTCTGGGGTGGGTA-3' as shown in SEQ ID NO. 13;

and (2) chr6:108882977 downstream primer: 5 'CTACTACAACCTCAACCAGCTACCA-3' as shown in SEQ ID NO. 14;

and (chr 17): 7591672 upstream primer: 5 'AGGTAGAAGATTTTCTGGGAGGAGGAP-3', as shown in SEQ ID NO. 15;

and (2) chr17:7591672 downstream primer: 5' ACAACCACAGAAAAACCTAAAC-.

Images