CN111154808B

CN111154808B - Gene transporter and preparation method and application thereof

Info

Publication number: CN111154808B
Application number: CN202010026644.3A
Authority: CN
Inventors: 张迪; 王旗; 李文雍; 王荣; 程小翠; 李欢欢
Original assignee: Fuyang Normal University
Current assignee: Fuyang Normal University
Priority date: 2020-01-10
Filing date: 2020-01-10
Publication date: 2022-03-22
Anticipated expiration: 2040-01-10
Also published as: CN111154808A

Abstract

The invention relates to a gene transporter and a preparation method and application thereof. The gene transporter comprises nano metal particles and polyethyleneimine, the gene transporter is of a core-shell structure, wherein the nano metal particles form a core of the gene transporter, the polyethyleneimine comprises first polyethyleneimine with the molecular weight of 20000-plus-30000 and second polyethyleneimine with the molecular weight of 1500-plus-2000, and the first polyethyleneimine and the second polyethyleneimine are interwoven and coated on the surface of the core to form a coating shell. After the gene transporter is combined with a plasmid inserted with an exogenous target gene segment through electrostatic adsorption, the gene transporter can break through a zona pellucida barrier on the outer layer of a plasma membrane of an embryonic cell to enter the embryonic cell, and promote double-strand DNA of the embryonic cell to break, thereby creating conditions for integration of the exogenous target gene segment. Meanwhile, the inventor also finds that the gene transporter also has the advantages of small particle size, good dispersibility, high stability, low toxicity and the like.

Description

Gene transporter and preparation method and application thereof

Technical Field

The invention relates to the technical field of medicines, in particular to a gene transporter and a preparation method and application thereof.

Background

In the related experiments of biological research, the introduction of specific exogenous genes into early embryonic cells of mice is an important experimental means. The technical methods used at present are various, but some disadvantages exist, such as: precision and precious instruments, high technical threshold, physical and chemical damage to embryos, inapplicable commodity transfection reagents, high price and the like. In addition, the embryonic cells are different from somatic cells, the outer layer of the plasma membrane of the embryonic cells is provided with a layer of zona pellucida, and the double-layer biological barrier causes the additional difficulty of foreign genes entering the embryonic cells.

The metal nano material has wide application in gene therapy and biological research due to the unique physical and chemical properties and better biocompatibility. The polyethyleneimine is one of cationic polymers with high transfection efficiency, is rich in amino groups and has a 'proton sponge effect', the amino groups with positive charges can be combined with phosphate groups with negative charges in DNA molecules through electrostatic adsorption, so that the polyethyleneimine has strong capacity of combining and compressing DNA, and the formed complex can be endocytosed by cells and can help the DNA to escape from phagocytosis of intracellular lysosomes and be prevented from being degraded by nuclease, so that exogenous genes are delivered into cell nuclei and expressed.

Traditionally, the transfection of exogenous genes by using nano metal particles and polyethyleneimine as vectors is mainly used for transfecting Hela cells, KB cells (a cell line of human oral epithelial cancer) and the like. For example: a non-viral gene vector is composed of gold nanoparticles and cationic polymer which are combined by sulfur-gold bonds; the gene vector containing the nano-gold particles and DNA of gene substances are compounded to form composite particles; wherein the cationic polymer is hyperbranched polyethyleneimine or a copolymer of hyperbranched polyethyleneimine and poly benzyl glutamate. For another example: the gold nanoparticles are coated by polyethylene glycol modified hyperbranched polyethyleneimine. However, these conventional techniques provide vectors that are not suitable for use with embryonic cells based on their specificity.

Disclosure of Invention

Accordingly, the present invention is directed to a gene transporter suitable for embryonic cells, which can break through the zona pellucida barrier of the outer layer of the plasma membrane of an embryonic cell and enter the embryonic cell after being combined with nucleic acid by electrostatic adsorption.

The purpose of the invention is mainly realized by the following technical scheme:

a gene transporter comprises nano metal particles and polyethyleneimine, wherein the gene transporter is of a core-shell structure, the nano metal particles form a core of the gene transporter, the polyethyleneimine comprises first polyethyleneimine with the molecular weight of 20000-30000 and second polyethyleneimine with the molecular weight of 1500-2000, and the first polyethyleneimine and the second polyethyleneimine are interwoven and coated on the surface of the core to form a coating layer.

The method for producing a gene transporter as described above, comprising: and adding the nano metal particle solution into the polyethyleneimine solution, and stirring.

The application of the gene transporter in preparing a gene therapy medicament for treating embryo-related diseases.

A nucleic acid/gene transporter complex comprises the gene transporter and a nucleic acid, wherein the gene transporter and the nucleic acid are combined through electrostatic adsorption, and the nucleic acid comprises an exogenous target fragment.

The method for producing a nucleic acid/gene transporter complex described above, comprising: mixing the solution of the nucleic acid and the solution of the gene transporter.

A kit for stably transferring embryonic cells comprises the gene transporter.

A construction method of stably transferred embryonic cells, which comprises the following steps: the embryonic cells to be transferred are inoculated into a culture medium to which the above-mentioned nucleic acid/gene transporter complex is added, and cultured.

Compared with the prior art, the invention has the following beneficial effects:

the invention selects the first polyethyleneimine with the molecular weight of 20000-plus 30000 and the second polyethyleneimine with the molecular weight of 1500-plus 2000 to wrap the surface of the nano metal particle so as to form the gene transporter, and the gene transporter can break through the zona pellucida barrier on the outer layer of the plasma membrane of the embryonic cell and enter the embryonic cell after being combined with nucleic acid through electrostatic adsorption. And the gene transporter also promotes the double-stranded DNA break of the embryonic cells so as to create conditions for the integration of exogenous target fragments. Meanwhile, the inventor also finds that the gene transporter also has the advantages of small particle size, good dispersibility, high stability, low toxicity and the like.

Drawings

FIG. 1 is a graph of color and UV-VIS absorption spectra of AuNP-PEI solutions of example 1;

FIG. 2 is a particle size distribution and a morphology under a transmission electron microscope of AuNP-PEI of example 1;

FIG. 3 is a block diagram of gel electrophoresis after compounding AuNP-PEI and DNA with different mass ratios in example 1; in the figure, the mass ratios of AuNP-PEI to DNA corresponding to lanes 1-6 are: 0:1, 0.1:1, 0.2:1, 0.3:1, 0.4:1, and 0.5: 1;

FIG. 4 is a graph showing the results of stability tests on AuNP-PEI and DNA according to different mass ratios in example 1; in the figure, the mass ratio of AuNP-PEI to DNA is 0.5:1, 1:1, 2:1, 4:1 and 5:1 in sequence from left to right;

FIG. 5 is a graph of the toxicity of AuNP-PEI on mouse embryonic cells at different concentrations according to example 1; in the figure, 1: control, 2: AuNP-PEI 0.5. mu.g/ml panel, 3: AuNP-PEI 1. mu.g/ml group, 4: AuNP-PEI 5. mu.g/ml panel, 5: AuNP-PEI (eluted 6h after transfection) 5 μ g/ml group, 6: AuNP-PEI 10. mu.g/ml panel, 7: AuNP-PEI 15. mu.g/ml group;

FIG. 6 is a graph showing the in vitro transfection effect of gold nanoparticle gene vectors observed under a fluorescence microscope in example 1;

FIG. 7 is a graph showing Tunel staining effect of in vitro transfected cells under a fluorescent microscope in example 1;

FIG. 8 is a graph showing the double staining effect of Cdx2 and Oct4 on in vitro transfected cells observed under a fluorescent microscope in example 1;

FIG. 9 is a photograph of immunofluorescence of cells after in vitro transfection of gene vectors observed under a fluorescence microscope in example 1;

FIG. 10 is a genotyping map of transplanted mice after transfection in example 1;

FIG. 11 is a photograph of fluorescent staining of histone H2A.X antibody of transplanted mice after transfection in example 1;

FIG. 12 is a graph showing the results of example 1, example 2, comparative example 1 and comparative example 2;

FIG. 13 is a schematic diagram of the self-assembly of a gene transporter and a nucleic acid/gene transporter complex according to an embodiment of the invention; wherein, the nucleic acid molecule comprises 10-nano metal ions, 20-polyethyleneimine, 210-first polyethyleneimine, 220-second polyethyleneimine, 30-gene transporter, 40-nucleic acid and 50-nucleic acid/gene transporter complex.

Detailed Description

In order that the invention may be more fully understood, reference will now be made to the accompanying examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The embodiment of the invention provides a gene transporter, which comprises nano metal particles and polyethyleneimine, wherein the gene transporter is of a core-shell structure, the nano metal particles form a core of the gene transporter, the polyethyleneimine comprises first polyethyleneimine with the molecular weight of 20000-30000 and second polyethyleneimine with the molecular weight of 1500-2000, and the first polyethyleneimine and the second polyethyleneimine are interwoven and coated on the surface of the core to form a coating shell.

Preferably, the mass ratio of the first polyethyleneimine to the second polyethyleneimine is 1:1-2: 3.

Preferably, the ratio of the mass of the nanometal to the sum of the masses of the first polyethyleneimine and the second polyethyleneimine is from 1:1 to 2: 1.

Preferably, the nano metal particles are nano gold particles.

The method for producing a gene transporter as described above, comprising: and adding a nano metal particle solution into the polyethyleneimine solution, stirring, and self-assembling the polyethyleneimine and the nano metal particles during stirring to form the gene transporter with the core-shell structure.

Preferably, the mass percentage of the polyethyleneimine in the polyethyleneimine solution is 0.01-1%, and the mass percentage of the nano metal particles in the nano metal particle solution is 1-3%.

Preferably, the stirring temperature is 22-27 ℃, the stirring speed is 700-900r/min, and the stirring time is 45-50 h.

Preferably, the preparation method is further subjected to membrane filtration after stirring, including but not limited to the use of a 220nm filter membrane. The obtained gene transporter can be stored at low temperature including but not limited to 4 ℃.

The embodiment of the invention also provides application of the gene transporter in preparing a gene therapy medicament for treating embryo-related diseases.

The embodiment of the invention also provides a nucleic acid/gene transporter compound, which comprises the gene transporter and the nucleic acid, wherein the gene transporter and the nucleic acid are combined through electrostatic adsorption. See fig. 13.

It is understood that the nucleic acids described in the embodiments of the present invention may be DNA or RNA. If the nucleic acid is DNA, the nucleic acid is a vector carrying the exogenous target fragment, such as a plasmid into which the exogenous target fragment is inserted.

The embodiment of the invention also provides a preparation method of the nucleic acid/gene transporter complex, which comprises the following steps: mixing the solution of the nucleic acid and the solution of the gene transporter.

Preferably, the concentration of the gene transporter contained in the solution of the gene transporter is 400-600 ng/. mu.l, and the concentration of the nucleic acid contained in the solution of the nucleic acid is 400-500 ng/. mu.l.

Preferably, the mass ratio of the gene transporter to the nucleic acid is (0.5-10): 1.

The embodiment of the invention also provides a kit for stably transferring embryonic cells, which comprises the gene transporter.

The embodiment of the invention also provides a construction method of the stably transferred embryonic cells, which comprises the following steps: the embryonic cells to be transferred are inoculated into a culture medium to which the above-mentioned nucleic acid/gene transporter complex is added, and cultured.

The materials used in the examples of the present invention are commercially available without specific reference.

Example 1

1 materials, apparatus and methods

1.1 materials

Polyethyleneimine (PEI, Sigma-Aldrich, relative molecular mass: 25000, 1800), chloroauric acid (HAuCl)₄·3H₂O, Sigma-Aldrich, relative molecular mass 394), green fluorescent protein reporter plasmid EGFP (self-constructed), TUNEL apoptosis test kit (shanghai bi yunnan biotechnology limited), Anti-phosphor-h 2a.x (merck chemical technology (shanghai) limited), and the rest of the reagents were domestic analytical grade, and all the experiments used water as ultrapure water.

1.2 apparatus

An intelligent numerical control temperature-controlled magnetic heating stirrer (model ZNCL-BS, Toyue instruments Co., Ltd., Chongqing), an ultraviolet spectrophotometer (Thermo, U.S.), an agarose gel electrophoresis apparatus (Bio-Rad, U.S.), a laser particle size analyzer (Nano 90, Malwern, England), a transmission electron microscope (JEOL-1400Plus, Japan K., Ltd.), a fluorescence microscope (Nikon, Japan).

1.3 methods

1.3.1 preparation of AuNP-PEI

The preparation method in the research is formed after continuous adjustment on the basis of the previous preparation method of the nano-gold. The method comprises the following specific steps: adding 16ml of 0.05% PEI solution with molecular weight of 25000 and 1800 (the mass ratio of the two is 3:2) into a small conical bottle, fully stirring, quickly adding 700 mu l of fresh 2% chloroauric acid solution, fixing the volume of ultrapure water to 22ml, sealing, stirring at 25 ℃ at 800r/min for 48h, filtering by using a 220nm filter membrane, and storing at 4 ℃ for later use.

1.3.2 characterization of AuNP-PEI

And (3) carrying out full-wavelength scanning (400-700 nm) by using an ultraviolet spectrophotometer, and analyzing the absorption spectrum and the wavelength of the maximum absorption peak. The morphological characteristics of AuNP-PEI nanoparticles are observed by a transmission electron microscope, and the particle size distribution and the surface potential (Zeta potential) of the nanoparticles are measured by a laser particle size analyzer.

1.3.3 Green fluorescent protein EGFP expression plasmid

The plasmid used in the present application is derived from Clontech's PIRES plasmid, which is 6100 bases in length.

1.3.4 detection of carrying amount and stability of AuNP-PEI to plasmid DNA

The concentration of the used AuNP-PEI solution (500 ng/. mu.l) was constant, the mass of the plasmid DNA was fixed at 1. mu.g (500 ng/. mu.l), and AuNP-PEI and DNA were complexed at mass ratios of 0:1, 0.1:1, 0.2:1, 0.3:1, 0.4:1, and 0.5:1, respectively.

Preparing 1.2% agarose gel, dyeing by using EB nucleic acid dye, taking 1 mu g plasmid DNA, adding AuNP-PEI solutions with different volumes according to the mass ratio, whirling for 10s, and incubating for 20min at room temperature to fully combine the AuNP-PEI solutions.

Loading 6 μ l of each well, performing agarose gel electrophoresis in an electrophoresis tank, performing electrophoresis at 110V for 35min, and observing and shooting the blocking condition in a gel imaging system to obtain the maximum carrying capacity of AuNP-PEI on plasmid DNA. And continuously reducing the DNA compounding amount on the basis of the maximum amount, wherein the DNA compounding amount is reduced according to the ratio of AuNP-PEI to DNA of 0.5:1, 1:1, 2: 1. 4: 1. 5:1, compounding, and observing the solution condition 6 hours after adding the embryonic cell culture system.

1.3.5 toxicity testing of AuNP-PEI on early embryonic cells of mice cultured in vitro

Experimental mice female SPF-grade KM mice were used for 6-8 weeks and were housed in clean-grade mouse rooms. Mouse prokaryotic embryonic cells obtained by mouse superovulation blasts and In Vitro Fertilization (IVF) are placed in a 4-well plate, and then the mouse prokaryotic embryonic cells are placed in a 5% CO at 37 DEG C₂And carrying out in-vitro culture in a constant-temperature incubator.

Setting a blank group and pure water with the same volume as a reference, respectively adding 50 mu l of AuNP-PEI solutions with different concentrations, and setting the experimental concentrations as follows by calculating the constant volume of 1ml in each hole of a 4-hole plate: 0.5. mu.ng/ml, 1. mu.g/ml, 5. mu.g/ml, 10. mu.g/ml and 15. mu.g/ml.

Selecting a proper AuNP-PEI experimental concentration by considering the blastocyst rate and the gene vector dosage, and mixing the AuNP-PEI experimental concentration with the gene vector dosage according to a mass ratio of 5:1 and compounding with plasmid DNA and simultaneously carrying out toxicity test. The number of the mouse embryonic cells added into each hole is not less than 30, the development condition of the mouse embryonic cells is observed and counted, and the experiment is repeated for 3 times in the same way.

1.3.6 in vitro transfection of AuNP-PEI/DNA on mouse embryonic cells

Preparing a carrier compound from AuNP-PEI and plasmid DNA according to the mass ratio of 5:1, diluting 0.5 mu g of plasmid DNA into pure water, quickly adding 10 mu l of AuNP-PEI solution, uniformly mixing, fixing the volume to 50 mu l by using KOSM culture solution, whirling for 10s, and standing for 20min at room temperature for later use.

The culture solution of each hole of the four-hole plate is constant to be 1mL of total volume, and a PEI group, a pure plasmid DNA group and a blank group (pure water) are simultaneously arranged for simultaneous experiments, wherein: the PEI group used concentration was 2. mu.g/ml and the mass ratio of PEI to plasmid DNA was 2:1, the pure plasmid DNA group concentration was 1. mu.g/ml. The number of the mouse embryonic cells added into each hole is not less than 30.

After transfection at 37 ℃ with 5% CO₂Continuously culturing in a constant-temperature incubator. The transfection experiment is divided into two parts, the carrier compound is respectively added into the prokaryotic stage (6 h after IVF) and the two-cell stage (just split into two cells and 14h after IVF) before the fusion of the gynandroecial nucleus for transfection, and the green fluorescent protein expression condition is observed and counted by using a fluorescence microscope at the end stage of the two cells (24 h after IVF).

1.3.7 TUNEL staining assay of mouse embryonic cells transfected with AuNP-PEI/DNA

In order to verify the safety of nanogold, nanosilver (500ng/ml, the semi-lethal dose obtained in the subject group) is introduced to serve as a control, whether the nanosilver can induce apoptosis of embryonic cells of mice is researched, and the apoptosis condition of the nanosilver is observed by TUNEL staining. Fixing the embryonic cells which are eluted and not eluted after the transfection treatment for 6h and develop into blastocysts by using 1% paraformaldehyde, standing overnight at 4 ℃, then carrying out an experiment according to the experimental steps of the one-step TUNEL apoptosis detection kit, and then observing and photographing by using a laser confocal microscope.

The comparative nano silver group is specifically: the concentration of the nano silver in the culture solution of each well of the four-well plate is 500 ng/ml. 1.3.8 detection of transfected mouse embryonic cells Using immunofluorescence

Mouse embryonic cells in which a green fluorescent signal was observed after transfection were fixed with 1% paraformaldehyde overnight at 4 ℃. Rabbit polyclonal antibody was used as primary antibody, FITC was used as secondary antibody, nuclei were stained with Hoechst33342, and observed and photographed using a laser confocal microscope.

1.3.9 double staining detection of Cdx2 and Oct4 on mouse embryonic cells that developed to blastocysts after transfection

The dyeing method employs conventional procedures in the art.

1.3.10 transplantation and propagation Using mouse embryonic cells that developed to blastocysts after transfection

Mouse embryos that were transfected and developed to the blastocyst stage were transplanted into pseudopregnant mice and bred.

1.3.11 observation of the phenotype of mice obtained by post-transplantation breeding and genotyping using PCR and gel electrophoresis techniques

1.3.12 fluorescent staining detection of histone antibody H2A.X on transfected mouse embryonic cells

The transfected mouse embryonic cells were labeled with h2a.x antibody, stained with Hoechst33342 for nuclei, and then observed and photographed using a confocal laser microscope.

2 results

2.1 morphological characteristics and UV absorption Spectroscopy of AuNP-PEI

The prepared AuNP-PEI solution is wine red, has no large particle aggregation and precipitation, is still wine red clear solution after being kept stand at 4 ℃ for more than 6 months, and shows that the AuNP-PEI solution has high stability and can be kept for standby application for a long time. As a result of full-wavelength scanning of the ultraviolet spectrophotometer, an ultraviolet absorption spectrum has a strong absorption peak at 520 nm. See in particular fig. 1.

2.2 morphological characteristics, particle size distribution and Zeta potential of AuNP-PEI

The particle size distribution and the dispersion state of AuNP-PEI were measured by a laser particle size analyzer, and the results showed that the dispersion coefficient was 0.197, the dispersion state was good, and the particle size was (9.89. + -. 1.3) nm. The Zeta potential of AuNP-PEI was found to be + (28.3. + -. 3.4) mV. See in particular fig. 2.

2.3 detection and verification of EGFP plasmid DNA

The mouse tail genomic DNA obtained was subjected to PCR amplification using the following primers, and the product was electrophoresed on a 1% agarose gel.

Forward primer (SEQ ID No. 1): GCAGCACGACTTCTTCAAGTC, respectively;

reverse primer (SEQ ID No. 2): GACTGGGTGCTCAGGTAGTG are provided.

The annealing temperature was 58 ℃ for 30 cycles. The length of the amplification product is 377 bp.

2.4 stability of different mass ratios of AuNP-PEI in combination with DNA

PEI coated on the surface of AuNP enables the PEI to have a large number of positive charges, and plasmid DNA with negative charges can be combined and compressed to the surface of a gene carrier through electrostatic adsorption. According to the agarose gel electrophoresis experiment result, under the condition that the quality of the plasmid DNA is constant, the released plasmid DNA is gradually reduced along with the increasing of the quality of the AuNP-PEI, until the AuNP-PEI/DNA is equal to 0.5, the positive electrode electrophoresis band basically disappears, the carrier compound is completely stayed at the sample adding hole, and the adsorption quantity of the AuNP-PEI to the plasmid DNA is at the critical point. See fig. 3.

Starting from the compounding ratio of AuNP-PEI to DNA of 0.5:1, continuously reducing the compounding amount of DNA, and mixing according to the ratio of 0.5:1, 1:1 and 2: 1. 4:1 and 5:1, compounding, observing the solution condition 6 hours after adding the embryonic cell culture system, wherein the solution condition is measured in a ratio of 0.5:1, 1:1, 2:1 and 4: precipitates with different sizes and colors appear at 1, and the positive charge on the surface of the gene carrier loaded with DNA is measured to be reduced, for example, at 0.5:1, the Zeta potential is reduced from + (28.3 +/-3.4) mV to + (6.21 +/-1.43) mV during preparation, and the reduction of the positive charge on the surface causes the reduction of the stability of the nano material, so that the nano material is more prone to coagulation in a culture system and loses the nano effect and transfection capacity. See in particular fig. 4. Therefore, the compounding ratio of AuNP-PEI and DNA used in the subsequent experiments is 5: 1.

2.5 toxicity test results of AuNP-PEI on early embryonic cells of mice cultured in vitro

Since the carrying amount of DNA by a gene vector is limited, it is necessary to increase the amount of the gene vector used as much as possible in order to improve the transfection efficiency of the vector. Herein, mouse embryonic cells were treated with various concentrations of AuNP-PEI and counted individually for the number of blastocysts developed to determine their feasibility and appropriate dosage for transfection of foreign genes. As can be seen from FIG. 5, the toxicity of nanogold becomes stronger with the increasing concentration of nanogold, the embryonic cells capable of developing into blastocysts at a concentration of 3. mu.g/ml account for about 60% of the prokaryotic amount and can carry about 0.5. mu.g of plasmid DNA, and the amount of the gene vector is determined to be 3. mu.g/ml in subsequent experiments in consideration of the combination. Wherein, the usage amount of AuNP-PEI in the 5 th group and the 4 th group is 5 mu g/ml, but the 5 th group is eluted after 6h of transfection and continuously cultured in a new culture solution, the blastocyst rate is increased rather than that in the 4 th group, which shows that the toxic effect of the nanogold can be reduced or eliminated after elution.

2.6 in vitro transfection experiments on mouse embryos Using AuNP-PEI/DNA

Mouse embryonic cells transfected in a prokaryotic stage (6 h after IVF) and a two-cell stage (immediately after being split into two cells and 14h after IVF) before male and female nuclear fusion are treated by nucleus staining by Hoechst33342, and are observed by a laser confocal microscope by using 488nm exciting light, and besides an AuNP-PEI/DNA group, a DNA group and a blank control group have no specific fluorescence. See in particular fig. 6.

By performing transfection experiments before and after two cells respectively, and performing transfection after two cells by using the gene vector also has no specific fluorescence, we speculate that the gene vector cannot penetrate the membrane for the second time after penetrating the membrane for the first time.

2.7 TUNEL staining of transfected mouse embryonic cells

The mouse embryonic cells were treated in two groups 6h after transfection: eluting one group from the original culture solution, and adding new culture solution for continuous culture; one group was still cultured in the original culture medium.

After the embryonic cells developed into blastocysts, they were washed with PBS and fixed overnight at 4 ℃ with 4% paraformaldehyde. After punching and sealing, TUNEL apoptosis detection reagent is used for staining by one-step method, Hoechst33342 is used for staining nuclei, and the cells are observed and photographed under a laser confocal microscope. After 6h of transfection, specific fluorescence appears in the eluted group and the non-eluted group, but compared with the eluted group, the apoptosis signal of the non-eluted group is obviously enhanced. See in particular fig. 7.

The result shows that normal embryonic cells can also undergo apoptosis to a certain degree during in vitro culture, the nano material can enhance apoptosis signals to a certain degree, and after the nano gold is eluted, the damage to the embryonic cells caused by transfection can be reduced to a certain degree.

2.8 double staining detection of Cdx2 and Oct4 in mouse embryonic cells that developed to blastocysts after transfection

The mouse embryo cells which develop into blastocysts after nanogold treatment are not specifically different from the normal group by carrying out double staining detection on Cdx2 and Oct4 on the mouse embryo cells at the blastocysts obtained after AuNP-PEI treatment. See in particular fig. 8.

2.9 results of immunofluorescence assay of transfected mouse embryos

The results are shown in FIG. 9. As can be seen from FIG. 9, positive signals were observed only in the transfected and GFP antibody-used groups, and no positive signals were observed in any of the remaining groups.

2.10 transfer of transfected embryonic cells, breeding to obtain mice, and detecting typing

After the transfected in vitro fertilized embryo develops to a blastocyst, transplantation is carried out, the tail of a mouse is cut and numbered, lysate (25mM NaOH/0.2mM EDTA) is used for rapidly extracting genome DNA, the genome DNA is used as a template for PCR, the positive mouse is pairwise paired and propagated, the tail of the mouse is continuously cut and numbered, the genome DNA is rapidly extracted, the genome DNA is used as the template for PCR, and the transfection result is identified.

PCR amplification primers:

forward primer (SEQ ID No. 1): GCAGCACGACTTCTTCAAGTC, respectively;

reverse primer (SEQ ID No. 2): GACTGGGTGCTCAGGTAGTG, respectively;

PCR reaction (30. mu.l): mu.l of template, 1. mu.l of forward and reverse primers, 1. mu.l of Taq enzyme (Takara), 1. mu.l of dNTP, 3. mu.l of button, H₂O 20μl。

PCR procedure: pre-denaturation at 94 deg.C for 4min, denaturation at 95 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 5min after 32 cycles, and extension at 4 deg.C for 30 μ l.

Taking the PCR product to perform gel electrophoresis and image.

The results are shown in FIG. 10. Counting the detection results, wherein three batches of mice transplanted after transfection are obtained, and the detection results of 4 mice transplanted in the first batch are all negative; the second group of transplanted mice has 10 mice, wherein 5 female mice and 5 male mice have positive detection results, the two mice are paired, the offspring of the two mice have 103 mice, and the total number of the mice with positive verified results is 4; the third transplanted mouse group had 4 mice, and 2 mice were positive.

2.10 antibody H2A.X staining detection of transfected mouse embryonic cells

See in particular fig. 11. Compared with a normal group, the mouse blastocyst stage embryonic cells obtained after the AuNP-PEI treatment have DNA double-strand breaks, which shows that the intervention of the nanogold increases the breaking chance of the double-strand DNA and creates conditions for the integration of exogenous genes.

Example 2

This example is a modification of example 1, and is modified from example 1 in that in the "preparation of 1.3.1 gene vector AuNP-PEI", PEI with a molecular weight of 25000 and PEI with a molecular weight of 1800 are used in a mass ratio of 1: 1.

referring to FIG. 12, the ratio of fluorescence signals exhibited by the blastocysts was also higher when the mass ratio of the first PEI to the second PEI was 1:1, according to FIG. 12.

Comparative examples 1 and 2

Comparative example 1 is a comparative example of example 1, and the difference from example 1 is mainly that only PEI having a molecular weight of 25000 is used and PEI having a molecular weight of 1800 is omitted in the "preparation of 1.3.1 gene vector AuNP-PEI".

Comparative example 2 is a comparative example of example 1, and the difference with respect to example 1 is mainly that in the "preparation of 1.3.1 Gene vector AuNP-PEI" step, PEI having a molecular weight of 1800 alone is used and molecular weight 25000 is omitted.

Comparison of example 1, comparative example 1 and comparative example 2 referring to FIG. 12, it can be seen from FIG. 12 that the ratio of fluorescence signal exhibited by the blastocyst is high when the second PEI and the first PEI are in the range of 1:1 to 3:2, and the ratio of fluorescence signal exhibited by the blastocyst is low when only the second PEI or the first PEI is used.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> university of fuyang teacher's university

<120> gene transporter, and preparation method and application thereof

<130> AGP191124544GZ

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcagcacgac ttcttcaagt c 21

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gactgggtgc tcaggtagtg 20

Claims

1. A construction method for stably transferring mouse embryonic cells is characterized by comprising the following steps: inoculating the mouse embryo cell to be transferred into a culture medium added with a nucleic acid/gene transporter compound, and culturing;

the mouse embryonic cells are mouse prokaryotic embryonic cells obtained by mouse superovulation mother cells and in-vitro fertilization;

the nucleic acid/gene transporter complex comprises a gene transporter and a nucleic acid, wherein the gene transporter and the nucleic acid are combined through electrostatic adsorption;

the gene transporter comprises a nanogold particle and polyethyleneimine, the gene transporter is of a core-shell structure, wherein the nanogold particle forms a core of the gene transporter, the polyethyleneimine comprises first polyethyleneimine with the molecular weight of 20000-30000 and second polyethyleneimine with the molecular weight of 1500-2000, and the first polyethyleneimine and the second polyethyleneimine are interwoven and coated on the surface of the core to form a coating shell; the mass ratio of the first polyethyleneimine to the second polyethyleneimine is 1:1-3: 2;

the preparation method of the gene transporter comprises the following steps: adding chloroauric acid solution into the polyethyleneimine solution, stirring, and self-assembling the polyethyleneimine and the gold nanoparticles to form the gene transporter with the core-shell structure during stirring; the mass percentage of polyethyleneimine contained in the polyethyleneimine solution is 0.01-1%, and the mass percentage of chloroauric acid contained in the chloroauric acid solution is 1-3%.

2. The method for constructing stably transformed mouse embryonic cells according to claim 1, wherein the stirring temperature is 22-27 ℃, the stirring speed is 700-900rpm, and the stirring time is 45-50 h.

3. The method of claim 1, wherein the nucleic acid/gene transporter complex is prepared by a method comprising: mixing the solution of the nucleic acid and the solution of the gene transporter.

4. The method for constructing transfer-stable mouse embryo cells according to claim 3, wherein the concentration of the gene transporter in the gene transporter solution is 400-600ng/μ l, the concentration of the nucleic acid in the nucleic acid solution is 400-500ng/μ l, and the mass ratio of the gene transporter to the nucleic acid is (0.5-10): 1.