CN111139289A - Constant-temperature rolling ring amplification method based on dumbbell ring template - Google Patents
Constant-temperature rolling ring amplification method based on dumbbell ring template Download PDFInfo
- Publication number
- CN111139289A CN111139289A CN201911360205.XA CN201911360205A CN111139289A CN 111139289 A CN111139289 A CN 111139289A CN 201911360205 A CN201911360205 A CN 201911360205A CN 111139289 A CN111139289 A CN 111139289A
- Authority
- CN
- China
- Prior art keywords
- dumbbell
- template
- amplification
- ring
- rolling circle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention belongs to the technical field of nucleic acid amplification, and particularly relates to a constant-temperature rolling circle amplification method based on a dumbbell ring template, which comprises the following steps: (1) preparing dumbbell-shaped circular DNA serving as a template, wherein the dumbbell-shaped circular DNA is integrally symmetrical, two ends of the dumbbell-shaped circular DNA are ring regions with the same size, and the middle of the dumbbell-shaped circular DNA is a completely complementary stem region; (2) adding the template prepared in the step (1) into a reaction system to carry out hyper-branched rolling circle amplification reaction, wherein the amplification product obtained by the reaction forms a secondary structure. The constant-temperature rolling circle amplification method based on the dumbbell ring template is simple to operate, can realize nucleic acid amplification reaction under a constant temperature condition, avoids non-specific amplification, ensures high-efficiency amplification of the nucleic acid, and improves amplification efficiency.
Description
Technical Field
The invention belongs to the technical field of nucleic acid amplification, and particularly relates to a constant-temperature rolling circle amplification method based on a dumbbell ring template.
Background
Rolling Circle Amplification (RCA) originated in the nineties of the last century, and was initially a linear rolling circle amplification method (LRCA) using a single primer for amplification, followed by the development of a hyper-branched rolling circle amplification method (HRCA) using a pair of primers, and amplification techniques such as PG-RCA, NRCA, etc., which incorporate nicking endonuclease based on HRCA. RCA has become one of the most commonly used isothermal amplification techniques developed to date, and its application fields relate to pharmacy, microbial detection, clinical medicine, etc. As an isothermal amplification technology, RCA is more advantageous than PCR in the aspects of batch detection and field detection, and has higher application value in the field of food, for example, food internal standards can be amplified through RCA, and a food traceability related detection technology can be established.
Compared with the LRCA technology, the HRCA amplification efficiency is faster, the sensitivity is higher, and the HRCA amplification method is widely applied to various detection technologies and the nano field. However, when amplification is carried out by the HRCA amplification method, non-specific amplification or complementary amplification products are likely to occur; non-specific amplification is easy to generate false positive results similar to rolling circle amplification, which brings great inconvenience to detection; however, the amplification products are complementary to each other, which makes it difficult for the primer to bind to the template for exponential amplification, resulting in a decrease in amplification efficiency. The above problems occur because the conventional HRCA uses a template which is generally a single loop with few secondary structures, and the single-stranded part of the amplification product is weak, and thus it is easy to bind to each other by winding to form a stable DNA double helix, occupying the primer binding site, making it difficult for the free primer to bind to the amplification product, thereby reducing the amplification efficiency.
Therefore, it is urgently needed to establish a more efficient hyper-branched rolling circle amplification method, which can avoid non-specific amplification and simultaneously ensure the amplification efficiency, and if the amplification product with stronger single-stranded rigidity and difficult combination and reserved primer binding sites can be obtained by changing the secondary structure of the template, the amplification efficiency of HRCA can be greatly improved.
Disclosure of Invention
Aiming at the problem that the existing HRCA amplification products are combined with each other to occupy primer binding sites, the invention provides a constant-temperature rolling circle amplification method based on a dumbbell ring template, which is a second-generation hyper-branched rolling circle amplification method, designs a novel dumbbell ring template, solves the problem of self product complementation during HRCA amplification by utilizing the dumbbell ring template, introduces a hairpin structure into the amplification template, and uses single strands of a ring area part for binding primers; the amplification product of the template forms a repeated stem-loop structure, and the primer binding site is reserved, so that the amplification efficiency of the template is ensured while non-specific amplification is avoided.
The technical scheme of the invention is as follows:
the constant-temperature rolling ring amplification method based on the dumbbell ring template is characterized by comprising the following steps:
(1) preparing dumbbell-shaped circular DNA serving as a template, wherein the dumbbell-shaped circular DNA is integrally symmetrical, two ends of the dumbbell-shaped circular DNA are ring regions with the same size, and the middle of the dumbbell-shaped circular DNA is a completely complementary stem region;
(2) adding the template prepared in the step (1) into a reaction system to perform hyper-branched rolling circle amplification reaction, wherein an amplification product obtained by the reaction forms a secondary structure; the secondary structure formed by the amplification product reduces the possibility of combining with other complementary products, and reserves sites for primer combination, thereby realizing high-efficiency amplification.
The action principle and the process of the constant-temperature amplification method are as follows:
compared with the conventional HRCA, the design of the secondary structure can change the region for combining the primer into a smaller ring, so that the rigidity of the ring is enhanced, and certain obstruction is existed in the primer combination at the beginning of amplification;
after the first primer is combined, the secondary structure of the template is opened along with the amplification, and the template complementary sequence of tandem repeat is generated as the conventional amplification is started;
then, complementary parts also exist in the amplification products and can preferentially form self stem-loop structures, so that the probability of complementation with other amplification products is reduced;
the secondary structure formed by the self reserves sites for primer combination, and the amplified product always reserves the binding sites for the primers along with the progress of amplification, so that the exponential amplification continues to progress, and the aim of improving the reaction efficiency is fulfilled.
Furthermore, the length of the dumbbell-shaped circular DNA is 50-200 nt.
Furthermore, the length of the dumbbell-shaped circular DNA is 80-120 nt.
Short DNA chains have certain rigidity and are difficult to form circular DNA; longer DNA strands are prone to errors in synthesis. The length of the dumbbell circular DNA is 50-200 nt, and the preferable length is 80-120 nt. The DNA chain with the length of 80-120 nt can be accurately synthesized and easily cyclized, and a stable stem part and a single-chain ring part with strong rigidity can be designed, so that the method is suitable for the amplification template of the constant-temperature amplification method.
When amplification is carried out, the position of the primer can be designed at each part of the template, preferably a ring part; thereby enabling the primer to rapidly bind to the loop single strand for rolling circle amplification.
Further, the reaction system of step (2) comprises two DNA primers, a restriction enzyme and a DNA polymerase with strand displacement effect.
Further, the DNA polymerase is any one of phi 29DNA polymerase, Bst DNA polymerase and Vent (exo-) DNA polymerase; other DNA polymerases having a strand displacement action may be used as long as the DNA polymerase has a strand displacement action.
Further, the preparation method of the dumbbell circular DNA in the step (1) is a cyclization mode, and the cyclization mode comprises enzymatic ligation and chemical synthesis. The preparation of the dumbbell ring template is not limited to the two modes provided in the specification, and the dumbbell ring template can be used in the second-generation hyper-branched rolling ring amplification method as long as the dumbbell ring can be prepared.
Further, the step (1) further comprises the purification of the dumbbell circular DNA, wherein the purification step comprises but is not limited to the purification of the dumbbell circular DNA by Exo I and EXO III, gel cutting recovery and HPLC; here, purification enables removal of by-products, residual substrates, and the like generated during the cyclization process to purify and enrich the circular DNA.
Further, the concentration of the template is 10-3～1nM。
Further, the temperature range of the amplification method is the optimal temperature range of polymerase; the temperature range is more suitable for polymerase to exert activity and carry out high-efficiency amplification.
The invention has the beneficial effects that:
(1) according to the dumbbell ring template provided by the invention, a hairpin structure is introduced into the template, and a single strand of a ring region part is used for combining a primer; the amplification product of the template forms a repeated stem-loop structure, the obtained product has fewer single-chain parts and stronger rigidity, and is difficult to wind into double helix, thereby reducing the possibility of combining with other complementary products, reserving primer binding sites, and improving the amplification efficiency while avoiding non-specific amplification.
(2) The amplification method provided by the invention has simple operation steps, and can realize nucleic acid amplification reaction under the condition of constant temperature; the stem-loop part of the amplified product has a large number of single strands, so that more single-stranded DNA primers can be conveniently combined, and the rapid and efficient amplification of nucleic acid can be realized.
Drawings
FIG. 1 is a diagram showing the results of isothermal amplification based on a dumbbell loop template provided in example 1; wherein, fig. 1A is a diagram of the connection result of a dumbbell ring template used in the second-generation super-branched rolling ring amplification, fig. 1B is a diagram of the purification result of the dumbbell ring template, fig. 1C is a diagram of the amplification result of different ring template concentrations, and fig. 1D is a diagram of the secondary structure of the dumbbell ring template used in the second-generation super-branched rolling ring amplification, wherein the underlined part is the same as or complementary to the primer sequence;
FIG. 2 Vent provided in example 2R(exo-) DNA polymerase was used for second generation hyper-branched rolling circle amplification. Wherein, FIG. 2A is the second generation super-branched rolling circle amplification result under different ring template concentrations, FIG. 2B is the secondary structure diagram of the ring template of this part, in which the underlined part is the same or complementary part with the primer sequence;
FIG. 3A is the results of the second generation of hyper-branched rolling circle amplification at different concentrations of the circle template when the primers are designed in the stem of example 3;
FIG. 3B is a schematic diagram of the secondary structure of the loop template of this section, in which the underlined section is the same or complementary portion to the primer sequence;
FIG. 4 is a schematic diagram of a second generation hyper-branched rolling circle amplification (A) and a conventional hyper-branched rolling circle amplification (B);
FIG. 5C is a graph showing the results of second generation hyperbranched rolling circle amplification and conventional rolling circle amplification provided in comparative examples; FIG. 5A is a schematic diagram of the secondary structure of a dumbbell ring template used in second-generation hyperbranched rolling circle amplification, and FIG. 5B is a schematic diagram of the secondary structure of a ring template used in conventional hyperbranched rolling circle amplification, in which the underlined part is the same as or complementary to the primer sequence;
FIG. 6 is a general verification of the second generation hyperbranched rolling circle amplification method provided in test example 1, wherein FIG. 6A is the second generation hyperbranched rolling circle amplification result of template loops with different loop lengths; FIG. 6B shows the amplification result of the second generation of the template loop with different stem lengths; FIG. 6C shows the amplification result of the second generation of the template Loop of the same secondary structure as that of T1-Loop25 but with different sequences, and FIG. 6D shows the secondary structure of the template Loop of the sequence, in which the underlined part is the same or complementary part with the primer sequence;
FIG. 7 shows the results of verifying the structure of the amplification product by the enzymatic cleavage method in test example 2; wherein, FIG. 7A is an MboI cleavage site; FIG. 7B shows the cleavage site of AciI; FIG. 7C is the electrophoresis diagram of the amplified products after the two enzymes have been cleaved.
Detailed Description
The technical solutions of the present invention will be described in detail and fully with reference to the following specific embodiments, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1: construction of constant-temperature rolling ring amplification method based on dumbbell ring template
Single-stranded DNA material:
T1-Loop 25-1：
TGCACTCATCCTTATGATTCAGCCGCCTCTTCTTGAGTGCAGTGATCTCA
T1-Loop 25-2：
GTAGGTTGCCCTTACTTCGTCAGCCACTTACTTCAACCTACTGAGATCAC
P1-T1-Loop 25:
5’-TGGCTGACGAAGT-3’
P2-T1-Loop 25:
5’-TATGATTCAGCCG-3’
1) single-stranded DNA (abbreviation: ssDNA) absorbance at a260 nm and analyzed for sequence concentration, DNA sequence was diluted to 100 μ M.
2) Preparing a dumbbell ring template: and (2) placing the phosphorylated sequence and a corresponding diluted sequence (the process needs a system containing a certain ion concentration and a proper amount of corresponding ligation Buffer can be added) into a PCR instrument, reacting at 94 ℃ for 3min to completely denature and open the DNA chain, cooling to room temperature at the rate of 0.1 ℃/s to enable the DNA chain to form a hairpin, and immediately adding the hairpin into the ligation reaction system after the reaction is finished. The connection system comprises: DNA strands (T1-Loop 25-1 and T1-Loop 25-2) each 1. mu.M, TaqDNA ligase 6U, TaqDNA ligase buffer 1 × (20mM Tris-HCl (pH 7.6@25 ℃), 25mM KAc, 10mM Mg (Ac)210mM DTT, 1mM NAD and 0.1% Triton X-100), deionized water to 10. mu.L. React for 4h at 55 ℃.
3) Purifying the template ring: the ligated DNA loop is cleaved with exonuclease to remove unligated single strands. Enzyme digestion system: DNA strand 0.5. mu.M, Exonuclease I5U, Exonuclease III 40U, Exonuclease I Buffer 0.5 × (33.5mM MgClyne-KOH (pH 9.5at 25 ℃),3.35mM MgCl2，0.5mM DTT)，Exonuclease III Buffer 0.5×(33mM Tris-HCl(pH8.0at 30℃)，0.33mM MgCl2) The volume of deionized water was adjusted to 10. mu.L. Reacting at 37 ℃ for 1h, and inactivating at 75 ℃ for 20 min.
4) Second generation HRCA amplification: diluting the purified template ring to different concentrations, adding 1 μ L into HRCA system, wherein the system also comprises: primers 5. mu.M each, phi 29DNA polymerase 3U, phi 29DNA polymerase buffer 1 × (50mM Tris-HCl, 10mM MgCl)2，10mM(NH4)2SO44mM DTT, pH 7.5@25 ℃), BSA 200. mu.g/mL, dNTPs 0.2mM, deionized water to make up to 10. mu.L. Reacting at 35 ℃ for 4 h.
5) Analysis of amplification products by gel electrophoresis: 12% modified polyacrylamide Gel (containing 8M urea) electrophoresis analysis dumbbell ring template preparation and purification results, 1% agarose electrophoresis analysis HRCA amplification products, voltage setting 100V, electrophoresis time 1h, electrophoresis results through Gel Red staining observation, and through Image Lab software, according to the strip brightness, products quantitative analysis. As shown in FIG. 1A and FIG. 1B, a relatively pure dumbbell ring template is prepared and applied to the second generation HRCAIn the amplification, the amplification result is shown in FIG. 1C, when the dumbbell ring template is 100nt (wherein the stem part is 25bp, and the ring part is 25nt), the template concentration can be 10-2Amplification products were successfully detected in nM.
Example 2: ventR(exo-) DNA polymerase for second generation HRCA amplification
Selection of DNA polymerase for amplification reaction VentR(exo-) DNA polymerase, wherein the preparation and purification steps of dumbbell loop template are identical to those of example 1, and the rest steps are as follows:
single-stranded DNA material:
T1-Loop 25：
5’-TGCACTCATCCTTATGATTCAGCCGCCTCTTCTTGAGTGCAGTGATCTCAGTAGGTTGCCCTTACTTCGTCAGCCACTTACTTCAACCTACTGAGATCAC-3’
P8-T1-Loop 25：
5’-AGAAGAGGCGGCTGAATCATAAGGA-3’
P9-T1-Loop 25：
5’-CCCTTACTTCGTCAGCCACTTACTT-3’
1) single-stranded DNA (abbreviation: ssDNA) absorbance at a260 nm and analyzed for sequence concentration, DNA sequence was diluted to 100 μ M.
2) Diluting the purified template to different concentrations, taking 1 mu L of the template and adding the template into an HRCA system, wherein the system also comprises: primers 5. mu.M each, VentR(exo-) DNA polymerase 4U, VentR(exo-) DNA polymerase buffer 1 × (20mM Tris-HCl, 2mM MgSO)4，10mM(NH4)2SO410mM KCl, 0.1% Triton X-100, pH 8.8@25 ℃ C.), 0.2mM dNTPs, and deionized water to make up to 10. mu.L. React for 4 hours at 65 ℃.
3) Analysis of amplification products by gel electrophoresis: and (3) carrying out analysis by 1% agarose Gel electrophoresis, setting the voltage to be 100V, carrying out electrophoresis for 1h, observing an electrophoresis result through Gel Red staining, and carrying out quantitative analysis on a product according to the brightness of a strip through Image Lab software. As can be seen from FIG. 2A, in VentRUnder the action of (exo-) DNA polymerase, T1-Loop25 has obvious amplification product at 1nM, which indicates that the polymerase with strand displacement activity can carry out second-generation hyper-branched rolling circle amplification.
Example 3: results of second generation hyperbranched rolling circle amplification when primers were designed at the stem
Single-stranded DNA material:
T1-Loop 25：
5’-TGCACTCATCCTTATGATTCAGCCGCCTCTTCTTGAGTGCAGTGATCTCAGTAGGTTGCCCTTACTTCGTCAGCCACTTACTTCAACCTACTGAGATCAC-3’
P1-T1-Loop 25:
5’-TGGCTGACGAAGT-3’
P7-T1-Loop 25:
5’-GTGCAGTGATCTCAGTAGGTTGCCCTT-3’
1) single-stranded DNA (abbreviation: ssDNA) absorbance at a260 nm and analyzed for sequence concentration, DNA sequence was diluted to 100 μ M.
2) Diluting the purified template to different concentrations, taking 1 mu L of the template and adding the template into an HRCA system, wherein the system also comprises: primers 5. mu.M each, phi 29DNA polymerase 3U, phi 29DNA polymerase buffer 1 × (50mM Tris-HCl, 10mM MgCl)2，10mM(NH4)2SO44mM DTT, pH 7.5@25 ℃), BSA 200. mu.g/mL, dNTPs 0.2mM, deionized water to make up to 10. mu.L. Reacting at 35 ℃ for 4 h.
3) Analysis of amplification products by gel electrophoresis: and (3) carrying out 1% agarose electrophoresis analysis, setting the voltage to be 100V, carrying out electrophoresis for 1h, observing the electrophoresis result through Gel Red staining, and carrying out quantitative analysis on the product according to the brightness of a band through Image Lab software. FIG. 3A shows that the detection limit of the second generation of hyperbranched rolling circle amplification is 1nM (lane 1) when the primers are designed in the stem region, which is comparable to 10 in FIG. 1-2The difference between nM and nM is two orders of magnitude, which indicates that the primer design can amplify both in the stem and loop, but the loop can improve the amplification sensitivity.
Comparative example: results of second-generation hyper-branched rolling circle amplification and conventional hyper-branched rolling circle amplification
Single-stranded DNA material:
T1-Loop 25：
5’-TGCACTCATCCTTATGATTCAGCCGCCTCTTCTTGAGTGCAGTGATCTCAGTAGGTTGCCCTTACTTCGTCAGCCACTTACTTCAACCTACTGAGATCAC-3’
T-C 100:
5’-AGCAACAGCAAGGAGATACAGGAATGGGCATAGTCTTAGCAAGTCGCAGAGGAGAGATGAACAGTGAGCAAGGAAGGTACCGAGAATAGAGAGGACAGAT-3’
P1-T1-Loop 25:
5’-TGGCTGACGAAGT-3’
P2-T1-Loop 25:
5’-TATGATTCAGCCG-3’
P1-T-C 100:
5’-CCATTCCTGTATC-3’
P2-T-C 100:
5’-AACAGTGAGCAAG-3’
1) single-stranded DNA (abbreviation: ssDNA) absorbance at a260 nm and analyzed for sequence concentration, DNA sequence was diluted to 100 μ M.
2) Diluting the purified template to different concentrations, taking 1 mu L of the template and adding the template into an HRCA system, wherein the system also comprises: primers 5. mu.M each, phi 29DNA polymerase 3U, phi 29DNA polymerase buffer 1 × (50mM Tris-HCl, 10mM MgCl)2，10mM(NH4)2SO44mM DTT, pH 7.5@25 ℃), BSA 200. mu.g/mL, dNTPs 0.2mM, deionized water to make up to 10. mu.L. Reacting at 35 ℃ for 4 h.
3) Analysis of amplification products by gel electrophoresis: and (3) carrying out analysis by 1% agarose Gel electrophoresis, setting the electrophoresis at 100V, carrying out electrophoresis for 1h, observing the electrophoresis result by Gel Red staining, and carrying out quantitative analysis on the product according to the brightness of the band by Image Lab software. In FIG. 5C, Lane 1 is Ladder, and Lane 1-4 shows the second generation hyperbranched rolling circle amplification result of dumbbell circular template (T1-Loop25) at different concentrations of circular template; lanes 5-8 are traditional rolling circle amplification results at different concentrations of the circle template; as can be seen from FIG. 5C, the amplification product was detected only in the conventional circular template at a template concentration of 1nM (lane 5), and the amplification product was entirely in the gel well, indicating that the conventional rolling circle amplification did not perform exponential amplification or performed very little exponential amplification, and most of the time the linear amplification was still performed, so the product was longer and longer, and the migration rate was very low during electrophoresis, and was substantially retained in the gel well. While the dumbbell-shaped rolling circle amplification can detect the amplification product when the concentration of the template is from 1nM to 0.01nM (lanes 1-3), the product amount is gradually reduced along with the reduction of the template concentration, and meanwhile, dispersed product strips exist in the lanes, so that the dumbbell-shaped template can be inferred to carry out exponential amplification. Through comparison, the dumbbell ring template has more advantages than the template used by the conventional HRCA when HRCA is carried out, and the detection sensitivity can be improved by more than tens of times.
Test example 1: universality verification of second-generation hyper-branched rolling circle amplification method
Single-stranded DNA material:
T-Loop 15:
5’-TGCACTCATTATGTAGCCGCCTTTGAGTGCAGTGATCTCAGTAGGTTGCCATCCGTACTTACTCAACCTACTGAGATCAC-3’
P1-T-Loop 15:
5’-GTAAGTACGGATG-3’
P2-T-Loop 15:
5’-TATGTAGCCGCCT-3’
T-Loop 20:
5’-TGCACTCATTTATGATTCAGCCGCCCCTTGAGTGCAGTGATCTCAGTAGGTTGCCCTTACCGTCAACTTACTTCAACCTACTGAGATCAC-3’
P1-T-Loop 20:
5’-TAAGTTGACGGTA-3’
P2-T-Loop 20
5’-TGATTCAGCCGCT-3’
T-Loop 30:
5’-CGGGAGTGCAGCAAGGAGATACACGAATGGGCATAGTCCACTCCCGTATGTGATCTCGTCTAGGATGATAAGTGAGCAAGGAAGGTACCGAGACTAGACGAGATCACATA-3’
P1-T-Loop 30:
5’-CCATTCGTGTATC-3’
P2-T-Loop 30:
5’-TGATAAGTGAGCA-3’
T1-Loop 25：
5’-TGCACTCATCCTTATGATTCAGCCGCCTCTTCTTGAGTGCAGTGATCTCAGTAGGTTGCCCTTACTTCGTCAGCCACTTACTTCAACCTACTGAGATCAC-3’
P1-T1-Loop 25:
5’-TGGCTGACGAAGT-3’
P2-T1-Loop 25:
5’-TATGATTCAGCCG-3’
T-Loop 35:
5’-CGGGAGTGAGCAACAGCAAGGAGATACACGAATGGGCATAGTCCACTCCCGTATGTGATCTCGTCTAGCGAGAGATGATAAGTGAGCAAGGAAGGTACCGAGACTAGACGAGATCACATA-3’
T2-Loop 25:
5’-AAGCGTGCACTCATCCTTATGATTCAGCCGCCTCTTCTTGAGTGCACGCTTGTGATCTCACGACGGTAGGTTGCCCTTACTTCGTCAGCCACTTACTTCAACCTACCGTCGTGAGATCAC-3’
T3-Loop 25:
5’-TGTCTCAGTCTCACTCCCGCTGTCTTCGATCTGTCGATCTGTGTCAGTGACTCTCATGACTCTCACTGTACCTCTTCACTGACACTGATCGACAGATCGA-3’
P1-T3-Loop 25：
5’-ACAGTGAGAGTAC-3’
P2-T3-Loop 25：
5’-AGTCTCACTCACT-3’
1) single-stranded DNA (abbreviation: ssDNA) absorbance at a260 nm and analyzed for sequence concentration, DNA sequence was diluted to 100 μ M.
2) Diluting the purified template to different concentrations, taking 1 mu L of the template and adding the template into an HRCA system, wherein the system also comprises: primers 5. mu.M each, phi 29DNA polymerase 3U, phi 29DNA polymerase buffer 1 × (50mM Tris-HCl, 10mM MgCl)2，10mM(NH4)2SO44mM DTT, pH 7.5@25 ℃), BSA 200. mu.g/mL, dNTPs 0.2mM, deionized water to make up to 10. mu.L. Reacting at 35 ℃ for 4 h.
3) Analysis of amplification products by gel electrophoresis: and (3) carrying out analysis by 1% agarose Gel electrophoresis, setting the electrophoresis at 100V, carrying out electrophoresis for 1h, observing the electrophoresis result by Gel Red staining, and carrying out quantitative analysis on the product according to the brightness of the band by Image Lab software. FIG. 6A shows the amplification result of the second generation hyperbranched rolling circle of the template loop with different loop length; l: o' RangeRuler50bp DNAladder, lanes 1-5 are amplification results at different concentrations of the loop template when the loop is 15nt, lanes 6-10 are amplification results at different concentrations of the loop template when the loop is 20nt, lanes 11-15 are amplification results at different concentrations of the loop template when the loop is 25nt, lanes 16-20 are amplification results at different concentrations of the loop template when the loop is 30nt, and lanes 21-24 are amplification results at different concentrations of the loop template when the loop is 35 nt; FIG. 6B shows the amplification result of the second generation of the template loop with different stem lengths; l: o' RangeRuler50bp DNAladder, lanes 1-5 are amplification results under different ring template concentrations when the stem part is 25bp, and lanes 6-10 are amplification results under different ring template concentrations when the stem part is 35 bp;
as can be seen from FIG. 6A, the dumbbell loop templates with 15nt and 20nt loop regions only have a small amount of amplification product at a template concentration of 1nM (lanes 1 and 6); amplification product detectable at 0.01nM for 25nt dumbbell loop template (lane 13); while the 30nt and 35nt dumbbell ring templates had obvious amplification products at 1nM (lanes 16 and 21), and in addition, no amplification product was found in the control group ( lanes 5, 10, 15 and 20) in this experiment, indicating that different ring lengths can effectively perform second-generation hyper-branched rolling-ring amplification.
As shown in FIG. 6B, the dumbbell loop template with 25bp stem length can amplify the product at the lowest concentration of 0.01nM (lane 2), while the dumbbell loop template with 35bp stem length can detect the amplified product at the template concentration of 1pM (lane 8), which indicates that different stem lengths can effectively perform the second-generation hyper-branched rolling-loop amplification.
As can be seen from FIG. 6C, the amplification result of the template sequence T3-Loop 25 is almost the same as that of T1-Loop25, the detection limit is 0.01nM (lanes 1-3), and it is shown that different DNA sequences can perform second-generation hyper-branched rolling circle amplification with the same secondary structure. In conclusion, the invention has better universality, can be suitable for various secondary structure templates and does not reduce the amplification efficiency due to the change of DNA sequences.
Test example 2: enzyme cutting method for verifying structure of amplification product
Single-stranded DNA material:
T1-Loop 25：
5’-TGCACTCATCCTTATGATTCAGCCGCCTCTTCTTGAGTGCAGTGATCTCAGTAGGTTGCCCTTACTTCGTCAGCCACTTACTTCAACCTACTGAGATCAC-3’
P1-T1-Loop 25:
5’-TGGCTGACGAAGT-3’
P2-T1-Loop 25:
5’-TATGATTCAGCCG-3’
1) single-stranded DNA (abbreviation: ssDNA) absorbance at a260 nm and analyzed for sequence concentration, DNA sequence was diluted to 100 μ M.
2) Diluting the purified template to different concentrations, taking 1 mu L of the template and adding the template into an HRCA system, wherein the system also comprises: primers 5. mu.M each, phi 29DNA polymerase 3U, phi 29DNA polymerase buffer 1 × (50mM Tris-HCl, 10mM MgCl)2，10mM(NH4)2SO44mM DTT, pH 7.5@25 ℃), BSA 200. mu.g/mL, dNTPs 0.2mM, deionized water to make up to 10. mu.L. Reacting at 35 ℃ for 4 h.
3) Respectively carrying out enzyme digestion on the amplification product by MboI and AciI, carrying out 1% agarose Gel electrophoresis analysis, setting the electrophoresis at 100V, carrying out electrophoresis time for 1h, observing the electrophoresis result by Gel Red staining, and carrying out quantitative analysis on the product according to the strip brightness by Image Lab software. In FIG. 7, the MboI cleavage result is relatively thorough, there is substantially no longer band, and the cleavage products are distributed around 50 bp; the enzyme cutting result of AciI shows a step-shaped band from top to bottom, and a small amount of large-fragment DNA bands also exist in the channel opening. Since the restriction enzyme site of MboI is at the stem of the template (FIG. 7A), the hairpin structure formed by either the amplified double-stranded or single-stranded product itself can be cut, while the RCA amplification product is a double-stranded product complementary or identical to the template, and therefore, there should be one restriction enzyme site every 50bp, which is consistent with the representation of the restriction enzyme product on the electrophoresis chart. The enzyme cutting site of aciI is in a loop region (figure 7B), only a loop part forms a double chain through amplification, the enzyme cutting can be carried out, even if a hairpin structure is formed by a single-chain product, the loop part region is still single-chain and can not be subjected to enzyme cutting, and the products after enzyme cutting often have tandem hairpin structures with different lengths.
In addition, since the loop region of the hairpin cannot be cleaved by enzyme, it can be shown that even if the hairpin structures of the amplification product are completely complementary to each other, the loop region thereof hardly forms a double-stranded structure, and the feasibility of the present study was laterally demonstrated. The above results can determine that the amplification reaction is performed according to the expected design, the reaction product forms a serial hairpin structure according to the experimental design, and more serial hairpins still exist after the reaction is finished.
The above description is only for the preferred embodiment of the present invention and should not be taken as limiting the invention, and any modifications, equivalents, improvements and the like made within the scope of the present invention should be included in the patent protection scope of the present invention.
Claims (9)
1. The constant-temperature rolling ring amplification method based on the dumbbell ring template is characterized by comprising the following steps:
(1) preparing dumbbell-shaped circular DNA serving as a template, wherein the dumbbell-shaped circular DNA is integrally symmetrical, two ends of the dumbbell-shaped circular DNA are ring regions with the same size, and the middle of the dumbbell-shaped circular DNA is a completely complementary stem region;
(2) adding the template prepared in the step (1) into a reaction system to carry out hyper-branched rolling circle amplification reaction, wherein the amplification product obtained by the reaction forms a secondary structure.
2. The constant-temperature rolling circle amplification method based on the dumbbell ring template of claim 1, wherein the length of the dumbbell ring-shaped DNA is 50-200 nt.
3. The constant-temperature rolling circle amplification method based on the dumbbell ring template of claim 2, wherein the length of the dumbbell ring-shaped DNA is 80-120 nt.
4. The constant-temperature rolling circle amplification method based on the dumbbell ring template of claim 1, wherein the reaction system in step (2) comprises two DNA primers, a restriction endonuclease and a DNA polymerase with strand displacement effect.
5. The isothermal rolling circle amplification method based on the dumbbell ring template of claim 4, wherein the DNA polymerase is phi 29DNA polymerase, Bst DNA polymerase or Vent (exo-) DNA polymerase.
6. The constant-temperature rolling circle amplification method based on the dumbbell ring template in the claim 1, characterized in that the preparation method of the dumbbell ring-shaped DNA in the step (1) is a cyclization mode, and the cyclization mode comprises enzymatic ligation and chemical synthesis.
7. The constant-temperature rolling circle amplification method based on the dumbbell ring template of claim 1, wherein the step (1) further comprises purification of dumbbell circular DNA by Exo I purification, EXO III purification, gel cutting recovery or HPLC purification.
8. The constant-temperature rolling circle amplification method based on the dumbbell ring template of claim 1, wherein the concentration of the template is 10-3～1nM。
9. The constant-temperature rolling circle amplification method based on the dumbbell ring template of claim 1, wherein the temperature range of the amplification method is the optimal temperature range of polymerase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911360205.XA CN111139289A (en) | 2019-12-25 | 2019-12-25 | Constant-temperature rolling ring amplification method based on dumbbell ring template |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911360205.XA CN111139289A (en) | 2019-12-25 | 2019-12-25 | Constant-temperature rolling ring amplification method based on dumbbell ring template |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111139289A true CN111139289A (en) | 2020-05-12 |
Family
ID=70520203
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911360205.XA Pending CN111139289A (en) | 2019-12-25 | 2019-12-25 | Constant-temperature rolling ring amplification method based on dumbbell ring template |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111139289A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113046453A (en) * | 2021-03-24 | 2021-06-29 | 复旦大学 | Method and kit for detecting DNA point mutation based on padlock probe mediated stem-loop connection amplification technology |
| CN113981044A (en) * | 2021-07-08 | 2022-01-28 | 南京鼓楼医院 | TsrA detection method based on rolling circle amplification and molecular beacon |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105349683A (en) * | 2015-12-09 | 2016-02-24 | 山东大学 | Cascade rolling-ring amplification strategy mediated with dumbbell molecular probe under protection of target object and applied to sensitiveness detection of DNA transmethylase activity |
| CN106480021A (en) * | 2016-10-31 | 2017-03-08 | 中山大学 | A kind of nucleic acid constant-temperature exponential amplification techniques based on symmetric annular dumbbell template and its application in microRNA detection |
| US20170067097A1 (en) * | 2014-04-11 | 2017-03-09 | Redvault Biosciences, Lp | Systems and methods for clonal replication and amplification of nucleic acid molecules for genomic and therapeutic applications |
| WO2018048205A1 (en) * | 2016-09-06 | 2018-03-15 | 이화여자대학교 산학협력단 | Method for molecular diagnosis based on rolling circle amplification |
| US20180073082A1 (en) * | 2015-02-25 | 2018-03-15 | Diogene Co., Ltd | Dumbbell-structure oligonucleotide, nucleic acid amplification primer comprising same, and nucleic acid amplification method using same |
| CN110004213A (en) * | 2019-03-04 | 2019-07-12 | 山东师范大学 | The method for mediating strand replacement reaction to cause rolling circle amplification and FRET detection miRNA based on Toehold |
-
2019
- 2019-12-25 CN CN201911360205.XA patent/CN111139289A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170067097A1 (en) * | 2014-04-11 | 2017-03-09 | Redvault Biosciences, Lp | Systems and methods for clonal replication and amplification of nucleic acid molecules for genomic and therapeutic applications |
| US20180073082A1 (en) * | 2015-02-25 | 2018-03-15 | Diogene Co., Ltd | Dumbbell-structure oligonucleotide, nucleic acid amplification primer comprising same, and nucleic acid amplification method using same |
| CN105349683A (en) * | 2015-12-09 | 2016-02-24 | 山东大学 | Cascade rolling-ring amplification strategy mediated with dumbbell molecular probe under protection of target object and applied to sensitiveness detection of DNA transmethylase activity |
| WO2018048205A1 (en) * | 2016-09-06 | 2018-03-15 | 이화여자대학교 산학협력단 | Method for molecular diagnosis based on rolling circle amplification |
| CN106480021A (en) * | 2016-10-31 | 2017-03-08 | 中山大学 | A kind of nucleic acid constant-temperature exponential amplification techniques based on symmetric annular dumbbell template and its application in microRNA detection |
| CN110004213A (en) * | 2019-03-04 | 2019-07-12 | 山东师范大学 | The method for mediating strand replacement reaction to cause rolling circle amplification and FRET detection miRNA based on Toehold |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113046453A (en) * | 2021-03-24 | 2021-06-29 | 复旦大学 | Method and kit for detecting DNA point mutation based on padlock probe mediated stem-loop connection amplification technology |
| CN113046453B (en) * | 2021-03-24 | 2023-02-03 | 复旦大学 | Method and kit for detecting DNA point mutation based on padlock probe mediated stem-loop connection amplification technology |
| CN113981044A (en) * | 2021-07-08 | 2022-01-28 | 南京鼓楼医院 | TsrA detection method based on rolling circle amplification and molecular beacon |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8003322B2 (en) | Method of amplifying a target nucleic acid by rolling circle amplification | |
| JP6894501B2 (en) | Isothermal nucleic acid self-amplification method | |
| US11505821B2 (en) | Closed linear DNA production | |
| US5834202A (en) | Methods for the isothermal amplification of nucleic acid molecules | |
| US5614389A (en) | Methods for the isothermal amplification of nucleic acid molecules | |
| US10683498B2 (en) | Methods for generating circular DNA from circular RNA | |
| US5514568A (en) | Enzymatic inverse polymerase chain reaction | |
| US20030082578A1 (en) | In vitro amplification of nucleic acid molecules via circular replicons | |
| CN104212791B (en) | A kind of nucleic acid synthesis methods extended based on two-way isothermal | |
| CA2917206C (en) | Dna amplification via scissor-like structures (dasl) | |
| KR101600039B1 (en) | Method for Amplification Nucleic Acid Using Aelle-Specific Reaction Primers | |
| CN111139289A (en) | Constant-temperature rolling ring amplification method based on dumbbell ring template | |
| WO2017143873A1 (en) | Isothermal nucleic acid amplification method | |
| KR20190092881A (en) | Method for Detecting Target Nucleic Acid Using Isothermal Nucleic Acid Amplication Basd on Hairpin Probe | |
| US9441271B2 (en) | Methods and compositions for amplification and sequencing of difficult DNA templates | |
| WO2018232594A1 (en) | Pcr primer pair and application thereof | |
| JP7333171B2 (en) | RNA detection method, RNA detection nucleic acid and RNA detection kit | |
| WO2002090538A1 (en) | Method of synthesizing nucleic acid | |
| WO2019134791A1 (en) | Controlled circularization of rna | |
| US20230183792A1 (en) | Methods for the multiplexed isothermal amplification of nucleic acid sequences | |
| WO2022239632A1 (en) | Method for producing synthesized dna molecule | |
| JP2005318884A (en) | Method for amplifying nucleic acid | |
| JP2011000058A (en) | Method for amplifying target dna | |
| WO2023220110A1 (en) | Highly efficient and simple ssper and rrpcr approaches for the accurate site-directed mutagenesis of large plasmids | |
| WO2001059099A1 (en) | A method of preparing recombinant nucleic acids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |