CN111118195B - Mutation site of anti-glufosinate-bulleyhead grass population, primer, detection method and application - Google Patents
Mutation site of anti-glufosinate-bulleyhead grass population, primer, detection method and application Download PDFInfo
- Publication number
- CN111118195B CN111118195B CN202010064000.3A CN202010064000A CN111118195B CN 111118195 B CN111118195 B CN 111118195B CN 202010064000 A CN202010064000 A CN 202010064000A CN 111118195 B CN111118195 B CN 111118195B
- Authority
- CN
- China
- Prior art keywords
- glufosinate
- goosegrass
- population
- dcaps
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a mutation site of a glufosinate-resistant goosegrass herb population, which is located in a target enzyme glutamine synthetase gene EiGS1-S cloned from glufosinate-sensitive goosegrass herb and has a sequence shown in SEQ ID NO: 1, the mutation at position 175 of the nucleotide sequence shown in 1 is a-G. The invention also discloses a dCAPs primer for detecting the gene mutation site of the anti-glufosinate-goosegrass population, a detection method of the anti-glufosinate-goosegrass population and application of the primer in preparation of a kit or a biological agent for detecting the anti-glufosinate-goosegrass population.
Description
Technical Field
The invention belongs to the technical field of glufosinate-resistant goosegrass detection, and particularly relates to a mutation site of a glufosinate-resistant goosegrass population, a primer, a detection method and application.
Background
Glufosinate ammonium (phosphinothricin) is a broad-spectrum contact-type biocidal herbicide developed successfully by egeft, formerly germany (post-homed bayer corporation) in the 80 s of the 20 th century. Glufosinate belongs to phosphonic acid herbicides and can inhibit glutamine synthetase in plant nitrogen metabolic pathways, so that metabolism of plants is interfered, and the plants die. Glufosinate, glyphosate and paraquat are called three broad-spectrum biocidal herbicides in the world, wherein the yield and sales of glyphosate are the first, but the global sales growth rate of glyphosate continuously slides down for nearly 5 years due to the continuous increase of resistant populations of the glyphosate; because of the high toxicity of paraquat, the paraquat water agent is forbidden in 2016 years in China. Benefiting from the glyphosate resistant weed control requirement and filling the market blank of paraquat disablement, under the promotion of large-area popularization of glufosinate-resistant transgenic crops, the yield and sales of glufosinate at home and abroad are continuously and highly increased in recent years, and after the glufosinate-resistant transgenic crops become glyphosate, the herbicide is treated by non-selective stems and leaves which are the second in international ranking, but with the wide and continuous use of glufosinate, the risk of resistance evolution of weeds to glufosinate is increased.
And (3) goosegrass herb: is a diploid (2 n-36) gramineous weed, and is one of ten malignant weeds in crop fields of China and even the world due to fast growth, large seed quantity and high population density. Glyphosate and paraquat are resistant to being flooded and damaged in southern areas of China, which seriously harms the planting of crops such as rice, corn, vegetables, fruit trees and the like and seriously affects local agricultural production and ecological environment. Since 2009, the broad crop growers in southern areas have gradually used glufosinate to control glyphosate and paraquat resistant goosegrass, the resistant population has been effectively controlled, but in recent years the field control of glufosinate has begun to decline. If the anti-glufosinate-ox-grass population breaks out and causes disasters in south China, the safe production of crops in the region is threatened seriously. Scientific prevention and control technology for resisting the glufosinate-ammonium goosegrass is urgently needed in production, and the requirement of a rapid detection technology for the resistant weeds is particularly urgent.
The target enzyme of glufosinate-ammonium is glufosinate-ammonium target enzyme Glutamine Synthetase (GS), which is an important detoxifying enzyme in the plant nitrogen metabolism process and can remove the toxicity of ammonium released in nitrate reduction, amino acid degradation and light respiration, and after being inhibited by glufosinate-ammonium, GS causes plant nitrogen metabolism disorder and ammonium ion accumulation, so that plant cell membranes are damaged, and finally plant photosynthesis is blocked and withered. GS is divided into cytoplasmic type GS1 and plastid type GS2 according to different subcellular localization, the goosegrass GS gene related to the invention is cytoplasmic type, and therefore, GS1 genes cloned from glufosinate-ammonium sensitive type goosegrass and resistant goosegrass are named as EiGS1-S and EiGS1-R respectively.
Herbicide resistance of weeds is divided into two mechanisms, 1) a target molecule based on herbicide target enzyme mutation or overexpression and 2) a non-target resistance mechanism based on absorption, transport and metabolism. At present, only a few populations of two weeds, i.e. the goosegrass and the ryegrass, are found to generate resistance to glufosinate-ammonium globally, and the resistance mechanism is still in the original data accumulation stage. The molecular mechanism research based on the target gene GS is only rarely researched, and a rapid detection technology based on the molecular characteristics of the target gene GS is not available. At present, the identification of the glufosinate-ammonium-resistant weeds is mainly determined by an indoor pot culture bioassay method, the method comprises the steps of field sampling, seed collection, indoor cultivation, stem and leaf spraying, bioassay and the like, the period is about 2 months, and the method is time-consuming and labor-consuming.
Disclosure of Invention
The invention aims to provide a mutation site of a glufosinate-resisting goosegrass population.
The present invention also provides the dCAPs primer for detecting the mutation site.
The third purpose of the invention is to provide a detection method of the anti-glufosinate-goosegrass population.
The last purpose of the invention is to provide the application of the primer in preparing a kit or a biological agent for detecting the anti-glufosinate-goosegrass population.
The first object of the present invention can be achieved by the following technical solutions: a mutation site resistant to a glufosinate-grass population, located at a position in a sequence shown in SEQ ID NO: 1, the mutation at position 175 of the nucleotide sequence shown in 1 is a-G.
Meanwhile, the mutation causes that the 59 th amino acid of the encoded protein is mutated from serine (Ser) to glycine (Gly).
In the application, the nucleotide sequence of the target enzyme glutamine synthetase gene EiGS1-R for endowing goosegrass with drug resistance to glufosinate-ammonium is shown as SEQ ID NO: 2, and the nucleotide sequence of the corresponding sensitive type glufosinate-ox tendon grass colony target enzyme glutamine synthetase gene (EiGS1-S) is shown as SEQ ID NO: 1, the Glutamine synthetase gene EiGS1-R of the anti-target enzyme of the grass-ammonium-phosphinothricin population has a molecular mutation characteristic A-G at the 175 th position of EiGS 1-S.
The mutation site can be obtained by the following steps:
(1.1) selecting an anti-type goosegrass herb population and a sensitive-type goosegrass herb population, respectively extracting total RNA, and performing reverse transcription to obtain cDNA;
(1.2) cloning EiGS1-R and EiGS1-S gene protein coding sequences by using cDNA in (1.1) as a template by adopting an upstream primer GS1-F (the base sequence is shown as SEQ ID NO: 5) and a downstream primer GS1-R (the base sequence is shown as SEQ ID NO: 6);
(1.3) sequencing to obtain the complete sequences of the genes gEiGS1-R (SEQ ID NO: 4) and gEiGS1-S (SEQ ID NO: 3), which are completed by a sequencing company;
(1.4) analyzing the difference of the aligned sequences by adopting nucleic acid sequence alignment software (DNAStar, DNAMAN and the like) to obtain mutation sites.
The second object of the present invention can be achieved by the following technical solutions: a dCAPs primer for detecting the mutation site comprises an upstream primer dCaps-GS1-F and a downstream primer dCaps-GS1-R, wherein the base sequence of the upstream primer dCaps-GS1-F is shown as SEQ ID NO: 7, the base sequence of the downstream primer dCaps-GS1-R is shown as SEQ ID NO: shown in fig. 8.
The primer has strong specificity, and can detect the mutation of the site A-175-G (the 175 th site is mutated from A to G) of the glutamine synthetase gene in the anti-glufosinate-goosegrass flora.
The primer can be obtained by the following method: the method takes the goosegrass glutamine synthetase GS1 genome sequence as a template, and comprises the following steps:
(2.1) selecting glufosinate-ammonium resistant and sensitive goosegrass herb populations, and extracting genome DNA (gDNA) of the taura-grass populations;
(2.2) cloning genome sequences gEiGS1-R and gEiGS1-S of EiGS1-R and EiGS1-S genes by adopting an upstream primer GS1-F (SEQ ID NO: 5) and a downstream primer GS1-R (SEQ ID NO: 6) and taking eleusine indica gDNA as a template;
(2.3) sequencing to obtain the complete sequence of the gEiGS1-R (SEQ ID NO: 4) and gEiGS1-S genes (SEQ ID NO: 3), which is completed by a sequencing company;
(2.4) designing primers according to the gene sequences of gEiGS1-R and gEiGS1-S, wherein the primers comprise an upstream primer dCaps-GS1-F and a downstream primer dCaps-GS1-R, and the base sequence of the upstream primer dCaps-GS1-F is shown in SEQ ID NO: 7, the base sequence of the downstream primer dCaps-GS1-R is shown as SEQ ID NO: shown in fig. 8.
Specifically, the bases of the obtained dCAPs primer are as follows:
dCaps-GS1-F：GTCATCCACTGAGCTGTTATTTGGC(SEQ ID NO：7)
dCaps-GS1-R：TCCTCGCCGGGAGCTTGGCCGGTAC(SEQ ID NO：8)。
the third object of the present invention can be achieved by the following technical solutions: a detection method of a glufosinate-resistant goosegrass herb population comprises the following steps:
(1) selecting a goosegrass seed group sample to be detected and a sensitive goosegrass herb population, and extracting the genomic gDNA of the goosegrass seed group sample and the sensitive goosegrass herb population;
(2) designing dCAPs primers of the specific enzyme cutting site KpnI-HF according to the 175 th nucleotide of a target enzyme glutamine synthetase gene EiGS1-S in the glufosinate-prevention goosegrass flora from A to G in a mutation mode, and amplifying nucleic acid fragments of about 200bp in front of and behind the mutation site;
(3) carrying out PCR amplification by using the dCAPs primer to obtain a PCR amplification product;
(4) the PCR product is cut by endonuclease Kpn I-HF;
(5) separating the enzyme digestion PCR product through agarose gel electrophoresis, and identifying whether the sample to be detected is the goosegrass herb population with the A-G mutation-resistant glufosinate-ammonium mutation site at the 175 th position according to the electrophoresis result; if the EiGS1 gene nucleic acid sequence in the Eleusines indica population sample to be detected generates A-G mutation at the 175 th position, a part of fragment can be cut off by Kpn I-HF, compared with the EiGS1 fragment which does not generate mutation, the fragment can run faster during electrophoresis, and the electrophoresis position is below the fragment which is not cut off by enzyme, so that the aim of rapid identification is fulfilled.
The method is based on molecular biology detection, and is simple, convenient, rapid, time-saving, labor-saving, high in sensitivity and high in accuracy.
In the detection method of the anti-glufosinate-goosegrass population based on gene mutation, the following steps are carried out:
preferably, the PCR reaction system in step (2) is as follows: 2 XPCR Buffer 12.5. mu.L, 10. mu.M dCaps-GS1-F (10. mu.M) and dCaps-GS1-R (10. mu.M) primers 1. mu.L each, Eleusine indica gDNA 2. mu.L (ca. 100ng), 8.5. mu.L of sterile distilled water was added to the reaction system to make 25. mu.L.
Preferably, the PCR procedure in step (2) is as follows: at 95 deg.C for 4min, at 94 deg.C for 30s, at 58 deg.C for 30s, at 72 deg.C for 30s for 40 cycles, at last at 72 deg.C for 7min, and storing at 4 deg.C for a short time, or storing at-20 deg.C if long-term.
Preferably, the reaction system for KpnI-HF cleavage in step (3) is as follows: 10 XNEB. Custmer Buffer 3. mu.L, KpnI-HF 1. mu.L, PCR amplification product 15. mu.L, ddH in step (3)2O11. mu.L, total volume 30. mu.L.
Preferably, the agarose gel electrophoresis in step (4) is 2% agarose gel by mass.
The last object of the present invention can be achieved by the following technical solutions: the application of the primer in preparing a kit or a biological agent for detecting the anti-glufosinate-goosegrass population.
The molecular biological method for rapidly detecting the anti-glufosinate-nigella population provided by the invention has the characteristics of high sensitivity, strong specificity and the like, and compared with the traditional technology, the molecular biological method has the beneficial results that:
(1) the method is simple and easy to implement: the detection method is used for testing through a molecular biology technical means, traditional detection steps such as culture materials, medicament screening and resistance index determination are not needed, the leaves of a population to be detected can be directly obtained, amplified bands after enzyme digestion are compared by the method, and rapid identification is carried out;
(2) the detection is efficient: compared with the traditional medicament screening of the resistant eleusine indica population, the method does not need the tedious processes of culturing materials, spraying pesticides, weighing dry weight or wet weight, calculating resistance index and the like, greatly shortens the detection time, and can complete the detection in 1 day in the whole process;
(3) the sensitivity is high: the method can detect the A-175-G mutation of the glufosinate-ammonium target enzyme glutamine synthetase gene in the goosegrass seed group;
(4) the accuracy is high: the mutation sites detected by the detection method are obviously different in sensitive and resistant goosegrass herb flora genes, and the detection accuracy is high;
(5) the specificity is strong: the enzyme has specificity, one enzyme can only recognize one specific deoxynucleotide sequence, and the endonuclease designed according to the mutation site can directionally cut the corresponding DNA segment;
(6) the invention firstly uses molecular biology technology to detect the anti-glufosinate-nigella population molecules at home and abroad, and the method is quick, simple and convenient, has strong operability, and has important practical significance for guiding farmers to correctly and scientifically use the medicine, reducing cost and reducing environmental pollution.
Drawings
FIG. 1 shows the results of aligning the mutation sites of EiGS1-S sequence (SEQ ID NO: 3) in 3 glufosinate-sensitive goosegrass populations (S1, S2, and S3) and EiGS1-R sequence (SEQ ID NO: 4) in 1 glufosinate-resistant goosegrass population (R1) in example 1. (A) The results of sequence alignment near the mutation sites of the nucleic acid sequences of EiGS1-S and EiGS 1-R; (B) partial sequencing peak plots for EiGS1-S and EiGS1-R (mutation sites are boxed); (C) the alignment result of the protein sequences of EiGS1-S and EiGS 1-R;
FIG. 2 is the result of electrophoretic analysis for detecting the mutation of the GS1 gene A-175-G in the anti-glufosinate-ox grass population and the glufosinate-sensitive-type-ox grass population in example 3;
FIG. 3 shows the results of the electrophoretic analysis of the mutations in the genes A-175-G of 3 anti-glufosinate-grass populations and 3 glufosinate-sensitive-type-goosegrass populations GS1 in example 4.
Detailed Description
The method of the present invention is further illustrated by the following examples. The following examples and drawings are illustrative only and are not to be construed as limiting the invention. Unless otherwise specified, the reagent raw materials used in the following examples are raw reagent raw materials which are conventionally commercially available or commercially available, and the laboratory instruments used are laboratory conventional instruments, and unless otherwise specified, the methods and apparatuses used in the following examples are those conventionally used in the art.
Example 1
The steps of cloning the glufosinate-ammonium resistant and sensitive type eleusine indica glutamine synthetase genes EiGS1-R and EiGS1-S and finding the mutation characteristics of the EiGS1-R gene A-175-G are as follows:
(1.1) extracting RNA from goosegrass herb, namely taking 3 glufosinate-sensitive goosegrass herb populations (before 10 years, collected and propagated in a farmland which has never been applied with glufosinate and then stored in a laboratory, and issuing to the public for verification tests) and 1 glufosinate-resistant goosegrass herb population (collected and screened from a farmland which is applied with glufosinate for a long time, stored in the laboratory, and issued to the public for verification tests) (3 plants are taken from each glufosinate-sensitive goosegrass herb material, 9 plants are totally taken from each glufosinate-sensitive goosegrass herb population material, 6 plants are taken from the goosegrass herb population material), respectively extracting RNA, and extracting steps such as that an EASYspin Plus plant RNA rapid extraction kit (Beijing Edela Biotech Co., Ltd.) is adopted;
(1.2) respectively taking 2 mu g of RNA to carry out reverse transcription to form cDNA, wherein the reaction system comprises the following steps: total RNA12 μ L, 4 XgDNA Eraser Mix 1 μ L, adding deionized sterile water to make up to 16 μ L Total volume, incubating at 37 deg.C for 5min, adding 4 μ L5 XTRUE RT Master Mix II, incubating at 42 deg.C for 20min, heating at 85 deg.C for 5min, and storing at 4 deg.C for use.
(1.3) the eleusine indica glutamine synthetase gene GS1 is amplified, GS1-F (shown in SEQ ID NO: 5) and GS1-R primers (shown in SEQ ID NO: 6) are adopted to clone glutamine synthetase genes EiGS1-R and EiGS1-S nucleic acid fragments from glufosinate-resistant and sensitive eleusine indica cDNA respectively, PCR products are sent to a sequencing company for sequencing to obtain corresponding nucleotide sequences which are respectively shown as GS1-R SEQ ID NO: 4(EiGS1-R) and SEQ ID NO: 3(EiGS 1-S).
(1.4) Using the MegAlign program of DNAStar software, the sequence differences between EiGS1-R and EiGS1-S were compared to obtain the mutation sites.
As shown in FIG. 1, compared with the nucleotide sequence (cDNA) of the glutamine synthetase gene EiGS1-S in sensitive type eleusine indica, the 175 th base of the nucleotide sequence (cDNA) of the glufosinate-target enzyme glutamine synthetase EiGS1-R gene in the glufosinate-resistant eleusine indica group is mutated from A to G (A-175-G), so that the 59 th amino acid of the encoded protein is mutated from Ser to Gly (the 59 th base is mutated from Ser to Gly), the amino acid sequence of the glufosinate-target enzyme glutamine synthetase GS in the glufosinate-resistant eleusine indica group before mutation is shown in SEQ ID NO: 1, and the amino acid sequence after mutation is shown in SEQ ID NO: 2).
The specific base sequence of the primer in (1.3) is as follows:
GS 1-F: ATGGCCTCCCTCACCGACCTCA (shown in SEQ ID NO: 5).
GS 1-R: TCAAGGCTTCCAGATGATGGTG (shown in SEQ ID NO: 6).
The PCR reaction system in step (1.3) is as follows: 2 XPCR Buffer 12.5. mu.L, 10. mu.M of each of the GS1-F (10. mu.M) and GS1-R (10. mu.M) primers 1. mu.L, Eleusine indica cDNA 2. mu.L (about 100ng), 8.5. mu.L of sterile distilled water was added to the reaction system to make 25. mu.L.
The PCR procedure in step (1.3) was as follows: carrying out 40 cycles at 95 deg.C for 4min, 94 deg.C for 30s, 57 deg.C for 30s, and 72 deg.C for 7min, and storing at 4 deg.C for a short time, or storing at-20 deg.C for a long time.
And (3) performing electrophoresis on the PCR product in the step (1.3) by using 0.8% agarose, cutting the agarose and recovering the agarose, wherein the recovery method refers to the gel purification and recovery kit (Beijing Edrley Biotech Co., Ltd.).
Example 2
Design of dCAPs primer for detecting mutation site of gene of A-175-G of anti-glufosinate-goosegrass population, which comprises the following steps:
(2.1) taking leaves of glufosinate-ammonium resistant and sensitive goosegrass herb, and respectively obtaining glufosinate-ammonium resistant and sensitive goosegrass herb genome DNA (gDNA) by adopting a CTAB plant genome extraction method;
(2.2) adopting an upstream primer GS1-F (shown in SEQ ID NO: 5) and a downstream primer GS1-R (shown in SEQ ID NO: 6), taking eleusine indica gDNA as a template, and cloning genome sequences of EiGS1-R and EiGS1-S genes (shown in SEQ ID NO: 2 and SEQ ID NO: 1 respectively); the PCR reaction system is as follows: 2 XPCR Buffer 12.5. mu.L, 10. mu.M of each of the GS1-F (10. mu.M) and GS1-R (10. mu.M) primers 1. mu.L, Eleusine indica gDNA 2. mu.L (about 100ng), and 8.5. mu.L of sterile distilled water was added to the reaction system to make the reaction system 25. mu.L.
The PCR procedure was as follows: at 95 deg.C for 4min, at 94 deg.C for 30s, at 58 deg.C for 30s, at 72 deg.C for 30s for 40 cycles, at last at 72 deg.C for 7min, and storing at 4 deg.C for a short time, or storing at-20 deg.C if long-term.
(2.3) sequencing to obtain the complete sequences of the genes gEiGS1-R and gEiGS1-S (shown as SEQ ID NO: 4 and SEQ ID NO: 3 respectively), and completing the sequencing by a sequencing company;
(2.4) designing primers at a position of about 200bp near the mutation site of A-175-G according to the gene sequences of gEiGS1-R and gEiGS1-S, wherein the primers comprise an upstream primer dCaps-GS1-F and a downstream primer dCaps-GS1-R, and the base sequence of the upstream primer dCaps-GS1-F is shown as SEQ ID NO: 7, the base sequence of the downstream primer dCaps-GS1-R is shown as SEQ ID NO: shown in fig. 8.
Specifically, the base sequence of the primer is as follows:
dCaps-GS1-F：GTCATCCACTGAGCTGTTATTTGGC(SEQ ID NO：7)。
dCaps-GS1-R：TCCTCGCCGGGAGCTTGGCCGGTAC(SEQ ID NO：8)。
example 3
The detection method for the anti-glufosinate-goosegrass population provided by the embodiment comprises the following steps:
(3.1) extracting genome DNA (gDNA) of leaves of glufosinate-ammonium sensitive type and anti-type goosegrass (10 samples of each) are extracted;
(3.2) PCR amplification was carried out using the primers dCaps-GS1-F and dCaps-GS1-R designed in example 2, with gDNA of (3.1); PCR reaction system and conditions thereof: 2 XPCR Buffer 12.5. mu.L, 10. mu.M dCaps-GS1-F (10. mu.M) and dCaps-GS1-R (10. mu.M) primers 1. mu.L each, Eleusine indica gDNA 2. mu.L (about 100ng), 8.5. mu.L sterile distilled water was added to the reaction system to 25. mu.L.
The PCR procedure was as follows: at 95 deg.C for 4min, at 94 deg.C for 30s, at 58 deg.C for 30s, at 72 deg.C for 30s for 40 cycles, at last at 72 deg.C for 7min, and storing at 4 deg.C for a short time, or storing at-20 deg.C if long-term.
(3.3) mixing (3.2)The PCR product is subjected to enzyme digestion, and the reaction system during the enzyme digestion of Kpn I-HF is as follows: 10 XNEB. Custmer Buffer 3. mu.L, KpnI-HF 1. mu.L, PCR amplification product 15. mu.L, ddH in step (3)2O11 μ L, total volume 30 μ L.
And (3.4) the agarose gel electrophoresis is 2% agarose gel by mass.
Electrophoresis conditions: buffer 1 × TAE, voltage 120V, time 1.5 h.
(3.5) identifying whether the sample to be detected is the goosegrass herb population with the A-175-G mutant-resistant glufosinate-ammonium mutant site according to the electrophoresis result; if the nucleic acid sequence of the GS gene in the goosegrass herb population has A-175-G mutation, a part of the fragment is cut off by Kpn I-HF, and compared with the GS fragment without mutation, the fragment runs faster during electrophoresis, and the electrophoresis position is below the fragment which is not cut off by enzyme (can also be described as the front part, and is below the fragment because of the swinging direction of an electrophoretogram in FIG. 2), so that the aim of quick identification is fulfilled.
The results in FIG. 2 show that the amplified bands of the 10 glufosinate-resistant goosegrass gDNA samples were all positioned below the bands of the sensitive goosegrass seed group after the enzyme digestion.
Therefore, the method can be used for detecting whether the test goosegrass colony sample is the mutant type glufosinate-ammonium-resistant goosegrass colony of the target gene A-175-G.
Example 4
The primers in the example 2 and the PCR reaction system in the example 3 are prepared into a kit, and the method in the example 3 is adopted to detect whether an unknown goosegrass sample has the site mutation of the glufosinate-resistant goosegrass flora.
gDNA was extracted from 8 Eleusine indica species collected in the Guangdong area and having been identified in resistance level by indoor bioassay (6 susceptible species and 2 resistant species, each of which was extracted by mixing leaves of 6 plants into one sample), and the 175-bit nucleic acid sequence characteristic of the GS1 gene was identified by the method of example 3. The detection shows that (as shown in fig. 3), the electrophoresis bands of 8 samples are single bands, the enzyme digestion product band in the glufosinate-ammonium resistant sample is below the enzyme digestion product band of the sensitive sample, namely 36 sensitive goosegrass plants in 6 glufosinate-ammonium sensitive populations have no A-175-G mutation, 12 goosegrass plants in 2 glufosinate-ammonium resistant goosegrass populations have A-175-G mutation, and the genotype is completely consistent with the phenotype.
Therefore, the primers, the detection method, the kit, the biological agent and the like designed in the invention can accurately and quickly detect the glufosinate-resistant goosegrass population, provide a simple, convenient, quick and low-cost detection technology for scientific research and production practice, and also provide theoretical basis and technical guidance for early warning, popular monitoring and reasonable medication of the resistant weeds.
Sequence listing
<110> institute for plant protection of academy of agricultural sciences of Guangdong province
<120> mutation site, primer and detection method of anti-glufosinate-goosegrass population and application
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1071
<212> DNA
<213> target enzyme Glutamine synthetase (Glutamine Synthesis)
<400> 1
atggcctccc tcaccgacct catcaacctc gacctctccg actccaccga gaagatcatc 60
gccgagtaca tatggatcgg tggatctggc atggacctca ggagcaaggc gaggaccctc 120
cccggcccgg tgagcgatcc cagcaagctg cccaagtgga actacgacgg ctccagcacc 180
ggccaagctc ccggcgagga cagtgaggtc atcctatacc cacaggccat cttcaaggac 240
cctttcagga agggcaacaa catccttgtc atgtgcgatt gctacacccc agctggcgag 300
ccaattccca ccaacaagag ggccaacgct gccaagatct tcagcaaccc tgaggtttct 360
gctgaggagc cctggtacgg tattgaacag gaatacaccc tcctgcagaa ggacaccaac 420
tggcctcttg ggtggcctct tggtggcttc cctggtccac agggtcccta ctactgcggt 480
gttggcgctg acaagtcatt cgggcgtgac attgttgact cccactacaa ggcttgcctg 540
tatgccggaa tcaacatcag tggcatcaat ggtgaagtca tgccaggaca gtgggagttc 600
caagtcggcc ctgctgttgg aatttctgct ggtgaccagg tgtgggttgc tcgctacatt 660
cttgagagga tcactgagat cgccggtgtc gtggtgacat tcgaccccaa gcctatccct 720
ggtgactgga acggtgccgg tgctcactca aactacagca ccaagtccat gaggaacgac 780
ggcggctacg aggtgatcaa gtccgcgatc gagaagctca aactgaggca ccgggagcac 840
atcgccgcct acggtgaggg caacgagcgc cggctcaccg gcaagcacga gaccgctgac 900
atcaacacct tcagctgggg cgtggcaaac cgtggcgcgt ctgtgcgtgt gggtcgcgag 960
acggagcaga acggcaaggg ctacttcgaa gaccgccggc cggcgtccaa catggacccc 1020
tacgtggtga cctccatgat cgccgagacc accatcatct ggaagccttg a 1071
<210> 2
<211> 1071
<212> DNA
<213> target enzyme Glutamine synthetase (Glutamine Synthesis)
<400> 2
atggcctccc tcaccgacct catcaacctc gacctctccg actccaccga gaagatcatc 60
gccgagtaca tatggatcgg tggatctggc atggacctca ggagcaaggc gaggaccctc 120
cccggcccgg tgagcgatcc cagcaagctg cccaagtgga actacgacgg ctccggcacc 180
ggccaagctc ccggcgagga cagtgaggtc atcctatacc cacaggccat cttcaaggac 240
ccattcagga agggcaacaa catccttgtc atgtgcgatt gctacacccc agctggcgag 300
ccaattccca ccaacaagag ggccaacgct gccaagatct tcagcaaccc tgaggtttct 360
gctgaggagc cctggtacgg tattgaacag gaatacaccc tcctgcagaa ggacaccaac 420
tggcctcttg ggtggcctct tggtggcttc cctggtccac agggtcccta ctactgcggt 480
gttggcgctg acaagtcatt cgggcgtgac attgttgact cccactacaa ggcttgcctg 540
tatgccggaa tcaacatcag tggcatcaat ggtgaagtca tgccaggaca gtgggagttc 600
caagtcggcc ctgctgttgg aatttctgct ggtgaccagg tgtgggttgc tcgctacatt 660
cttgagagga tcactgagat cgccggtgtc gtggtgacat tcgaccccaa gcctatccct 720
ggtgactgga acggtgccgg tgctcactca aactacagca ccaagtccat gaggaacgac 780
ggcggctacg aggtgatcaa gtccgcgatc gagaagctca aactgaggca ccgggagcac 840
atcgccgcct acggtgaggg caacgagcgc cggctcaccg gcaagcacga gaccgctgac 900
atcaacacct tcagctgggg cgtggcaaac cgtggcgcgt ctgtgcgtgt gggtcgcgag 960
acggagcaga acggcaaggg ctacttcgaa gaccgccggc cggcgtccaa catggacccc 1020
tacgtggtga cctccatgat cgccgagacc accatcatct ggaagccttg a 1071
<210> 3
<211> 3343
<212> DNA
<213> target enzyme Glutamine synthetase (Glutamine Synthesis)
<400> 3
tgccatggcc tccctcaccg acctcatcaa cctcgacctc tccgactcca ccgagaagat 60
catcgccgag tacatatggt acgtcttacg gcggcgttgc cttgttgatc cctctgcgcg 120
ttacgcttgt tttttttttc cctcgtcaat ctggaattca ggatcgatct tgctgggngc 180
tggactgctg gtcgcctttt catggcgttt ccccatgcga aaactggttc tttccggtag 240
tattgaggaa aggcaagatc ttttgggggt ttagngggtt tttgggngcg agtaacatgg 300
attggtgcan atttcagtct tgttcgccgg ctcaagcagg ggnggggttt gttttccctg 360
gttttcagcc gctctgtttt gtttccgatc atccgtttgt ccgtcgccaa gtaaaaaatc 420
tgttattctt gcacatgaat atcggctcag ttttggatat gcttcaagtg agacgganag 480
atgcgaattc tagtactatg gttgtacggt tttgtttgtc ctgttgggga gatctctgaa 540
gtggcctcct ctgcttgcca cctggnccct cacctcaccg cacatattgt gtttattatg 600
tgtatcacga gccacacggn cagatgatct gtctgtggac gcttttactc attgattcat 660
tcactctgat gccgtattat tacagtaaaa tacatgtttc atcttaagca cggtttagat 720
tgctctgttc cgcanaacat gaatggtgag aagctggtta ctttgttgtg aaattttata 780
ttaatgcatg gccttttccc gttacaggat cggtggatct ggcatggacc tcaggagcaa 840
ggcgagggta agcctttatt cccagcacta ggaccccatg atcctgtttg tcatgcatga 900
ctcacttatc acttatatcc gtgaagtcat ccactgagct gttatttggc ttatatatca 960
gagaactcac tactactagg aattaatact cttttctttt ttgataaata atcgtattta 1020
ttgatctggt tgttgcagac cctccccggc ccggtgagcg atcccagcaa gctgcccaag 1080
tggaactacg acggctccag caccggccaa gctcccggcg aggacagtga ggtcatccta 1140
tagtaagtgc aatggcagga taagctttct aagatcagat tttttttttg ttttatttgt 1200
gtacatgtaa taattcgttt tccttgccat gtgacatcct gcagcccaca ggccatcttc 1260
aaggacccat tcaggaaggg caacaacatc cttgtaagtg aacaccccaa ccatccaagt 1320
gatgtggacc acactctatc tttccttcca aatattgctt tagttcaccg atctgactga 1380
gacgaatgca tctatagaag ataaaataat ggtgtcttct cttcttagct atttgcagaa 1440
tctctgaatc ttcttataac agataaaaag aatgtatgtc ttatcttctt agcaaaacta 1500
cagttatgat acacccgtga aacactgaat ctctctctga ttggatgtta tgtcgacttt 1560
cactcgacat gtgagaactt agatactttt gttaattagg tgtgattgcc cgctgtacct 1620
aactatatag tctaggagtc caagcggtcg tttagtcccc ttctctaata ttagatagag 1680
atcactttca gacattcact gaatttgatt gacctgcagg tcatgtgtga ttgctacacc 1740
ccagctggcg agccaattcc caccaacaag agggccaacg ctgccaagat cttcagcaac 1800
cctgaggttt ctgctgagga gccctggtat gcaaatcgtc acaagataaa tcacgacgtc 1860
gaaactattt ttatgtcatc ggccctgact gttcttgtaa atggcaggta cggtattgaa 1920
caggaataca ccctcctgca gaaggacacc aactggcctc ttgggtggcc tcttggtggc 1980
ttccctggtc cacaggtaca taacatcatt aatttgattg attcagagaa atgcatcgtt 2040
gatttggtcc aatatgtgtt gaagtgtcac ctcacaaatc tccattgttt gtgtttaggg 2100
tccctactac tgcggtgttg gcgctgacaa gtcattcggg cgtgacattg ttgactccca 2160
ctacaaggct tgcctgtatg ccggaatcaa catcagtggc atcaatggtg aagtcatgcc 2220
aggacaggtg aaatacctct gcgttttatg ttcttgaaac ttcaattgta ccatcaaact 2280
actgtatttc tgaccatggg aaacattctg gttggtttca gtgggagttc caagtcggcc 2340
ctgctgttgg aatttctgct ggtgaccagg tgtgggttgc tcgctacatt cttgaggtat 2400
gcatgcaata ttttgaattc tacaaatgat cgtaaatagt agcaaaattt gcttgaatca 2460
agcacgcttt ttgtgcagcc tatgtgctaa tttgttcttg tgtccatacc ttgtaataac 2520
agaggatcac tgagatcgcc ggtgtcgtgg tgacattcga ccccaagcct atccctggcg 2580
actggaacgg tgccggtgct cactcaaact acagcaccaa gtccatgagg aacgacggcg 2640
gctacgaggt gatcaagtcc gcgatcgaga agctcaagct gaggcaccgg gagcacatcg 2700
ccgcctacgg tgagggcaac gagcgccggc tcaccggcaa gcacgagacc gctgacatca 2760
acaccttcag ctgggtacgt gtgcactgca atcttgatct gatcccctga tcctgcctcc 2820
aagttgtgtc ctgtaaactg acttctcttg tacagggcgt ggcaaaccgt ggcgcgtctg 2880
tgcgtgtggg tcgcgagacg gagcagaacg gcaagggcta cttcgaagac cgccggccgg 2940
cgtccaacat ggacccctac gtggtgacct ccatgatcgc cgagaccacc atcatctgga 3000
agccttgatc gcgtcccacc ctcaccagga tttggcgatt gcattgtgcc ccgggggaaa 3060
caattcgtct tctgattcac gcaaagcatc tcattgtctc ctgttcctgt cccatttggt 3120
tacactgcta ctattactac agcatttagt taggtctggg tatgttcatt tcacctcggg 3180
gtgagtgatg atcatggtgg caagtggtgt gaaggacaaa gacattgttg cttccttgcc 3240
gtccgtttgg gtggtcctgt gtaatccaat aatggccgta ccgtggtgtg gtactttttc 3300
agtacttctg ctcgtccatc tatttagtgg tgtgatttca atc 3343
<210> 4
<211> 3343
<212> DNA
<213> target enzyme Glutamine synthetase (Glutamine Synthesis)
<400> 4
tgccatggcc tccctcaccg acctcatcaa cctcgacctc tccgactcca ccgagaagat 60
catcgccgag tacatatggt acgtcttacg gcggcgttgc cttgttgatc cctctgcgcg 120
ttacgcttgt tttttttttc cctcgtcaat ctggaattca ggatcgatct tgctgggngc 180
tggactgctg gtcgcctttt catggcgttt ccccatgcga aaactggttc tttccggtag 240
tattgaggaa aggcaagatc ttttgggggt ttagngggtt tttgggngcg agtaacatgg 300
attggtgcan atttcagtct tgttcgccgg ctcaagcagg ggnggggttt gttttccctg 360
gttttcagcc gctctgtttt gtttccgatc atccgtttgt ccgtcgccaa gtaaaaaatc 420
tgttattctt gcacatgaat atcggctcag ttttggatat gcttcaagtg agacgganag 480
atgcgaattc tagtactatg gttgtacggt tttgtttgtc ctgttgggga gatctctgaa 540
gtggcctcct ctgcttgcca cctggnccct cacctcaccg cacatattgt gtttattatg 600
tgtatcacga gccacacggn cagatgatct gtctgtggac gcttttactc attgattcat 660
tcactctgat gccgtattat tacagtaaaa tacatgtttc atcttaagca cggtttagat 720
tgctctgttc cgcanaacat gaatggtgag aagctggtta ctttgttgtg aaattttata 780
ttaatgcatg gccttttccc gttacaggat cggtggatct ggcatggacc tcaggagcaa 840
ggcgagggta agcctttatt cccagcacta ggaccccatg atcctgtttg tcatgcatga 900
ctcacttatc acttatatcc gtgaagtcat ccactgagct gttatttggc ttatatatca 960
gagaactcac tactactagg aattaatact cttttctttt ttgataaata atcgtattta 1020
ttgatctggt tgttgcagac cctccccggc ccggtgagcg atcccagcaa gctgcccaag 1080
tggaactacg acggctccgg caccggccaa gctcccggcg aggacagtga ggtcatccta 1140
tagtaagtgc aatggcagga taagctttct aagatcagat tttttttttg ttttatttgt 1200
gtacatgtaa taattcgttt tccttgccat gtgacatcct gcagcccaca ggccatcttc 1260
aaggacccat tcaggaaggg caacaacatc cttgtaagtg aacaccccaa ccatccaagt 1320
gatgtggacc acactctatc tttccttcca aatattgctt tagttcaccg atctgactga 1380
gacgaatgca tctatagaag ataaaataat ggtgtcttct cttcttagct atttgcagaa 1440
tctctgaatc ttcttataac agataaaaag aatgtatgtc ttatcttctt agcaaaacta 1500
cagttatgat acacccgtga aacactgaat ctctctctga ttggatgtta tgtcgacttt 1560
cactcgacat gtgagaactt agatactttt gttaattagg tgtgattgcc cgctgtacct 1620
aactatatag tctaggagtc caagcggtcg tttagtcccc ttctctaata ttagatagag 1680
atcactttca gacattcact gaatttgatt gacctgcagg tcatgtgtga ttgctacacc 1740
ccagctggcg agccaattcc caccaacaag agggccaacg ctgccaagat cttcagcaac 1800
cctgaggttt ctgctgagga gccctggtat gcaaatcgtc acaagataaa tcacgacgtc 1860
gaaactattt ttatgtcatc ggccctgact gttcttgtaa atggcaggta cggtattgaa 1920
caggaataca ccctcctgca gaaggacacc aactggcctc ttgggtggcc tcttggtggc 1980
ttccctggtc cacaggtaca taacatcatt aatttgattg attcagagaa atgcatcgtt 2040
gatttggtcc aatatgtgtt gaagtgtcac ctcacaaatc tccattgttt gtgtttaggg 2100
tccctactac tgcggtgttg gcgctgacaa gtcattcggg cgtgacattg ttgactccca 2160
ctacaaggct tgcctgtatg ccggaatcaa catcagtggc atcaatggtg aagtcatgcc 2220
aggacaggtg aaatacctct gcgttttatg ttcttgaaac ttcaattgta ccatcaaact 2280
actgtatttc tgaccatggg aaacattctg gttggtttca gtgggagttc caagtcggcc 2340
ctgctgttgg aatttctgct ggtgaccagg tgtgggttgc tcgctacatt cttgaggtat 2400
gcatgcaata ttttgaattc tacaaatgat cgtaaatagt agcaaaattt gcttgaatca 2460
agcacgcttt ttgtgcagcc tatgtgctaa tttgttcttg tgtccatacc ttgtaataac 2520
agaggatcac tgagatcgcc ggtgtcgtgg tgacattcga ccccaagcct atccctggcg 2580
actggaacgg tgccggtgct cactcaaact acagcaccaa gtccatgagg aacgacggcg 2640
gctacgaggt gatcaagtcc gcgatcgaga agctcaagct gaggcaccgg gagcacatcg 2700
ccgcctacgg tgagggcaac gagcgccggc tcaccggcaa gcacgagacc gctgacatca 2760
acaccttcag ctgggtacgt gtgcactgca atcttgatct gatcccctga tcctgcctcc 2820
aagttgtgtc ctgtaaactg acttctcttg tacagggcgt ggcaaaccgt ggcgcgtctg 2880
tgcgtgtggg tcgcgagacg gagcagaacg gcaagggcta cttcgaagac cgccggccgg 2940
cgtccaacat ggacccctac gtggtgacct ccatgatcgc cgagaccacc atcatctgga 3000
agccttgatc gcgtcccacc ctcaccagga tttggcgatt gcattgtgcc ccgggggaaa 3060
caattcgtct tctgattcac gcaaagcatc tcattgtctc ctgttcctgt cccatttggt 3120
tacactgcta ctattactac agcatttagt taggtctggg tatgttcatt tcacctcggg 3180
gtgagtgatg atcatggtgg caagtggtgt gaaggacaaa gacattgttg cttccttgcc 3240
gtccgtttgg gtggtcctgt gtaatccaat aatggccgta ccgtggtgtg gtactttttc 3300
agtacttctg ctcgtccatc tatttagtgg tgtgatttca atc 3343
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atggcctccc tcaccgacct ca 22
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tcaaggcttc cagatgatgg tg 22
<210> 7
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gtcatccact gagctgttat ttggc 25
<210> 8
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tcctcgccgg gagcttggcc ggtac 25
Claims (7)
1. A dCAPs primer for detecting mutation sites of a glufosinate-resistant goosegrass population is characterized by comprising the following components in parts by weight: the primer comprises an upstream primer dCaps-GS1-F and a downstream primer dCaps-GS1-R, wherein the base sequence of the upstream primer dCaps-GS1-F is shown as SEQ ID NO: 7, the base sequence of the downstream primer dCaps-GS1-R is shown as SEQ ID NO: 8, the mutation site is located in a target enzyme glutamine synthetase gene EiGS1-S cloned from glufosinate-ammonium sensitive type goosegrass, and the mutation site is shown as SEQ ID NO: 1, the mutation at position 175 of the nucleotide sequence shown in 1 is a-G.
2. A detection method of a glufosinate-resistant goosegrass herb population is characterized by comprising the following steps:
(1) selecting a goosegrass seed group sample to be detected and a glufosinate-sensitive goosegrass seed group, and extracting the genomic gDNA of the goosegrass seed group sample;
(2) designing a dCAPs primer according to the fact that the 175 th nucleotide of a target enzyme glutamine synthetase gene EiGS1-S in the grass-ammonium-resisting goosegrass flora is mutated from A to G, and the dCAPs primer is used for amplifying a nucleic acid fragment of about 200bp before and after a mutation site;
(3) carrying out PCR amplification by using the dCAPs primer to obtain a PCR amplification product;
(4) the PCR product is cut by endonuclease Kpn I-HF;
(5) separating the enzyme digestion PCR product through agarose gel electrophoresis, and identifying whether the sample to be detected is the goosegrass herb population with the A-G mutation-resistant glufosinate-ammonium mutation site at the 175 th position according to the electrophoresis result; if the EiGS1 gene nucleic acid sequence in the Eleusines indica population sample to be detected generates A-G mutation at the 175 th position, a part of fragment can be cut off by Kpn I-HF, compared with the EiGS1 fragment which does not generate mutation, the fragment can run faster during electrophoresis, and the electrophoresis position is below the fragment which is not cut off by enzyme, so that the aim of rapid identification is fulfilled.
3. The method for detecting the anti-glufosinate-goosegrass population according to claim 2, characterized by: the PCR reaction system in the step (3) is as follows: 2 XPCR Buffer 12.5. mu.L, 10. mu.M dCaps-GS1-F and dCaps-GS1-R primers 1. mu.L each, and Eleusine indica gDNA 2. mu.L, 8.5. mu.L sterile distilled water was added to the reaction system to 25. mu.L.
4. The method for detecting the anti-glufosinate-goosegrass population according to claim 2, characterized by: the PCR procedure in step (3) was as follows: at 95 ℃ for 4min, at 94 ℃ for 30s, at 58 ℃ for 30s, at 72 ℃ for 30s for 40 cycles, and finally at 72 ℃ for 7 min.
5. The method for detecting the anti-glufosinate-goosegrass population according to claim 2, characterized by: in the step (4), the reaction system during the Kpn I-HF enzyme digestion is as follows: 10 XNEB. Custmer Buffer 3. mu.L, KpnI-HF 1. mu.L, PCR amplification product 15. mu.L, ddH2O11. mu.L, total volume 30. mu.L.
6. The method for detecting the anti-glufosinate-goosegrass population according to claim 2, characterized by: and (5) performing agarose gel electrophoresis on the agarose gel with the mass percentage of 2%.
7. Use of the primers of claim 1 for the preparation of a biological agent for detecting a population of goosegrass herb resistant to glufosinate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010064000.3A CN111118195B (en) | 2020-01-20 | 2020-01-20 | Mutation site of anti-glufosinate-bulleyhead grass population, primer, detection method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010064000.3A CN111118195B (en) | 2020-01-20 | 2020-01-20 | Mutation site of anti-glufosinate-bulleyhead grass population, primer, detection method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111118195A CN111118195A (en) | 2020-05-08 |
| CN111118195B true CN111118195B (en) | 2021-05-25 |
Family
ID=70491424
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010064000.3A Active CN111118195B (en) | 2020-01-20 | 2020-01-20 | Mutation site of anti-glufosinate-bulleyhead grass population, primer, detection method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111118195B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114280306B (en) * | 2021-05-27 | 2023-05-05 | 中国农业科学院植物保护研究所 | ELISA detection kit and detection method for eleusine indica EPSPS protein |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012024524A1 (en) * | 2010-08-18 | 2012-02-23 | Monsanto Technology Llc | Early applications of encapsulated acetamides for reduced injury in crops |
| CN103757033A (en) * | 2013-12-25 | 2014-04-30 | 上海市农业科学院 | Rice glutamine synthetase mutant gene capable of improving resistance of plant glufosinate, and preparation method and applications thereof |
| CN106498088A (en) * | 2016-12-30 | 2017-03-15 | 中国环境科学研究院 | Based on CAPs molecular markers and its application that SNP site identifies rough fruit Herba Amaranthi tricoloriss |
| CN109402234A (en) * | 2018-11-23 | 2019-03-01 | 杭州艾迪康医学检验中心有限公司 | Detect the primer and method of DMD A827T, 6436 insC site mutation of DMD A5741T and DMD |
| CN110229794A (en) * | 2019-07-01 | 2019-09-13 | 四川天豫兴禾生物科技有限公司 | Glutamine synthelase mutant and its application and breeding method with glufosinate resistance |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2971185A4 (en) * | 2013-03-13 | 2017-03-08 | Monsanto Technology LLC | Methods and compositions for weed control |
-
2020
- 2020-01-20 CN CN202010064000.3A patent/CN111118195B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012024524A1 (en) * | 2010-08-18 | 2012-02-23 | Monsanto Technology Llc | Early applications of encapsulated acetamides for reduced injury in crops |
| CN103757033A (en) * | 2013-12-25 | 2014-04-30 | 上海市农业科学院 | Rice glutamine synthetase mutant gene capable of improving resistance of plant glufosinate, and preparation method and applications thereof |
| CN106498088A (en) * | 2016-12-30 | 2017-03-15 | 中国环境科学研究院 | Based on CAPs molecular markers and its application that SNP site identifies rough fruit Herba Amaranthi tricoloriss |
| CN109402234A (en) * | 2018-11-23 | 2019-03-01 | 杭州艾迪康医学检验中心有限公司 | Detect the primer and method of DMD A827T, 6436 insC site mutation of DMD A5741T and DMD |
| CN110229794A (en) * | 2019-07-01 | 2019-09-13 | 四川天豫兴禾生物科技有限公司 | Glutamine synthelase mutant and its application and breeding method with glufosinate resistance |
Non-Patent Citations (3)
| Title |
|---|
| "Alterations in the 5 ’untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica";Chun Zhang等;《Pest Manag Sci》;20181130;第74卷(第11期);第2561-2568页 * |
| "Selection of relatively exact reference genes for gene expression studies in goosegrass (Eleusine indica) under herbicide stress";Jingchao Chen等;《Scientific Reports》;20170421(第7期);第1-9页 * |
| "牛筋草对草甘膦的抗药性研究";董慧荣;《中国优秀硕士学位论文全文数据库 农学科技辑》;20171215(第12期);D046-10 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111118195A (en) | 2020-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2014036946A1 (en) | Rice brown planthopper resistance gene bph9 and molecular markers, and uses thereof | |
| CN111235180B (en) | Method for shortening flowering phase of corn | |
| WO2019223563A1 (en) | Rice brown planthopper resistance gene bph30 and molecular marker closely linked thereto | |
| CN107988409B (en) | Specific CAPS marker for identifying wild type or mutant of rice salt-tolerant gene OsRR22, primer and application of primer | |
| CN109628466A (en) | A kind of alfalfa salt tolerance and drought resistance gene MsCKX and its application | |
| CN111118195B (en) | Mutation site of anti-glufosinate-bulleyhead grass population, primer, detection method and application | |
| CN112981000B (en) | InDel molecular marker related to cotton drought resistance and application thereof | |
| CN107326035B (en) | Deubiquitinating enzyme gene UBP5 for regulating rice grain shape and leaf color and application thereof | |
| CN109988771B (en) | Corn salt-resistant QTL and application thereof | |
| CN107574171A (en) | A kind of corn salt resistance main effect QTL and its related gene, molecular labeling and application | |
| CN113004382A (en) | Application of EmBP1 gene or protein thereof | |
| CN108864265A (en) | Application of the protein TabZIP60 in regulation plant root system development | |
| CN113943732A (en) | SNP (Single nucleotide polymorphism) marker related to heat resistance of cucumber in adult stage, primer group, kit and application | |
| CN107699630B (en) | Molecular marker linked with wheat disease-resistant gene Pm21 and application thereof in breeding | |
| CN107058303A (en) | A kind of functional label related to soybean phytic acid phosphorus use efficiency and its application | |
| CN108239639B (en) | Flanking sequence of exogenous insert of stress-tolerant transgenic soybean event WB1 and application thereof | |
| CN111748560B (en) | Application of rice OsNRT2.1 gene in improving manganese content in rice grains | |
| CN108690847B (en) | Application of protein nog1 in regulation and control of plant yield and grain number per ear | |
| Wang et al. | Growth adaptability and foreign gene stability of TaLEA transgenic Populus simonii× nigra | |
| CN114369604B (en) | Salt-resistant QTL gene of corn and application thereof | |
| CN113817748B (en) | Corn salt-resistant major QTL and application thereof | |
| CN109355270A (en) | A kind of rice kinases OSK1 and its application | |
| CN114438082B (en) | DNA sequence for rapidly identifying related ecology of flowering phase, spring and winter habit of wheat family and application | |
| CN112646013B (en) | Corn flowering phase gene and application thereof | |
| CN108504760A (en) | The QTL of the excellent salt tolerant resource of rice is excavated and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |