CN111118010A - Double-stranded RNA for silencing V-ATPA gene, expression vector and application thereof - Google Patents

Abstract

The invention provides a double-stranded RNA, wherein a sense strand nucleotide sequence of the double-stranded RNA is shown as SEQ ID NO.1 in a sequence table, and an antisense strand nucleotide sequence of the double-stranded RNA is shown as SEQ ID NO.2 in the sequence table. The invention also provides an RNAi inverted repeat sequence, a sense strand sequence and an antisense strand sequence of the double-stranded RNA, and a nucleotide sequence of the RNAi inverted repeat sequence is a sequence shown by SEQ ID NO.3 in a sequence table. The invention also provides an expression vector containing the double-stranded RNA or the RNAi inverted repeat sequence and application thereof. The double-stranded RNA, the RNAi inverted repeat sequence containing the sense strand sequence and the antisense strand sequence of the double-stranded RNA and the expression vector thereof can effectively silence the V-ATPA gene, can be used for biological control of Aedes mosquitoes, and have environment-friendly characteristics and higher commercial application value.

Description

Double-stranded RNA for silencing V-ATPA gene, expression vector and application thereof

Technical Field

The invention relates to double-stranded RNA, a recombinant vector and application thereof, in particular to double-stranded RNA for silencing a V-ATPA gene, an expression vector and application thereof.

Background

Aedes mosquitoes (Aedes) take a very important position in the mosquito-borne disease process. The infectious Aedes mosquitoes are mainly Aedes aegypti (Aedes aegypti) and Aedes albopictus (Aedes aegypti). Aedes mosquitoes belong to the phylum Arthropoda (Arthropoda), the class Insecta (Insecta), the order Diptera (Diptera), the family Culicineae (Culicinea), the genus Aedes (Aedes). The distribution range of the aedes is wide in China, and the aedes can be traced from Liaoning at 38 degrees north latitude to Hainan at 19 degrees north latitude. Wherein the Aedes aegypti mainly lives in areas with lower latitude, and is mainly distributed in the West Shuangbanna areas of Leizhou peninsula, Hainan province and Yunnan in Guangdong in China; the Aedes albopictus mainly lives in regions with higher latitudes, and is mainly distributed in Shanxi, Hebei, Shandong, Henan and the like in China. At present, the main epidemic mosquito-borne diseases in the world, the most serious diseases such as dengue fever, and the second emerging Zika virus, yellow fever, chikungunya disease and the like are all transmitted by aedes. Mosquitoes which can spread diseases in China also include anopheles, such as tiny anopheles, major anopheles, Chinese anopheles and anopheles addicted to people, which mainly spread malaria; culex tritaeniorhynchus mainly spreads epidemic encephalitis b. Statistically, about half of all people worldwide per year are infected with such mosquito-borne diseases. Since 2007, 128 countries and regions of asia, africa, america, and continental continent have been reported to have local transmission of dengue fever. The dengue fever in China mainly occurs in Guangdong, Yunnan, Guangxi, Fujian, Hainan and Taiwan areas. According to statistics of China center for disease prevention and control, the national cumulative dengue fever in 2013 is 4662, wherein the most serious dengue fever is in the Guangdong region, and 2895 dengue fever is recorded. Mosquito-borne diseases, typified by dengue fever, have become a public health concern of common concern worldwide. .

As no effective drug for treating dengue fever exists so far, no safe and effective vaccine for dengue fever prevention exists. Therefore, most countries adopt a method for controlling dengue fever transmission vectors to prevent dengue fever. In China, Aedes albopictus (Aedes albopictus) and Aedes aegypti (Aedes aegypti) are the main transmission vectors. At present, 2 kinds of mosquitoes are still mainly prevented and controlled by adopting the insecticide, so that the insecticide causes irreversible pollution to the environment, and meanwhile, the tolerance of the mosquitoes to chemical agents is continuously increased. Therefore, there is a strong need for an environmentally friendly technique for controlling aedes aegypti and aedes albopictus.

RNAi refers to a phenomenon in which silencing of the expression of a target gene is caused by intervention of double-stranded RNA. In the field of plant protection research, the plant-derived pesticide is widely used for silencing key genes related to physiology and biochemistry of agricultural pests so as to prevent and control the agricultural pests. The entire process of feeding to produce RNAi effects includes feeding, uptake of dsRNA from the midgut parietal cells into midgut cells (environmental RNAi effects) and diffuse transmission across the midgut to other tissues (systemic RNAi effects).

Microalgae is a collective concept, meaning unicellular organisms that can undergo photosynthesis. Mosquito larvae generally feed on smaller individual microalgae in the chlorophyta in the water. Such as Chlamydomonas, Chlorella, Scenedesmus, and Pandalus. V-ATPase is located in the superficial membranes of insect epithelial tissues, including the digestive tract, salivary glands, labial glands, sensory organs, and the middle intestine. V-ATPase plays an important role in nutrient absorption and maintenance of ion balance in the insect intestinal system. The V-atpase holoenzyme regulates pH in various intracellular compartments by hydrolyzing ATP molecules into ADP and phosphate and using the energy produced by hydrolysis to pump protons through the plasma membrane. The V-ATPase consists of two functional domains, V1 and V0. The V1 domain, located on the cytoplasmic side of the membrane, is composed of eight different subunits (a-H) responsible for ATP hydrolysis. The V0 domain is responsible for membrane binding, consists of five subunits (a-e), and plays a role in proton conduction. If the V-ATPA gene is silenced, the metabolism of the mosquito is affected, and then the mosquito is killed. However, there is no means for effectively inhibiting the expression of V-ATPA gene.

Disclosure of Invention

The invention aims to overcome the defects in the prior art, constructs the RNAi vector of the important gene V-ATPA for the growth regulation of Aedes mosquitoes, can be used for biological control of the Aedes mosquitoes, and has environment-friendly characteristic and higher commercial application value.

The first aspect of the invention provides a double-stranded RNA, which consists of a sense strand and an antisense strand, wherein the nucleotide sequence of the sense strand is shown as SEQ ID NO.1 in a sequence table, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.2 in the sequence table.

In a second aspect, the invention provides an RNAi inverted repeat sequence, which comprises a sense strand sequence and an antisense strand sequence of the double-stranded RNA described in the first aspect of the invention, wherein the nucleotide sequences are represented by SEQ ID NO.3 in the sequence table.

In a third aspect, the present invention provides an expression vector comprising an original vector and either a double-stranded RNA according to the first aspect of the present invention or an RNAi inverted repeat according to the second aspect of the present invention.

As the original vector, there can be used a vector commonly used in the field of gene recombination, such as a virus, a plasmid, etc. The invention is not limited in this regard. In one embodiment of the invention, the original vector is the pMaa7IR/XIR vector plasmid, but it is understood that other plasmids, viruses, or the like may be used.

Preferably, the original vector is pMaa7IR/XIR, and the RNAi inverted repeat of the second aspect of the invention is cloned into the Maa7IR/XIR vector by recombinant means.

In a fourth aspect, the invention provides the use of a double stranded RNA according to the first aspect of the invention, or an RNAi inverted repeat according to the second aspect of the invention, or an expression vector according to the third aspect of the invention for silencing a V-ATPA gene, wherein the V-ATPA gene is one of the following nucleotide sequences:

1) the V-ATPA gene of Aedes aegypti, a sequence shown as SEQ ID NO.4 in a sequence table;

2) DNA sequence with over 90% homology with Aedes aegypti V-ATPA gene and coding the same functional protein.

In a fifth aspect, the invention provides the use of a double stranded RNA according to the first aspect of the invention, or an RNAi inverted repeat according to the second aspect of the invention, or an expression vector according to the third aspect of the invention, in the preparation of an agent for controlling aedes mosquitoes.

The sixth aspect of the invention provides a transgenic microalgae prepared by transforming the expression vector of the third aspect of the invention into microalgae which is edible by mosquito larvae.

Preferably, the microalgae are chlamydomonas (e.g., chlamydomonas reinhardtii), chlorella (e.g., chlorella pyrenoidosa, chlorella vulgaris).

The seventh aspect of the invention provides the application of the transgenic microalgae of the sixth aspect of the invention in preparing an agent for controlling aedes.

The double-stranded RNA, the RNAi inverted repeat sequence containing the sense strand sequence and the antisense strand sequence of the double-stranded RNA and the expression vector thereof can effectively silence V-ATPA gene, can be used for biological control of Aedes mosquitoes, have environment-friendly characteristics and higher commercial application value, for example, in a specific implementation mode, the expression vector containing the RNAi inverted repeat sequence (containing the sense strand sequence and the antisense strand sequence of the double-stranded RNA of the invention) is transformed into Chlamydomonas nucifera genome to obtain an engineering strain, and the engineering strain is fed to Aedes mosquito larvae to effectively kill the Aedes mosquito larvae.

Drawings

FIG. 1 shows the result of restriction enzyme identification of the expression vector Maa7IR/V-ATPAIR EcoRI. 1: maa7IR/V-ATPAIR/EcoRI, M: DNA marker-D5000.

FIG. 2 shows the result of PCR amplification of Maa7IR/V-ATPAIR transgenic strain. 1-13: maa7IR/V-ATPAIR transgenic strain, M: DNA marker-D2000.

FIG. 3 is a tissue section of Aedes mosquito larvae fed with V-ATPARNAi transgenic strain.

FIG. 4 shows the survival rate of adult Aedes aegypti after 30 days of Chlamydomonas culture with Maa7IR/V-ATPAIR vector. Fodder: feeding with feed; CC 425: feeding non-transgenic chlamydomonas CC 425; aedes aegypti: transferring Maa7IR/V-ATPAIR carrier chlamydomonas to feed Aedes aegypti; aedes albopictus: the Aedes albopictus was bred by transferring Maa7IR/V-ATPAIR vector Chlamydomonas.

Detailed Description

The invention will be better understood by reference to the following examples. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. Marker was purchased from Dalibao Bio Inc. In the following examples,% is by mass unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Construction of V-ATPA RNAi expression vector of Aedes aegypti

(1) V-ATPA RNAi inverted repeat acquisition

An inverted repeat sequence (shown as SEQ ID NO. 3) of the V-ATPA gene fragment was artificially synthesized and cloned into a pUC57 vector, which was named pUC 57-V-ATPAIR. The inverted repeat (sequence shown in SEQ ID NO. 3) contains a multiple cloning site including EcoRI.

(2) Cloning of the inverted repeat sequence (sequence shown in SEQ ID NO. 3) into the Maa7IR/XIR vector by EcoRI cleavage

1) The pUC57-V-ATPAIR and Maa7IR/XIR vectors were digested with EcoRI, and after agarose gel electrophoresis, the correct band was selected and recovered. And connecting and transforming the Escherichia coli to obtain an expression vector Maa7 IR/V-ATPAIR. The EcoRI enzyme digestion is used for identifying Maa7IR/V-ATPAIR, a fragment with the size of about 814bp is obtained after EcoRI enzyme digestion, the size of the fragment is consistent with the predicted fragment size of 814bp, and the construction success of the Aedes V-ATPA RNAi expression vector Maa7IR/V-ATPAIR is shown (figure 1).

II, V-ATPA gene RNAi expression vector transformation Chlamydomonas reinhardtii

The constructed Maa7IR/V-ATPAIR expression vector is transformed into Chlamydomonas reinhardtii by glass bead method, and the transformed strain is uniformly spread on resistant solid TAP culture medium containing paromomycin and 5-fluoroindole for repeated screening. 121V-ATPA RNAi transgenic strains are obtained.

Extracting DNA from the Maa7IR/V-ATPAIR transgenic algae strain, carrying out PCR amplification on the DNA of the transgenic algae strain by taking the Maa7IR/XIR vector sequence as a primer, and identifying whether the transgenic algae strain has a carrier insert. PCR identified 65 positive strains among the 121V-ATPA RNAi-transformed algal strains (FIG. 2).

It should be noted that besides chlamydomonas reinhardtii in the present embodiment, other chlamydomonas, chlorella, etc. may be selected, and the present invention is illustrated by chlamydomonas reinhardtii, which is not limited herein. The same effects as Chlamydomonas reinhardtii can be achieved with other algae according to the description of the embodiments, and the present invention is not described herein again.

Third, the aedes detection of transgenic algae strain fed

(1) Larval mortality detection

Feeding larvae of Aedes molitor with feed, clear water, non-transgenic Chlamydomonas CC425, transgenic Maa7IR/XIR vector Chlamydomonas, and transgenic Maa7IR/V-ATPAIR vector Chlamydomonas respectively. When the aedes were fed with the vector Chlamydomonas Maa7IR/V-ATPAIR on day 12, the mortality rates of the transgenic strains AAVVAP 2-1 to AAVVAP 2-5 were 80%, 100%, 90%, 70%, 80%, respectively, compared to the feeds, clear water, non-transgenic Chlamydomonas CC425, and transgenic Chlamydomonas Maa7IR/XIR vector Chlamydomonas under the same feeding conditions. The mortality rate of the feed, the clear water and the non-transgenic algal strain CC425 was 0%. The mortality rate of the strain Maa7-2 fed with the transfer blank vector Maa7IR/XIR was 20%. The V-ATPA RNAi transgenic strain has a certain lethal effect on Aedes (Table 4).

TABLE 4 mortality of Aedes mosquitoes fed with Maa7IR/V-ATPAIR transgenic algal strain

VATPA-1

VATPA-2

VATPA-3

VATPA-4

VATPA-5

Feed stuff

Clean water

CC425

Maa7-2

Day 1

0％

0％

0％

0％

0％

0％

0％

0％

0％

Day 2

10％

10％

30％

30％

0％

0％

0％

0％

0％

Day 3

20％

10％

30％

30％

0％

0％

0％

0％

0％

Day 4

40％

10％

30％

40％

10％

0％

0％

0％

0％

Day 5

50％

80％

40％

40％

10％

0％

0％

0％

0％

Day 6

50％

90％

50％

40％

20％

0％

0％

0％

0％

Day 7

50％

90％

70％

50％

40％

0％

0％

0％

0％

Day 8

60％

90％

90％

60％

50％

0％

0％

0％

0％

Day 9

70％

90％

90％

60％

70％

0％

0％

0％

20％

Day 10

70％

90％

90％

70％

70％

0％

0％

0％

20％

Day 11

80％

100％

90％

70％

70％

0％

0％

0％

20％

Day 12

80％

100％

90％

70％

80％

0％

0％

0％

20％

(2) Tissue section analysis of larvae of Aedes aegypti fed Maa7IR/V-ATPAIR transgenic algae

In order to know whether the body surface or the in-vivo tissue of the aedes aegypti larvae has corresponding pathological changes after eating the transgenic algae strain containing V-ATPA RNAi, and further explain the reason of larva death, paraffin sections are carried out on the aedes aegypti larvae, and then the aedes aegypti larvae are observed and detected by an Olilpas microscope. The results show that the aedes larvae fed with the control chlamydomonas reinhardtii CC425 had intact epidermis, thick body wall muscles, uniform muscle distribution, clear lines, normal midgut tissue morphology, and intact gut lumen. The mosquito's intestinal wall is mainly composed of flat square monolayer epithelial cells or columnar monolayer epithelial cells, and the cells are arranged regularly (fig. 3A, 3B and 3C). The epidermal and body wall muscles of aedes larvae fed with the V-ATP RNAi transgenic algae strain are seriously damaged, the muscles are unevenly distributed, disorderly and some of the muscles are even dissolved and disappear. The midgut tissue was severely damaged, the intestinal lumen was enlarged, the cells were shriveled, some cells were vacuolated, cells were scattered and distributed, and disintegration occurred to various degrees (fig. 3D).

(3) Test in isolation room of transgenic engineering strain Maa7IR/V-ATPAIR fed by Aedes aegypti larvae

The aedes aegypti test scale was up to 300 eggs and fed for 30 days for biological observation statistics. The results showed that on day 7 of the larvae fed with the feed, pupae began to eclose into adults, and on day 30, 281 adult mosquitoes remained alive with a survival rate of 93.7%. The pupae of the larvae fed with the non-transgenic algal strain CC425 begin to eclose into adults on the 7 th day, 283 adult mosquitoes are remained to survive on the 30 th day, and the survival rate is 94.3 percent. The larvae fed with the Maa7IR/V-ATPAIR algal strain survived 72 adult mosquitoes at day 30, the survival rate was 24%, and the period was accompanied by uninterrupted death of the larvae and adults, and the insecticidal effect was obvious (figure 4).

The transgenic Maa7IR/V-ATPAIR strain was fed with Aedes albopictus. The results show that: 97 adult mosquitoes survived 30 days after feeding larvae of the Maa7 IR/V-ATPAR algal strain, and the survival rate is 32.3%. The results showed that the Maa7IR/V-ATPAIR transgenic strain was also highly lethal to Aedes albopictus (FIG. 4).

The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.

Sequence listing

<110> Hainan college of medicine

Institute of tropical biotechnology, institute of tropical agricultural sciences

<120> double-stranded RNA for silencing V-ATPA gene, expression vector and application thereof

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>290

<212>RNA

<213>Artificial

<400>1

cuacgagcgu gccggucgug ucaagugucu cgguaacccu gaacgugaag guucgguguc 60

caucgucggu gccguaucgc ccccuggugg ugauuucucc gaucccguca cauccgccac 120

ccuugguauc guacaggugu ucuggggucu ggacaagaaa cuggcccagc guaagcauuu 180

ccccucgauc aacugguuga ucuccuacag caaguacaug cgcgcccuug augacuucua 240

cgauaagaac uuccaggagu uugucccacu gcguaccaag guuaaggaga 290

<210>2

<211>290

<212>RNA

<213>Artificial

<400>2

ucuccuuaac cuugguacgc agugggacaa acuccuggaa guucuuaucg uagaagucau 60

caagggcgcg cauguacuug cuguaggaga ucaaccaguu gaucgagggg aaaugcuuac 120

gcugggccag uuucuugucc agaccccaga acaccuguac gauaccaagg guggcggaug 180

ugacgggauc ggagaaauca ccaccagggg gcgauacggc accgacgaug gacaccgaac 240

cuucacguuc aggguuaccg agacacuuga cacgaccggc acgcucguag 290

<210>3

<211>814

<212>RNA

<213>Artificial

<400>3

gaauucugca gauauccauc agaucucuac gagcgugccg gucgugucaa gugucucggu 60

aacccugaac gugaagguuc gguguccauc gucggugccg uaucgccccc ugguggugau 120

uucuccgauc ccgucacauc cgccacccuu gguaucguac agguguucug gggucuggac 180

aagaaacugg cccagcguaa gcauuucccc ucgaucaacu gguugaucuc cuacagcaag 240

uacaugcgcg cccuugauga cuucuacgau aagaacuucc aggaguuugu cccacugcgu 300

accaagguua aggagagggc ccuugaucca accccuccgc ugcuauagug cagucggcuu 360

cugacguuca gugcagccgu cuucugaaaa cgacaugucg cacaaguccu aaguuacgcg 420

acaggcugcc gcccugcccu uuuccuggcg uuuucuuguc gcguguuuua gucgcauaaa 480

guagaauacu ugcgacuaga acucuccuua accuugguac gcagugggac aaacuccugg 540

aaguucuuau cguagaaguc aucaagggcg cgcauguacu ugcuguagga gaucaaccag 600

uugaucgagg ggaaaugcuu acgcugggcc aguuucuugu ccagacccca gaacaccugu 660

acgauaccaa ggguggcgga ugugacggga ucggagaaau caccaccagg gggcgauacg 720

gcaccgacga uggacaccga accuucacgu ucaggguuac cgagacacuu gacacgaccg 780

gcacgcucgu agaagcuuca gugugcugga auuc 814

<210>4

<211>2308

<212>RNA

<213>Artificial

<400>4

caccccccga aggcacaggg gccagccagc agcagcggaa ccagccgccg gggggaggca 60

cccacccacc ccgacaacgcagcaccaaga gcagaaggaa gcagagcagg aggaacggac 120

gaacaagcca cccgaagaag acccgagagg accgcgagcc aaacggaagg cgccgaccgg 180

ccgcgcacgg ccgagcggag ccggcggcag acgagggccg cgcggacacg agcggcggga 240

gacaccggga agggacaggc caccaccagg aacgaggaaa ccccgggcac cgcggcgacc 300

cggcgcgacc ggcaagcccc cccgcgaacc ggccaggaag ggagcacgac ggaccagcgc 360

cacgaaggac aaacgaacga ccagccgaca cacccgaagg gggaacaccc gcgcccgacc 420

cagagcgggg acaaccccga acgaaagggg cccacacacc ggaggagacg acgggggcac 480

gagaaacccg gcaagcacaa gcgggcccgc cacgcgccaa gggacagcga cagcccaccc 540

ggcaacacac cgcgacgaca cacggagacg gaacgacggg agacaacaag ggcaggcagg 600

gggcccggcg cagccacgcc aggacgagaa ggcccgccaa cacccgcgac ggcagcgggg 660

gacgcgcccg gccaggggga ccacgccacc ccggagccgg gcggaagacg caccgcaggc 720

ccgccaagac ccaacccgag caacacgcgg gcggagaacg ggaacgaaag cgaagagcgg 780

acccgagcgc gggagagacg ggacggagcc acagaagcga ccgcgcgggc caacacccca 840

acagccgcgc gccggaagcc cacacaccgg aaccgccgag acccggaagg gacaacgacc 900

agaggcgacc gaccccgggg ccgaagcccg agaaaccggc gcggcgagag ccgccgaccg 960

gaccgccacc ggggcacggg cccccacgag cggccggcgg caaggccgga acccgaacgg 1020

aaggcgggcc acgcgggccg acgcccccgg gggacccgac ccgcacaccg ccacccggac 1080

gacagggcgg ggcggacaag aaacggccca gcgaagcacc cccgacaacg ggacccacag 1140

caagacagcg cgcccgagac cacgaaagaa cccaggaggc ccacgcgacc aaggaaggag 1200

accgcaggag gaagaagagc cgaaaggcag cggcggaagg cacgcggcag aaaccgaaag 1260

acacccgagg agccaagcgc caaggagacc gcagcagaac cgaccggcga cgacgacgcc 1320

gcacaagacg gcggagcgcg aaacagacgg acacgaaggc cgccacgccg cgaaaccacc 1380

gcccagcgga gaacaagaca ccggaacgga ccggaccgag ggcaacaccg accagcgcgc 1440

gagaagcaag gacccaggaa ggaggcgaag cgaagacaag gccgacgacc aacgacgaag 1500

accgcagcag gcgccgcaac cggaagaaaa ccccgcacac gggcccaagc gaaaccgaaa 1560

cagagcagaa acaagcaaag aaagcgagca aggcaaacaa aacacaaaag agaaacacga 1620

aacacagcaa aaggagggcc cccggcacag acaaccaaca acaccaaaga aaagccaggc 1680

accaacaggc gaagggaaac aaacacaaaa gcaagaaaaa agaaagagaa caaacaaaag 1740

cgaggaacaa acaagaaacg gcgaaacaca caacaacaca gaacacacgg cagaacagaa 1800

acaaaagagg aaggaagcaa gggccgacgg cgaggaaaag gagcgaacgg aaaacgcaac 1860

ggaaagccga aagccgcgca gcggccaaag cgaaaaaacg aaaacaacgg ggaaacaaca 1920

caggagaaaa caaaggggaa aaagaaacac gggacaaaag acaaaagcaa aacccagcag 1980

aaagcagacg cgcgaagcga caaaaagaaa aacaaaccac ggaagggaaa aaagaagaaa 2040

ccgagagcag aagaaacacc agagagaaag acgcaaaacg aaagaaaaac agaaaacaag 2100

aaagggaagc caacaaggaa cagaaaaaag gaaaagacaa gaggcgccac ggaggacgga 2160

aacgagaacg agagagacgg gcaaagaaag aaagaaaaag cggggaacag aagaagagcc 2220

gccgcgcgcg gcaagcaagc gaccgacggc cgacgcgaca gcgagagcag aaaaaagaga 2280

aaaaacccca aaaaagcacc gcgaaacg 2308

<210>5

<211>3108

<212>DNA

<213>Artificial

<400>5

ttttcattcc tctcctcgaa gtgcacaggt tggccagtct ttcagtcagt cagtcttgtg 60

ataccatttt gcttcgctcg gtgtgtggag tttgcatttt tcccatccca tctctctcga 120

caactgcagc acctaagagc agaaggaagc agagcaggag gaacggatcg taacaatgtc 180

caccctgaag aagatctccg atgaggaccg cgagtccaaa ttcggatatg tgttcgccgt 240

atccggtcct gtcgtcacgg ccgagcggat gtccggttcg gctatgtacg agttggtccg 300

cgtcggttac tacgagctgg tcggtgagat catccgtttg gaaggtgaca tggccaccat 360

ccaggtatac gaggaaacct ccggtgtcac cgtcggcgat cccgtgctgc gtaccggcaa 420

gcccctctcc gtcgaactcg gtccaggtat tatgggtagc atctttgacg gtatccagcg 480

tccactgaag gacattaacg aactgaccag ctcgatctac atcccgaagg gtgtgaacat 540

tccctgcttg tcccgtaccc agagctgggg attcaacccc ttgaacgtaa aggttggctc 600

tcacatcacc ggaggagatc tgtacggttt ggtgcacgag aataccctgg tcaagcacaa 660

gctgttggtc ccgccacgcg ccaagggtac agttcgttac attgctccac ccggcaacta 720

caccgtcgac gacatcattc tggagacgga attcgacggt gagatcaaca agtggtctat 780

gttgcaggtg tggcccgtgc gtcagccacg tccagtgact gagaagttgc ccgccaatca 840

tcctctgctg actggtcagc gtgtgttgga ttcgctgttc ccttgtgtcc agggtggtac 900

cactgccatc cccggagctt tcggttgcgg taagactgtc atctcgcagg ccctgtccaa 960

gtactccaac tccgatgtca ttatctacgt cggttgcgga gaacgtggta acgaaatgtc 1020

tgaagtattg cgtgatttcc ctgagctgtc ggttgagatt gacggtgtta cggagtccat 1080

catgaagcgt accgcgctgg ttgccaacac ctccaacatg cctgtcgctg ctcgtgaagc 1140

ttccatctac accggtatta ccttgtccga gtacttccgt gatatgggtt acaacgtatc 1200

catgatggct gactcgacct ctcgttgggc cgaagctctt cgagaaattt ccggtcgtct 1260

ggctgagatg cctgccgatt ccggttatcc tgcctacctg ggtgcacgtt tggcctcctt 1320

ctacgagcgt gccggtcgtg tcaagtgtct cggtaaccct gaacgtgaag gttcggtgtc 1380

catcgtcggt gccgtatcgc cccctggtgg tgatttctcc gatcccgtca catccgccac 1440

ccttggtatc gtacaggtgt tctggggtct ggacaagaaa ctggcccagc gtaagcattt 1500

cccctcgatc aactggttga tctcctacag caagtacatg cgcgcccttg atgacttcta 1560

cgataagaac ttccaggagt ttgtcccact gcgtaccaag gttaaggaga tcctgcagga 1620

ggaagaagat ttgtccgaaa ttgtgcagct ggtcggtaag gcatcgctgg cagaaaccga 1680

taagatcacc cttgaggtag ccaagctgct caaggatgat ttcctgcagc agaactcgta 1740

ctcggcgtac gatcgattct gtccgttcta caagacggtc ggtatgctgc gaaacatgat 1800

cggattctac gatatggctc gccacgccgt cgaaaccacc gcccagtcgg agaacaagat 1860

cacctggaac gtgatccgtg actcgatggg caacatcctg taccagctgt cgtcgatgaa 1920

gttcaaggac ccagtgaagg atggcgaagc gaagatcaag gccgatttcg accaactgta 1980

cgaagacctg cagcaggcgt tccgcaacct ggaagattaa attctcccgc acattcgtgg 2040

tctcttcaat gcgaaattcc ttgaaacagt tttattgttt tcagtaaaca tagcaaagaa 2100

atgttcgtag catagtgcaa acaaaacatc aaaatgagaa acacgaaaca cagcaaaagt 2160

gtagggccct ccttggcatc atgatcaacc aacaacatcc attaagtaaa atgcttctag 2220

gtcaccattt tacaggcgta tttaggttga aacatttatt tacacaaatt attgcaagaa 2280

aaaagattaa gagaacaaat ctataaagcg agtgtaacat atacatttag aaacggcgaa 2340

acactacaac aactacagaa cacacggcag aacagaaaca aattttagta ggtaagtgat 2400

attgcaagtg ttgtccgacg gcgtaggaaa aggttagcga acggaataac gttcaatcgg 2460

aaattgtctt cgaaagtttt ccgcttgcat gcgtgtctca aatgcgaata aaacgtataa 2520

acaatcgtgg tgaaacttaa catcagtgat gatataatca aaggggatta aaatgaaaca 2580

cgtggacaaa agatctataa agcaaaactc tcagctagaa tagttcatga cgtcgcgaag 2640

cgtactataa atagaataat atctaaacca cggttaatgg gaaaataaga agaaactttc 2700

gattgagcta tgttatagaa acttatccat gtatgattgt ataagatcgc taattaatcg 2760

tataagaaat aacagaaaac aagttttatt ataggtgtaa gccaatcaag ttgttatatc 2820

agtttaaata ttatttagtg aatatagttt tacttttaat tttgtagtgt cgtttttcca 2880

tcggtaggat cggaaacgag aatcgatgat tgattgactg ttggcaaatg aaatgaaagt 2940

taaatttatt atgctttttt gtttgtgtga acagaattga agagccgccg cgtcgtttcg 3000

gtcaatgcaa gcgaccgacg gctcgtatct gtcttgtaca tttttgtcga tgagcagaaa 3060

atatatgaga ataaaaccct ctaaaaaatt gcattccgcg taaactgt 3108

Claims (9)

1. A double-stranded RNA is characterized by consisting of a sense strand and an antisense strand, wherein the nucleotide sequence of the sense strand is shown as SEQ ID NO.1 in a sequence table, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.2 in the sequence table.

2. An RNAi inverted repeat sequence comprising a sense strand sequence and an antisense strand sequence of the double-stranded RNA of claim 1, wherein the nucleotide sequence is represented by SEQ ID NO.3 of the sequence Listing.

3. An expression vector comprising an original vector and the double-stranded RNA of claim 1 or the RNAi inverted repeat of claim 2.

4. The expression vector of claim 3, wherein the original vector is pMaa7IR/XIR, and the RNAi inverted repeat sequence of claim 2 is cloned into the Maa7IR/XIR vector by recombinant means.

5. Use of the double stranded RNA of claim 1, or the RNAi inverted repeat of claim 2, or the expression vector of claim 3 or 4 for silencing a V-ATPA gene, wherein the V-ATPA gene is one of the following nucleotide sequences:

1) the V-ATPA gene of Aedes aegypti, a sequence shown as SEQ ID NO.4 in a sequence table;

2) DNA sequence with over 90% homology with Aedes aegypti V-ATPA gene and coding the same functional protein.

6. Use of the double stranded RNA of claim 1, or the RNAi inverted repeat of claim 2, or the expression vector of claim 3 or 4 for the preparation of an agent for controlling aedes.

7. A transgenic microalgae prepared by transforming the expression vector of claim 3 or 4 into microalgae edible by mosquito larvae.

8. A transgenic microalga according to claim 7, wherein the microalga is Chlamydomonas or Chlorella.

9. Use of a transgenic microalga of claim 7 or 8 in the preparation of an agent for controlling aedes.

Images