CN117431261A - OfDrosha gene dsRNA capable of improving termite control effect of Serratia marcescens - Google Patents

Abstract

The invention discloses a method for improving the termite control effect of Serratia marcescensOfDroshaGene dsRNA. The saidOfDroshaThe nucleotide sequence of (2) is shown as SEQ ID N0:1. The invention designs dsRNA (ds)OfDrosha) And further constructing the dsRNA-HT115 engineering strain. Dss for black wing soil termitesOfDroshaAfter treatment, thenTreatment with Serratia marcescens resulted in a significant increase in mortality, indicating dsOfDroshaThe toxicity of biocontrol bacteria is improved, and a theoretical basis is provided for further improving the biological control or chemical control effect of controlling the black wing soil termites.

Description

OfDrosha gene dsRNA capable of improving termite control effect of Serratia marcescens

Technical Field

The invention relates to the technical field of biology, in particular to an OfDrosha gene dsRNA capable of improving the termite control effect of Serratia marcescens.

Background

Termites are worldwide pests, and damage involves house buildings, hydraulic dykes, pipeline facilities, agriculture, forestry, plants and the like, causing great economic losses each year. The termite Odontotermesformosanus (Shiraki) is a soil-dwelling termite belonging to the genus subterranean termite of the subfamily of the family Blatta, belonging to the order Blatta, and is one of the most serious termites harmful to agriculture and forestry plants, and can harm various crops and woods. In addition, the black wing soil termites are also important pests of the water conservancy dykes, and can cause dykes to collapse when the pests are serious. The termite is wide in distribution range, and mainly takes tree roots, cortex, seedlings, saplings, crop straws, sugarcanes, bamboo roots, grass roots, rice and the like as feeding objects, and can also feed cow dung, so that feeding performance is very miscellaneous. The black wing soil termites have different grades of differentiation in the same group due to different positions, different labor division and different levels of termite king, termite postambary, winged adults, soldier termites and industrial termites. Termite individuals can be classified into two major types, reproductive and non-reproductive, from the external morphology and physiology. The prevention and treatment means of the black wing soil termites mainly comprise physical prevention and treatment, biological prevention and treatment, chemical prevention and treatment and the like. Physical control mainly utilizes physical barriers such as gravel, waterproof films, inert powder or plastic baffles and the like to protect buildings and the like from termites. Chemical agents for controlling the black wing termites are the most dominant control means at present, but the chemical agents have great negative influence on the environment. Biological control has the advantages of being friendly to the environment and not injuring non-target organisms. But biological control has weaker control effect on termites, and the biological control effect is improved by using a biological technology, so that the termite control method is a future development trend.

RNA interference (RNAi) is a complex process of regulating gene expression under the action of various enzymes, and can trigger specific silencing of target genes by generating fragmented RNA, so that the RNA has high specificity, high efficiency and amplification effect. The basic principle of RNAi in pest control is to cause the growth and development of pests to be blocked or even to be fatal by interfering with the transcription and posttranscriptional processes of exogenous target genes. However, RNAi technology is also not the same in different insect applications. The dsRNA needs to exert RNA interference effect in cells, and methods for allowing in vitro dsRNA to enter cells mainly comprise microinjection, feeding and soaking transfection methods, and methods such as virus infection, symbiont mediation, transgenic plant mediation, nanoparticle coating, liposome modification and the like are derived on the basis of the methods. Because of the high specific targeting mechanism of dsRNA, RNAi mediated by dsRNA has a great application prospect in pest control.

Drosha, a ribonuclease of RNase III family, is a core molecule in the microRNA (miRNA) production pathway. mirnas are single stranded RNAs of 19-25 nucleotides in length produced by endogenous hairpin transcripts. The nuclear micro-processing complex consisting of Drosha and DGCR8 recognizes and cleaves a hairpin primary miRNA (pri-miRNA) to produce a precursor miRNA (pre-miRNA), which is then transferred out of the nucleus by the action of export-5 (Exp 5) and sheared by the cytoplasmic RNase III family nuclease Dicer to produce a double stranded miRNA of about 22 nucleotides. Drosha is a large nuclear protein of 130-160kDa in size, with multiple domains, which are conserved in animals. Drosha consists of three parts, namely N-terminal proline, serine and arginine rich regions, a DGCR binding region and a C-terminal region containing RNaseIII cleavage activity, wherein RNaseIII domain comprises RNaseIII Da and NaseRIIIb and a dsRBD. RNase III proteins exhibit a high degree of conservation in their basic mechanism of action. Two RNaseIII's interact to form a dimer. At the interface between the two RNaseIII's, a single treatment center was formed containing two closely spaced catalytic sites, either of which could cleave each dsRNA strand. Drosha proteins localize themselves to the nucleus by phosphorylation and form the final miRNA processing function.

Recent studies indicate that Drosha has a direct role in controlling viral infections, in addition to its classical function in miRNA biogenesis. Drosha is involved in regulating development and feeding processes of grasshopper in desert. Silencing the drosha gene of aphids increases the sensitivity of insects to plant secondary substances. The research shows that Drosha protein participates in the growth and development of insects, feeding and stress-resistant processes. At present, research on the function of the OfDrosha gene of the subterranean termite at home and abroad is not reported at home and abroad. The function of the Drosha gene of the black wing soil termite in the Serratia marcescens is clarified, so that the control effect of the biocontrol bacteria Serratia marcescens is improved, and a theoretical basis is provided for the application and popularization of the biological control of the termite.

Disclosure of Invention

The invention aims to provide a black wing soil termite gene Drosha (OfDrosha) and dsRNA thereof, and the black wing soil termite gene Drosha (OfDrosha) and dsRNA thereof are combined with Serratia marcescens (Serratia marcescens, SM 1) to control termites.

In order to achieve the above purpose, the technical scheme of the invention is as follows:

the invention provides a black wing soil termite OfDrosha gene, the nucleotide sequence of which is shown as SEQ ID N0:1.

The invention provides an application of the above-mentioned Alternaria nigromaculata OfDrosha gene in reducing the pathogenic bacteria resistance of termites.

Further, the pathogenic bacteria are Serratia marcescens.

The invention improves a black wing soil termite OfDrosha gene dsRNA, which is obtained by any black wing soil termite OfDrosha.

The invention also provides a control method of the black wing subterranean termite, which comprises the steps of obtaining dsRNA from any black wing subterranean termite ofDrosha gene, treating the black wing subterranean termite for 6-24h by using the dsRNA, and then treating the subterranean termite by using Serratia marcescens.

The invention also provides an application of the OfDrosha gene dsRNA in improving the effect of Serratia marcescens in preventing and controlling the subterranean termites, wherein the OfDrosha gene dsRNA capable of improving the effect of Serratia marcescens in preventing and controlling the subterranean termites is obtained by a nucleotide sequence shown as SEQ ID N0:1, and the preparation method of the OfDrosha gene dsRNA comprises the following steps:

(1) Extracting total RNA in the black wing soil termite body, and obtaining termite cDNA library through reverse transcription; (2) Using termite cDNA as a template, amplifying the OfDrosha gene fragment by using an OfDrosha specific primer, and separating and purifying the OfDrosha gene fragment by agarose gel electrophoresis, wherein the OfDrosha specific primer is as follows: an upstream primer (5 '-3') ATGTGGTACAATGACTCGGGAG, and a downstream primer (5 '-3') TTATTTCTTGCCTGCAGACACTT;

(3) Introducing the OfDrosha gene fragment into an expression vector L4440 by TA cloning, and detecting to obtain an OfDrosha plasmid containing the target gene OfDrosha;

(4) Using an OfDrosha plasmid as a template, and amplifying by using a specific primer to obtain a dsRNA template, wherein the sequence of the upstream primer (5 '-3') is

CCCAAGCTTGTGACCGTAGGATTCATTACATGAA, the sequence of the downstream primer (5 '-3') is CCGCTCGAGTGGTGAGATTTTGCAGCAGC;

(5) The fused expression vector is transformed into qualified cell escherichia coli HT115 (DE 3) to obtain dsRNA-HT115 engineering strain;

(6) Killing dsRNA-HT115 engineering strains by using an ultrasonic treatment method, and simultaneously destroying cell walls and cell membranes of bacteria to promote the release of dsRNA;

(7) After the dsRNA obtained above is fed to the black wing soil termites through filter paper, serratia marcescens is dripped on the chest backboard of the worker termite.

Further, after the dsRNA is treated for 6-24 hours, serratia marcescens is used for treatment.

Further, after 6 hours of treatment of the subterranean termites with the dsRNA, the subterranean termites were treated with Serratia marcescens.

The invention has the beneficial effects that:

according to the invention, dsRNA (dsOfDrosha) is designed aiming at the obtained OfDrosha of the black wing termites, and the RNAi technology is utilized to interfere and inhibit the expression quantity of the OfDrosha gene in the body of the black wing termites; the black wing subterranean termite treated by dsOfDrosha is contacted with SM1 biocontrol bacterium, the antibacterial activity and the survival rate are obviously reduced, the active immunity of the infected termite is broken, and the control effect of the SM1 biocontrol bacterium on the termite is obviously improved. The invention can be applied to the RNAi technology combined with SM1 biocontrol bacteria to control the black wing soil termites. The invention has the characteristics of strong specificity, excellent effect and environmental protection, deepens the physiological function and effect of the OfDrosha of the subterranean termites, also uses the subterranean termites as a new target, develops corresponding immunosuppressants and provides theoretical basis for further improving the biological prevention effect of the subterranean termites.

Drawings

FIG. 1 is a graph of phylogenetic analysis results of Drosha of the subterranean termites;

FIG. 2 is a graph of the expression of the Alternaria nigromaculata OfDrosha in different grades and tissues of Alternaria nigromaculata;

FIG. 3 is a graph of the results of construction of a subterranean termite dsOfDrosha interfering vector, wherein panel A shows cloning of a subterranean termite dsOfDrosha interfering fragment; panel B shows the results of double cleavage verification of the constructed L4440-dsOfDrosha vector;

FIG. 4 is a graph showing the results of the growth of the subterranean termite dsOfDrosha-HT115 and dsGFP-HT115 transgenic strains after sonication;

FIG. 5 is a standard graph of the subterranean termites dsOfDrosha (A) and dsGFP (B);

FIG. 6 is a graph showing the results of expression of OfDrosha at various time points after feeding dsOfDrosha by the subterranean termites;

figure 7 is a graph of the results of silencing OfDrosha of the subterranean termites OfDrosha, results of a bioassay experiment using SM1 for treatment of subterranean termites.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. However, unless otherwise indicated, all the specific examples described in the examples below were either conventional or were carried out under the conditions recommended by the manufacturer's instructions.

1. Experimental method

The black wing termites were collected from Nanjing, jiangsu province and fed on fermented sawdust in a dark environment at 25+ -1deg.C and 90+ -5% relative humidity. Collected workers, young ants and soldiers are used for grade and tissue specific gene expression analysis. The obtained male and female wedding ants were used for grade and tissue specific gene expression analysis. Serratia marcescens (SM 1) was stored in our laboratory and cultured in fermentation medium. The specific culture method comprises the following steps: 10 mu L of the preserved SM1 bacteria solution is taken and placed into a fermentation medium for culturing for 48 hours at 30 ℃ and 180 rpm/min.

EXAMPLE 1 cloning of the subterranean termite Drosha (OfDrosha) Gene

Total RNA of the black wing termites is extracted, reverse transcription is respectively carried out by referring to the instruction book of PrimeScript 1st Strand cDNA Synthesis Kit kit, and the first step system is as follows:

after the above systems were mixed, the procedure was as follows:

65℃5min

rapidly cooling on ice, and performing a second reaction.

The second step system is as follows:

after the above systems were mixed, the reaction procedure was as follows:

42℃ 60min

95℃ 5s

after the reaction was completed, the mixture was stored in an environment of-20 ℃.

The Primer Premier 5.0 software was used to design the upstream and downstream primers based on the OfDrosha gene sequences in the subterranean black-tail termite transcriptome, the Primer sequences are shown in table one:

PCR amplification of the target Gene:

the cDNA obtained by the reverse transcription was amplified by PCR, and the following was placed on ice:

after the above systems were mixed, the reaction procedure was as follows:

94℃5min

94℃30s,58℃30s,72℃1min30 s (35 cycles)

92℃10min

4℃∞

After the reaction, a part of the PCR product is subjected to gel electrophoresis, observed by a gel imager and photographed and recorded, a part of the product is used for TA cloning and sent to Nanjing qing department Biotechnology Co., ltd for sequencing, and the rest part is stored in an environment of-20 ℃.

Example 2 phylogenetic analysis of subterranean termites with other insects Drosha

The OfDrosha gene was cloned in this study. We studied the relationship between Drosha of Blackwing termites and other insects by constructing phylogenetic trees. The Amino Acid (AA) sequence (OfDrosha) is determined by the NCBI Open Reading Frame (ORF) finder (https:// www.ncbi.nlm.nih.gov/order /). We used each of these genes as a topic to query non-redundant databases (https:// www.ncbi.nlm.nih.gov /) on the NCBI website. MEGAX (version 10.1) was used to analyze multiple amino acid sequence arrangements and construct phylogenetic trees by adjacency (NJ) using 1000 guide replications.

Example 3 expression level of Alternaria nigra OfDrosha

Total RNA from each sample (about 50 mg) was extracted using RNA isolater Total RNA Extraction Reagents and cDNA was synthesized using HiScript IIQ RT SuperMix (R223-01,Vazyme BiotechnologyNanjing,Co, ltd., nanjing, china) according to the manufacturer's instructions. The expression levels of OfDrosha were analyzed by real-time fluorescent quantitative PCR (qRT-PCR), GAPDH and RPS18 as reference genes (table 1). All primers are listed in Table 1. Primers were tested for amplification efficiency using Linreg PCR software (version 2016.1) as described by Ramakers. Grade and tissue specific qRT-PCR detection with 2 ^-ΔCt Analysis by the method, the rest qRT-PCR detection adopts 2 ^-ΔΔCt And (5) analyzing by a method.

Example 4 Synthesis of subterranean termites dsofDrosha

The dsRNA primers for Drosha were designed based on the OfDrosha nucleic acid sequence of the subterranean termite species (Table 1). The PCR product obtained was subcloned into the expression vector L4440. The fused expression vector was transformed into a conforming cell, E.coli HT115 (DE 3). The specific method comprises the following steps:

table 1 primers used in the experiments

Note that: the bold letters are cleavage sites.

The cDNA obtained by reverse transcription was amplified by PCR, and the system was prepared as follows on ice:

after the above systems were mixed, the reaction procedure was as follows:

95℃3min

95℃15s,57℃15s,72℃30s (35 cycles)

72℃10min

4℃∞

After the reaction is finished, a part of PCR products are subjected to gel electrophoresis, and are observed and photographed by a gel imager for recording, and a part of products are subjected to gel recovery for subsequent dsRNA expression vector construction.

The purified target fragment and L4440 plasmid were double digested with restriction endonucleases HindIII and XhoI, respectively, while the control plasmid containing green fluorescent protein (Green fluorescent protein, GFP) was double digested with restriction endonucleases SacI and HindIII, as follows:

double enzyme digestion is carried out at 37 ℃ overnight, detection and identification are carried out through 1% agarose gel electrophoresis, and the target fragment and the target vector are purified by using a DNA gel recovery kit respectively. Then, the target fragment and the target vector are connected by using T4DNA ligase at 16 ℃ overnight, and the connection system is as follows:

ligation was completed to obtain a recombinant plasmid containing the fragment of interest, which was transformed into HT115 (DE 3) competent cells, as follows:

(1) HT115 (DE 3) competent cells were removed from-80℃and rapidly inserted into ice, and after the pellet melted, the plasmid of interest was added and gently mixed by hand dialing the bottom of the EP tube, and allowed to stand in ice for 25min.

(2) Water bath at 42 ℃ for 45s, quickly put back in ice and stand for 2min.

(3) To the centrifuge tube, 700. Mu.L of LB sterile medium without antibiotics was added, and resuscitated at 37℃for 60min at 200 rpm.

(4) Centrifuge at 5000rpm for 1min, leave about 50. Mu.L of supernatant gently blow the resuspended pellet and spread on LB solid medium containing tetracycline (concentration 12.5. Mu.g/mL) and ampicillin (concentration 50. Mu.g/mL).

(5) The plates were placed in an incubator at 37℃overnight.

The monoclonal antibody cultured overnight in the culture medium is selected, added into LB sterile culture solution containing tetracycline and ampicillin, cultured at 37 ℃ and 200rpm until turbidity, and the connection product is subjected to double digestion and sequencing identification, and is stored in a refrigerator at-80 ℃ according to the mixing of HT115 bacterial liquid and 50% glycerol according to the ratio of 1:1.

5. Mu.L of HT115 bacteria solution was added to 50mL of sterile LB medium, and tetracycline and ampicillin were added to the medium at final concentrations of 12.5. Mu.g/mL and 75. Mu.g/mL, respectively. After culturing at 37deg.C and 200rpm for 12h, adding again to 50mL of sterile LB culture solution, simultaneously adding the same amount of tetracycline and ampicillin as in the previous step, culturing at 37deg.C and 200rpm to OD ₆₀₀ IPTG was added at a final concentration of 0.4-0.6 to a final concentration of 0.8mM, and the culture was continued at 37℃and 200rpm for 4 hours, at which time the dsRNA was already expressed in a large amount in the bacterial liquid to extract RNA.

EXAMPLE 5 preparation of dsRNA by ultrasonic inactivation of engineering Strain dsOfDrosha-HT115

Adding 10 μl of preserved dsOfDrosha-HT115 bacterial liquid into 50mL of LB liquid medium, adding ampicillin and tetracycline into the LB liquid medium to obtain final concentrations of 75 μg/mL and 12.5 μg/mL, shake culturing at 37deg.C for 24 hr, adding 1mL of bacterial liquid into 50mL of LB liquid medium again, shake culturing at 37deg.C to OD ₆₀₀ 400 μl of IPTG was added to a final concentration of 0.8mM when the concentration was between 0.4 and 0.6, and the bacterial suspension was cultured at 37 ℃ for 4 hours with shaking. Using ultrasonic treatment method to kill dsRNA-HT115 engineering strain and destroy cell wall and cell membrane of bacteria,promoting the release of dsRNA. Specifically, 8mL of dsOfDrosha-HT115 bacterial liquid was centrifuged at 8000rpm for 5min, the supernatant was removed, and 5mL of DEPC water was added and mixed well. The bacterial suspension was disrupted using an ultrasonic cell disrupter with a power of 50% and a start of 3s and stop of 6s. mu.L of the bacterial liquid was aspirated every 20min and then plated on LB medium (containing 100. Mu.g/ml ampicillin and 12.5. Mu.g/ml tetracycline) for 24 hours before observation.

Example 6 interference efficiency of subterranean termites dsofDrosha

Design of experiment includes ddH ₂ Group O, dsGFP, and dsOfDrosha treated groups. The black wing termites were fed with filter paper in a 5cm dish and ddH was used ₂ O (negative control), 400. Mu.L dsGFP (positive control) or 400. Mu.L dsOfDrosha (treatment group) [ ddH ] ₂ O, dsRNA with Nel blue (10% w/v), respectively]The workers were collected at 3, 6, 12 and 24 hours and the expression of these genes was detected by qRT-PCR. Experiments were performed independently in triplicate.

Example 7 sensitivity assay to SM1 after silencing of the Alternaria nigromaculata OfDrosha Gene

In this experiment, a quantity of subterranean termites from the Solanum nigrum was transferred to a medium containing 400. Mu.L ddH ₂ O, dsGFP and dsOfDrosha [ ddH ] ₂ O, dsRNA with Nel blue (10% w/v), respectively]Is treated in a petri dish for 12 hours, and then ddH is added ₂ The O, dsGFP, dsOfDrosha treated workers were divided into two groups (fermentation medium treated and SM1 treated groups), respectively. One microliter of fermentation medium was dropped onto the forechest of each control workers, and 1. Mu.L of SM1 (1.8X10) ¹⁰ CFU/mL) was dropped onto the chest backboard of each treatment worker. Each repetition consisted of 20 workers and each treatment was repeated 3 times. Observation was stopped every 2h until one of the conditions appeared: (1) The mortality rate of the fermentation medium treated group was lower than 20% while all members of the SM1 treated group died. (2) Regardless of mortality in the SM1 treated group, mortality in the fermented media group exceeded 20%.

2. Data analysis

Collected data were analyzed by analysis of variance (ANOVA) using intat software (GraphPad, san Diego, CA, USA). Significant differences between the two samples were compared using a two-tailed unpaired t-test. The statistical significance of the multiple sample comparisons was determined using one-way anova followed by Tukey's multiple comparisons.

3. Results and analysis

1. Phylogenetic analysis of black-wing subterranean termites and other insects Drosha

Blast analysis is performed on the amino acid sequence of Drosha of the subterranean termites, and the fact that the amino acid sequence of Drosha of the subterranean termites has high similarity with the homologous sequences of other insects is found. To study the phylogenetic relationship of Drosha of the subterranean termites, we constructed a phylogenetic tree of the Drosha amino acid sequence of subterranean termites with other insect species. The AA sequences of the black-winged soil termites Drosha are clustered with those of Zootermopsis nevadensis and Cryptotermes secundus (as shown in fig. 1, wherein specific branches of coleoptera, lepidoptera, orthoptera, hymenoptera and diptera Drosha are represented in different colors).

2. Specific expression of ofDrosha in the grades and tissues of subterranean termites

Gene expression analysis shows that the expression level of OfDrosha in each grade and tissue of the subterranean termite is different. In workers and soldiers, the expression level of OfDrosha was significantly higher than that of larvae, female wedding ants and male wedding ants (fig. 2). Furthermore, our findings indicate that OfDrosha is expressed in different tissues of different populations, including haemolymph, gut, head and leg. The expression level of OfDrosha in blood stranguria was highest, followed by intestinal tract, and the lowest expression level was head and leg. ( As shown in fig. 2, the grades include workers, soldiers, larvae, female wedding ants, and male wedding ants. Tissues include haemolymph, intestine, head, skin and feet. Data are expressed as mean ± SD of three replicates. The same letters on the error bars indicate that there is no significant difference in OfDrosha expression (P > 0.05). )

3. Construction of a Blacker Solanum nigrum dsOfDrosha interference vector

We obtained a DNA band of 546bp dsOfDrosha by cloning (FIG. 3A). Then we constructed the correct sequence for sequencing onto the L4440 expression vector, confirming that dsOfDrosha was successfully constructed by double enzyme validation (fig. 3B).

4. Inactivation of dsOfDrosha-HT115 and dsGFP-HT115 and drawing of standard curves

The bacterial liquid was sonicated using a cell disrupter, and samples were collected every 30min, and we found that plating was performed on the bacterial liquid after the sonication, and the number of colonies was continuously reduced with the extension of disruption time, and colonies were no longer present on the plates after 2.5h and 3h of treatment (FIG. 4). We performed subsequent experiments using the treatment fluid at this point.

The logarithm of the four gradient concentrations was plotted against the corresponding CT values, and the standard curve for dsOfDrosha was calculated as y= -2.5223x+16.648 (R ² = 0.9319) (fig. 5A), the standard curve of dsGFP established y= -2.0459x+16.658 (R ² =0.9624) (fig. 5B).

5. Determination of interference efficiency of the subterranean termites dsofDrosha

20 workers were grouped into petri dishes (diameter 7 cm) with dry filter paper, which was treated with 400. Mu.L dsOfDrosha and nile (1% w/v) with dsGFP and nile (1% w/v) as positive controls and DEPC water and nile (1% w/v) as negative controls. Termites were placed in a dark environment and harvested at 3, 6, 12 and 24 hours. Then total RNA of termite workers received at different treatment times was extracted, primers were designed outside the dsRNA interference area (Table 1, below), and qRT-PCR was used to detect the expression level of the termite OfDrosha gene at different treatment times. By 2 ^-ΔΔCT The qRT-PCR data was analyzed.

After dsodrosha treatment, samples were collected at 3, 6, 12 and 24 hours, respectively, and the expression of the odrosha gene was detected by qRT-PCR, and we found that the expression of the odrosha gene was inhibited in all time periods, and the transcript level of the odrosha gene was decreased by 23.53,51.39,81.32and 74.41% at 3, 6, 12 and 24 hours, respectively. ( As shown in fig. 6, wherein the data are expressed as mean ± SD of three replicates. The same letters on the error bars indicate that there is no significant difference in the expression of OfDrosha (P > 0.05). )

6. Effect of dsOfDrosha on SM1 on subterranean termite virulence

Treatment of subterranean termites with SM1 after silencing OfDrosha gene showed that at 20h, the mortality rate (7.5%) of dsOfDrosha-SM1 group was significantly higher than that of the other treatment groups; at 40h, the mortality rate of dsOfDrosha-SM1 group was 28.75%, significantly higher than that of the other treatment groups; at 60h, the mortality rate of dsOfDrosha-SM1 group was 80% and significantly higher than that of the other treatment groups; the results of the survival curves showed that the survival rate of dsofDrosha-SM1 group was lower than that of the other SM1 treated groups (CK-SM 1 group, dsGFP-SM1 group), and that the survival rate of SM1 treated groups (CK-SM 1, dsGFP-SM1, dsOfDrosha-SM 1) was lower than that of the control groups (CK group and dsGFP group). ( As shown in fig. 7, wherein fig. 7A is mortality of the black-winged soil termites within 20h after silencing OfDrosha gene with SM1 treatment; FIG. 7B is mortality of subterranean termites within 40h after silencing the OfDrosha gene by SM1 treatment; FIG. 7C is mortality of the subterranean termites within 60h after silencing the OfDrosha gene by SM1 treatment; FIG. 7D is the survival rate of subterranean termites treated with SM1 after silencing the OfDrosha gene. Data are expressed as mean ± SD of three replicates. In these figures, the different letters represent a significant difference in the mortality rate of the black wing subterranean termites (P < 0.05). )

The result shows that after the disturbance ofDrosha, the death rate of the termite can be obviously improved by the SM1 re-infection of the termite with the black wing soil: feeding the black-winged subterranean termites with dsOfDrosha obtained by using the inactivated engineering strain can silence the expression of the OfDrosha, and silencing the OfDrosha gene of the black-winged subterranean termites can enhance the insecticidal effect of SM 1.

Claims (8)

1. The gene of the Alternaria nigra OfDrosha is characterized in that the nucleotide sequence is shown as SEQ ID No. 0:1.

2. Use of the OfDrosha gene of the black-fin soil termite according to claim 1 for reducing the resistance of termite to pathogenic bacteria.

3. The use according to claim 2, wherein the pathogenic bacteria are serratia marcescens.

4. A subterranean termite OfDrosha gene dsRNA, characterized in that it is obtained from a subterranean termite OfDrosha gene according to any one of claims 1-3.

5. A method for controlling black-wing subterranean termites, which is characterized in that after dsrnas are obtained from the OfDrosha genes of any one of claims 1-3, the black-wing subterranean termites are treated for 6-24 hours by the dsrnas, and then are treated by serratia marcescens.

The application of the OfDrosha gene dsRNA in improving the effect of Serratia marcescens in preventing and controlling the subterranean termites is characterized in that the OfDrosha gene dsRNA capable of improving the effect of Serratia marcescens in preventing and controlling the subterranean termites consists of a nucleotide sequence shown as SEQ ID N0:1, and the preparation method of the OfDrosha gene dsRNA is as follows:

(1) Extracting total RNA in the black wing soil termite body, and obtaining termite cDNA library through reverse transcription;

(2) Using termite cDNA as a template, amplifying the OfDrosha gene fragment by using an OfDrosha specific primer, and separating and purifying the OfDrosha gene fragment by agarose gel electrophoresis, wherein the OfDrosha specific primer is as follows: an upstream primer (5 '-3') ATGTGGTACAATGACTCGGGAG, and a downstream primer (5 '-3') TTATTTCTTGCCTGCAGACACTT;

(3) Obtaining an OfDrosha plasmid containing a target gene OfDrosha through TA cloning;

(4) Amplifying by using cDNA as a template and using a specific primer to obtain a dsRNA template, wherein the sequence of the upstream primer (5 '-3') is CCCAAGCTTGTGACCGTAGGATTCATTACATGAA, and the sequence of the downstream primer (5 '-3') is CCGCTCGAGTGGTGAGATTTTGCAGCAGC;

(5) The fused expression vector is transformed into qualified cell escherichia coli HT115 (DE 3) to obtain dsRNA-HT115 engineering strain;

(6) Killing dsRNA-HT115 engineering strains by using an ultrasonic treatment method, and simultaneously destroying cell walls and cell membranes of bacteria to promote the release of dsRNA;

(7) After the dsRNA obtained above is fed to the black wing soil termites through filter paper, serratia marcescens is dripped on the chest backboard of the worker termite.

7. The use of claim 6, wherein the dsRNA is further treated with serratia marcescens after 6-24 hours of treatment with subterranean termites.

8. The use of claim 7, wherein the dsRNA is treated with serratia marcescens 6 hours later than treatment with serratia nigra.