CN111109199B

CN111109199B - Slc12a9 gene knockout mouse model and establishment method and application thereof

Info

Publication number: CN111109199B
Application number: CN201911158751.5A
Authority: CN
Inventors: 孙维建; 林以诺; 吴昊; 沈贤; 王文茜; 郑志强; 游涛
Original assignee: Second Affiliated Hospital and Yuying Childrens Hospital of Wenzhou Medical University
Current assignee: Second Affiliated Hospital and Yuying Childrens Hospital of Wenzhou Medical University
Priority date: 2019-11-22
Filing date: 2019-11-22
Publication date: 2022-02-18
Anticipated expiration: 2039-11-22
Also published as: CN111109199A

Abstract

The invention provides a Slc12a9 gene knockout model mouse, a breeding method thereof and application of the mouse model in researching pathogenesis of hypertension. The model mouse is knocked out of exon5, exon6 and exon7 of the SLC12A9 gene. The cultivation method is simple, the model is simple to manufacture, and the repeatability is good; the manufacturing cost is low. The clinical manifestations of the hypertension are similar to the human hypertension, and the hypertension can be used for the research of the human hypertension and has important practical significance for explaining the pathogenesis of the hypertension. The research also shows that the model provides a new model for the research of tumors, and can be used as an index for predicting the prognosis of patients with brain glioma. Therefore, the method has good popularization and application values.

Description

Slc12a9 gene knockout mouse model and establishment method and application thereof

Technical Field

The invention relates to a mouse model, in particular to a breeding method of a Slc12a9 gene knock-out mouse and application of the mouse model.

Background

Hypertension affects important organs and structures such as our arteries and heart. After long-term development, life-threatening symptoms such as myocardial infarction and apoplexy can also be caused. The prevalence rate of hypertension in China reaches 23%, and at present, the mechanism of hypertension is not clear.

Slc12a9 is widely distributed on cell membranes of cells in vivo, mediates the transport of sodium ions, potassium ions and chloride ions inside and outside the cells, and is closely related to osmotic pressure inside and outside the cells and the like. The SLC family of proteins play an important role in the development of tumors. In the prior art, the Slc12a9 gene is located on chromosome 5, the genome is 19040kb in length and has 14 exons, and the transcript is 19.040kb and codes 914 amino acids. At present, reports of Slc12a9 and hypertension are not found internationally, and establishment of a Slc12a9 gene knockout mouse model has important practical significance for elucidating pathogenesis of hypertension.

Disclosure of Invention

Based on the state of the art, the invention provides a model mouse, namely a Slc12a9 gene knockout mouse.

Furthermore, exon5, exon6 and exon7 of the SLC12A9 gene were knocked out.

The invention also provides a method for establishing a Slc12a9 gene knockout mouse model, which comprises the following steps: aiming at the SLC12A9 gene of a mouse, designing a gene knockout strategy, and selecting a knockout region: exon5, exon6, and exon 7; obtaining an F0 generation mouse by adopting a CRISPR-Cas9 gene editing method; and breeding the positive F0-generation mice and C57BL/6J to obtain positive F1-generation mice SLC12A9Slc12A9 with Slc12A9 gene knockout.

Further, the CRISPR-Cas9 gene editing method comprises the steps of respectively designing and constructing 5S1 sgRNA and 3S1 sgRNA, and carrying out in vitro activity test to prepare a Cas9 mixed sample system; and the sgRNA is combined with the Cas9 protein to guide the Cas9 enzyme to target the genomic DNA for shearing.

The invention also discloses a method for establishing a Slc12a9 gene knockout mouse model, which comprises the following steps:

(1) aiming at the SLC12A9 gene of a mouse, designing a gene knockout strategy, and selecting a knockout region: exon5, exon6, and exon 7;

(2) respectively designing and constructing 5S1 sgRNA and 3S1 sgRNA, and performing in vitro activity test to prepare a Cas9 mixed sample system;

(3) mixing and injecting a cas9 mixed sample system into a fertilized egg, and transplanting to obtain an F0 mouse;

(4) and breeding the positive F0-generation mice and C57BL/6J to obtain positive F1-generation mice SLC12A9Slc12A9 with Slc12A9 gene knockout.

Further, the 5S1 sgRNA and 3S1 sgRNA are 5S 1: CTCGCAGACCAAACAACTCC, respectively; 3S 1: CTACTATTATAGAGAGTTTG are provided.

Further, the cas9 sample mixing system comprises two sgrnas 5S1 and 3S1 and cas 9.

Further, Cas9 mixed system included Cas9 protein 20 ng/. mu.l, and the concentration of each sgRNA was 10 ng/. mu.l.

Further, positive F1 mouse was used for stock protection and establishment, and mating was not allowed in principle between different stock protection and establishment.

The invention also provides application of the Slc12a9 gene knockout mouse in a model mouse for researching the onset of hypertension.

The model mouse disclosed by the invention is applied to the research of the onset of hypertension. And the application of the method in preparing a model mouse for researching the onset of hypertension.

The Slc12a9 gene knockout mouse model and the establishment method thereof fill in a gap in the research field of the pathogenesis of hypertension, the model is simple to manufacture, good in repeatability and low in manufacturing cost, and the clinical performance of the Slc12a9 gene knockout mouse model is similar to that of human hypertension, so that the Slc12a9 gene knockout mouse model can be used for the research of the human hypertension and related drug intervention experiments. And also has certain value in tumor research. Therefore, the method can be popularized and applied at home and abroad.

Drawings

FIG. 1 is a schematic diagram of a build strategy.

Fig. 2 is a diagram of a simple version of the build strategy.

Detailed Description

The invention is further described with reference to the following figures and examples.

Example 1 creation of SLC12a9 knock-out mouse model

A,Cas9 mixed sample system

sgRNA design.

As shown in the strategy diagrams of construction shown in fig. 1 and 2, a genome sequence of a knockout SLC12a9 gene, which comprises Exon5 (Exon5), Exon6 (Exon6) and Exon7 (Exon7), was determined, and the coding region sequences thereof were as follows:

Exon5:ATGCCACAGGCTCCAGTGGGATCCAGGTTCTACCCCAGGGTTATGGCTGGAATCTGCTC TATGGCTCCCTTCTGCTGGGCCTCGTGGGTGGTGTGTGCACTTTGGGAGCTGGGCTCTATGCCCGAGCC TCCTTTCTTACATTCCTGCTGGTTTCTGGCTCCCTGGCCTCCGTGCTGGTCAGTTTTGTGGCAGTGGGA CCCAGGAACATCCCGTTAGCTCCTCGACCGGGCACCAATGCTTCCTCCGTGCCACACCGGCATGGCCAC TTCACTGGGTTCAACGGAAGCACCCTAAGGGACAACTTAGGTG

Exon6:CTGGCTACGCCGAGGACTACACCACAGGGGCCATGATGACTTTCGCCAGTGTTTTTGCT GTCCTCTTCAACGGCTGCACGGGCATCATGGCTGGGGCCAACATGTCAG

Exon7:GGGAGCTGAAGGACCCCAGCCGGGCAATTCCTCTGGGCACCATCATTGCAGTCGCCTAT ACCTTCTTCATCTACATCCTGCTGTTCTTCCTCTCCAGCTTCACTTGTGACAG

sgRNA sequences were designed, which are described in table 1.

Table 1 sgRNA sequences

sgRNA name	sgRNA sequence (5 '→ 3')	PAM
			5S1	CTCGCAGACCAAACAACTCC	GGG
3S1	CTACTATTATAGAGAGTTTG	TGG

sgRNA in vitro Activity assay

Two sgrnas 5S1 and 3S1 shown in table 1 and a Cas9 in vitro enzyme digestion target DNA sequence are respectively designed and synthesized, and a Cas9 enzyme recognizes a Pam sequence and cuts the Pam sequence to obtain two DNA fragments (two sgrnas 5S1 and 3S 1). The activity and cleavage efficiency of sgRNA were judged by observing the percentage of sgRNA-mediated DNA cleavage by agarose electrophoresis analysis.

The cleavage efficiency in this experiment was 70% for 5S1 and 90% for 3S1, respectively, so the sgRNA activity was highly efficient.

3. Preparation of Cas9 Mixed sample System

Wherein the Cas9 mixing system is a mixture comprising 2 sgRNAs (i.e. two sgRNAs of 5S1 and 3S 1) and Cas9, the concentration is 20ng/μ l of Cas9 protein respectively, and the concentration of the two sgRNAs is 10ng/μ l each.

II,Microinjection and transplantation

The method for preparing F0 mouse includes the following steps: supervola of mice; injecting fertilized eggs and transplanting; f0 mouse generations were obtained.

Mouse strains: c57BL/6J

The specific method comprises the following steps:

1. selecting experimental mice

Selecting mice with age of 5-6 weeks and weight of 18-22 g.

2. Superovulation and injection of fertilized eggs in mice

The mice are supervolved and injected, namely female mice of 4 weeks are injected with PSMG firstly, HCG is injected after 48 hours, and ova are taken out after 24 hours, and then in vitro fertilization is carried out, and the fertilized ova are taken out.

The cas9 mixed sample system was mixed and injected into fertilized eggs, and then transplanted into pseudopregnant female mice to obtain F0 generation mice.

3. Transplantation

After the injection is completed, the fertilized eggs are transplanted into the uterus of the pseudopregnant female mouse. The transplanted receptor 2 is fed in one cage, and can be continuously observed within one week after the operation, and pain reaction can be caused, and the injection of pain preparation can be timely arranged.

III,F0 generation mouse identification and breeding

Microinjected mice F0 were subjected to PCR and electrophoretic characterization. PCR amplification primers, PCR reaction system, and procedure are shown in the following table.

The primer sequences for detecting KO are as follows

3501-Slc-12a9-KO-tF1：ATGCCTTTGGAGGCATGTGTACATA

3501-Slc-12a9-KO-tR1：GGTGACCTCTCCTCCAACCATAAC

The primer sequences for detecting the wild type are as follows:

3501-Slc12a9-wt-tF1：CAGCCTCAGGCTCCTGAGTGC

3501-Slc12a9-KO-tR1:GGTGACCTCTCCTCCAACCATAAC

and (3) PCR system:

PCR Components	Dosage (mu l)
		gDNA template	2
10×Taq Buffer(mg²⁺plus)	2
		dNTP(10mM)	0.5
Primer mix(10μM)	0.5
		Taq DNA polymerase (5U/ul)	0.5
Purified water	Added to a total volume of 20. mu.l

1. Conventional PCR procedures, suitable for detecting wild-type primer sequences:

Seg.	Temp.	Time	Cycle
					1	95℃	5min
2	95℃	30s
					3	58℃	30s
4	72℃	45s	2-4,35×
				5	72℃	3min
6	10℃	hold

2. touchdown PCR procedure, primer sequences suitable for detecting KO:

Seg.	Temp.	Time	Cycle
					1	95℃	5min
2	98℃	30s
					3	65℃	30s
4	72℃	45s	2-4,20×
				5	98℃	30s
6	55℃	30s
				7	72℃	45s	5-7,20×
8	72℃	5min
				9	10℃	hold

through PCR amplification and electrophoretic identification, 5F 0 generation mice are confirmed to successfully knock out the Slc12a9 gene, and the details are shown in the following table.

ID	Gender	color	Gty	DOB	Gen
						83	♂	B	Positive for	2017-8-6	F0
98	♂	B	Positive for	2017-8-6	F0
						111	♂	B	Positive for	2017-8-6	F0
121	♂	B	Positive for	2017-8-6	F0
						128	♀	B	Positive for	2017-8-6	F0

Positive F0 mice were backcrossed to background mice, which were C57 BL/6J. The F0 mice were selected and bred to C57BL/6J respectively to obtain positive F1 mice.

Identification of four-and F1-generation mice

After 5 positive F0 generation mice numbered 83,98,111,121 and 128 and C57BL/6J are bred, offspring are obtained from F0 generation mice with the ID numbers of 111 and 83, and the 5 positive F1 generation mice are obtained by tail cutting identification and are identified by PCR and electrophoresis.

PCR amplification primers, PCR reaction system, and procedure are shown in the following table.

The primer sequences for detecting KO are as follows

3501-Slc-12a9-KO-tF1：ATGCCTTTGGAGGCATGTGTACATA

3501-Slc-12a9-KO-tR1：GGTGACCTCTCCTCCAACCATAAC

The primer sequences for detecting the wild type are as follows:

3501-Slc12a9-wt-tF1：CAGCCTCAGGCTCCTGAGTGC

3501-Slc12a9-wt-tF1:GGTGACCTCTCCTCCAACCATAAC

and (3) PCR system:

Seg.	Temp.	Time	Cycle
					1	95℃	5min
2	95℃	30s
					3	58℃	30s
4	72℃	45s	2-4,35×
				5	72℃	5min
6	10℃	hold

2. touchdown PCR procedure, primer sequences suitable for detecting KO:

the results obtained for positive F1 mice are shown in Table 2.

TABLE 2

ID

Gender

color

Gty

DOB

Gen

F/M

129

♂

B

-4044bp/wt

2017-10-16

F1

111/C57BL/6J

134

♀

B

-4044bp/wt

2017-10-16

F1

111/C57BL/6J

140

♀

B

-4044bp/wt

2017-10-16

F1

111/C57BL/6J

145

♂

B

-4054bp/wt

2017-10-18

F1

83/C57BL/6J

153

♀

B

-4054bp/wt

2017-10-18

F1

83/C57BL/6J

F1 generation positive mouse gene identification results and the enzyme cutting results in Table 3.

TABLE 3

Example 2 positive mice from the F1 generation were analyzed for blood pressure.

The results of the analysis are shown in Table 4 below.

The blood pressure measuring method comprises the following steps: the mouse was subjected to non-invasive blood pressure measurement using the BP2000 system of Visitech Systems in a conscious state by mouse tail pressure measurement.

[ operating methods ]

Preheating a machine for 10 minutes to 37 ℃;

② the mouse is put into the blood pressure fixator, and the tail is exposed from the small hole at the rear end of the fixator. The rat tail penetrates through the detection rubber ring, the rat is pulled to the bottom of the fixer, and the rat tail is fixed by the adhesive tape.

And thirdly, after the mouse is fixed, carrying out automatic measurement after the mouse is calmed down.

And fourthly, performing at least five times of prediction measurement before each formal measurement so that the mouse is better adapted to the blood pressure measurement to be performed in the fixator, and reducing errors.

Every mouse is measured for about 25 cycles. Collecting 25 circulation systolic pressure data, removing invalid values, and carrying out average value calculation on blood pressure to obtain the daily systolic pressure data and heart rate data of each mouse.

[ notes ] to provide a novel therapeutic agent

1) Before each batch of mice is formally tested, the mice are trained for 1-5 days to adapt to a blood pressure fixator, and all processes are carried out during the testing process.

2) Each measurement is fixed in time and frequency.

3) If the animals are kept in different rooms, the animals are moved 1-2 hours in advance to the room where the blood pressure measurements are taken for adaptation.

4) During operation, the movements are as gentle as possible and the room for measurement is kept quiet.

5) The smallest size anchor is selected.

6) In the measurement, the measurement channels of each rat should be systematically swapped, in such a way as to balance the errors between the different channels.

7) After the animals were given a cage change, the measurement was repeated at least 24 hours later.

Detection time: blood pressure was measured in mice at 14-16 weeks.

TABLE 4

The blood pressure of F1 positive mice after SLC12A9 gene knockout is analyzed, the blood pressure of F1 positive mice is obviously increased, and C57BL/6J mice are used for establishing the model, so that the hypertension of the mice is caused. Therefore, the model mouse has good popularization and application values when being applied to the research of hypertension.

The mouse model provided by the invention is used for carrying out related drug intervention experiments. For example, in order to study the effect of the gene of human tissue-type kinase on the dilation of blood vessels, the gene was cloned into a recombinant adeno-associated virus vector and intravenously injected into a model mouse according to the present invention. After two weeks, the blood pressure of these model mice with hypertension decreased significantly. In addition, further research shows that the model provides a new model for tumor research, and the SLC9A1 can be used as an index for predicting the prognosis of patients with glioma.

Sequence listing

<110> second Hospital affiliated to Wenzhou medical university and English child care Hospital affiliated to Wenzhou medical university

<120> Slc12a9 gene knockout mouse model and establishment method and application thereof

<130> 201901

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 240

<212> DNA

<213> mouse genes

<400> 1

atgccacagg ctccagtggg atccaggttc taccccaggg ttatggctgg aatctgctct 60

atggctccct tctgctgggc ctcgtgggtg gtgtgtgcac tttgggagct gggctctatg 120

cccgagcctc ctttcttaca ttcctgctgg tttctggctc cctggcctcc gtgctggtca 180

gttttgtggc agtgggaccc aggaacatcc cgttagctcc tcgaccgggc accaatgctt 240

cctccgtgcc acaccggcat ggccacttca ctgggttcaa cggaagcacc ctaagggaca 300

acttaggtg 309

<210> 2

<211> 108

<212> DNA

<213> mouse genes

<400> 2

ctggctacgc cgaggactac accacagggg ccatgatgac tttcgccagt gtttttgctg 60

tcctcttcaa cggctgcacg ggcatcatgg ctggggccaa catgtcag 108

<210> 3

<211> 112

<212> DNA

<213> mouse genes

<400> 3

gggagctgaa ggaccccagc cgggcaattc ctctgggcac catcattgca gtcgcctata 60

ccttcttcat ctacatcctg ctgttcttcc tctccagctt cacttgtgac ag 112

<210> 4

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 4

ctcgcagacc aaacaactcc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 5

ctactattat agagagtttg 20

<210> 6

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 6

atgcctttgg aggcatgtgt acata 25

<210> 7

<211> 24

<212> DNA

<213> Artificial Synthesis

<400> 7

ggtgacctct cctccaacca taac 24

<210> 8

<211> 21

<212> DNA

<213> Artificial Synthesis

<400> 8

cagcctcagg ctcctgagtg c 21

Claims

1. The method for establishing the Slc12a9 gene knockout mouse model is characterized by comprising the following steps:

(2) obtaining an F0 generation mouse by adopting a CRISPR-Cas9 gene editing method; the CRISPR-Cas9 gene editing method comprises the steps of respectively designing and constructing 5S1 sgRNA and 3S1 sgRNA, carrying out in vitro activity test, and preparing a Cas9 mixed sample system; combining the sgRNA with the Cas9 protein to guide the Cas9 enzyme to target the genomic DNA for shearing;

(4) breeding the positive F0-generation mouse and C57BL/6J to obtain a positive F1-generation mouse SLC12A9Slc12A9 with Slc12A9 gene knockout;

the 5S1 sgRNA and 3S1 sgRNA are 5S 1: CTCGCAGACCAAACAACTCC, respectively; 3S 1: CTACTATTATAGAGAGTTTG, respectively;

the cas9 sample mixing system comprises two sgRNAs 5S1 and 3S1 and cas 9;

positive F1 mice were used for breed conservation and establishment, and mating was not allowed in principle between different breed conservation and establishment;

blood pressure of the positive F1 mouse SLC12A9Slc12A9 was measured by the following method: adopting a mouse tail pressure measurement method, and carrying out non-invasive blood pressure measurement on the mouse by using a BP2000 system of Visitech Systems in a conscious state of the mouse; preheating a machine for 10 minutes to 37 ℃; secondly, placing the mouse into a blood pressure fixator, and exposing a tail from a small hole at the rear end of the fixator; the rat tail penetrates through the detection rubber ring, the rat is pulled to the bottom of the fixer, and the rat tail is fixed by using an adhesive tape; thirdly, after the mouse is fixed, automatic measurement is carried out after the mouse gets quiet; before each formal measurement, at least five times of prediction measurement is carried out, so that the mouse is better adapted to the blood pressure measurement to be carried out in the fixator, and the error is reduced; measuring each mouse for 25 cycles; collecting 25 circulating systolic pressure data, removing invalid values, and carrying out average value calculation on blood pressure to obtain the daily systolic pressure data and heart rate data of each mouse;

the method is applied to preparing a model mouse for researching the onset of hypertension.

2. The use of the model mouse of claim 1 in the study of the onset of hypertension.