CN111100931A - Primer probe set, kit and method for quantitatively detecting SMIM3 gene expression quantity - Google Patents

Abstract

The invention discloses a primer probe set, a kit and a method for quantitatively detecting SMIM3 gene expression quantity, wherein the primer probe set comprises a component A and a component B, the component A comprises an upstream primer SMIM3-FP, a downstream primer SMIM3-RP and a probe SMIM3-probe, and the component B comprises an upstream primer ABL1-FP, a downstream primer ABL1-RP and a probe ABL 1-probe. The invention has the advantages that the quantitative detection of the relative expression quantity of SMIM3 in cells is realized, the sensitivity of SMIM3 and the sensitivity of ABL1 are both up to 100 copies, the sensitivity is high, the result is accurate, the reliability is high, a novel auxiliary diagnosis method or an auxiliary identification method is provided for blood tumor cells (especially acute myeloid leukemia and acute lymphocytic leukemia), and the application prospect is wide.

Description

Primer probe set, kit and method for quantitatively detecting SMIM3 gene expression quantity

Technical Field

The invention relates to the field of biochemical detection, in particular to a primer probe set for quantitatively detecting SMIM3 gene expression quantity, a kit containing the primer probe set and a method for quantitatively detecting SMIM3 gene expression quantity.

Background

Small Integral Membrane Protein 3, SMIM3, also known as C5orf62 or NID67, SMIM3 gene encodes a single-chain transmembrane Protein. SMIM3 mRNA is most abundant in heart, ovary, and adrenal gland, and is only expressed at low levels in most brain regions, testis, thyroid, thymus, pituitary, kidney, and intestinal tract, with little SMIM3 in skeletal muscle and cerebellum; however, in the PC12 pheochromocytoma cell, SMIM3 can be induced preferentially by NGF and EGF, and SMIM3 can also be induced strongly by forskolin, A23187 and ATP.

The human SMIM3 gene is located at 5q33.1, and the cDNA of SMIM3 contains a 180 bp Open Reading Frame (ORF) and encodes a 60 amino acid protein, 29 amino acids of which are more hydrophobic in the center and most likely contain a transmembrane domain. SMIM3 may be involved in forming or modulating ion channels, but currently there is little research on SMIM3 and its function is not yet clear.

Disclosure of Invention

The invention aims to provide a primer probe group for quantitatively detecting the expression level of SMIM3 gene, a kit containing the primer probe group and a method for quantitatively detecting the expression level of SMIM3 gene.

In order to achieve the purpose, the invention adopts the following technical scheme:

the primer probe set for quantitatively detecting the SMIM3 gene expression level comprises a component A and a component B, wherein the component A comprises:

an upstream primer SMIM3-FP of the nucleotide sequence shown in SEQ ID NO.1,

a downstream primer SMIM3-RP of the nucleotide sequence shown in SEQ ID NO.2,

and a probe SMIM3-probe containing a nucleotide sequence shown in SEQ ID NO.3, wherein the 5 'end of the probe SMIM3-probe is marked with a FAM luminous group, and the 3' end is marked with a fluorescence quenching group BHQ;

the component B comprises:

an upstream primer ABL1-FP of the nucleotide sequence shown in SEQ ID NO.4,

a downstream primer ABL1-RP of the nucleotide sequence shown in SEQ ID NO.5,

and a probe ABL1-probe containing a nucleotide sequence shown in SEQ ID NO.6, wherein the 5 'end of the probe ABL1-probe is marked with FAM luminous group, and the 3' end is marked with fluorescence quenching group TAMRA.

The invention also provides a kit for quantitatively detecting the SMIM3 gene expression level, which comprises the primer probe set, a positive control plasmid containing the SMIM3 gene fragment shown in SEQ ID NO.7 and an internal reference control plasmid containing the ABL1 gene fragment shown in SEQ ID NO. 8.

Furthermore, the molar ratio of the upstream primer SMIM3-FP, the downstream primer SMIM3-RP, the probe SMIM3-probe in the component A in the kit is 3:3:2, and the molar ratio of the upstream primer ABL1-FP, the downstream primer ABL1-RP, the probe ABL1-probe in the component B in the kit is 3:3: 2.

Furthermore, the positive control plasmid is a positive plasmid with the SMIM3 gene fragment shown in SEQ ID No.7 inserted into the XhoI/KpnI enzyme cutting site of the GV219 plasmid, and the internal control plasmid is an internal control plasmid with the ABL1 gene fragment shown in SEQ ID No.8 inserted into the XhoI/KpnI enzyme cutting site of the GV219 plasmid.

The invention also provides a method for quantitatively detecting the SMIM3 gene expression level, which comprises the following steps:

firstly, extracting RNA in a sample to be detected, and performing reverse transcription to obtain cDNA;

secondly, drawing a fluorescence standard curve of the positive control plasmid and a fluorescence standard curve of the internal reference control plasmid;

and thirdly, taking the cDNA obtained in the first step as a template, respectively adding the component A and the component B for amplification reaction, respectively carrying out RQ-PCR detection, obtaining the cycle number of the SMIM3 gene segment and the cycle number of the ABL1 gene segment in the sample, respectively calculating by using the fluorescence standard curve of the positive control plasmid and the fluorescence standard curve of the internal reference control plasmid in the second step to obtain the copy number of the SMIM3 gene segment and the copy number of the ABL1 gene in the sample, and obtaining the ratio of the copy number of the SMIM3 gene segment to the copy number of the ABL1 gene in the sample, namely the SMIM3 gene expression quantity in the sample.

The invention has the advantages that the method for quantitatively detecting the relative expression quantity of the SMIM3 gene is provided, the quantitative detection of the relative expression quantity of the SMIM3 in cells is realized, the relative expression quantity of the SMIM3 gene is equal to the ratio of the copy quantity of the SMIM3 gene in the cells to the copy quantity of ABL1 in the cells, the sensitivity of the SMIM3 and the sensitivity of ABL1 are both as high as 100 copies, the sensitivity is high, the result is accurate, the reliability is high, a novel auxiliary diagnosis method or an auxiliary identification method is provided for blood tumor cells (especially acute myeloid leukemia and acute lymphocytic leukemia), and the application prospect is wide.

Drawings

FIG. 1 is a graph of fluorescence standards for reference masses according to the present invention.

FIG. 2 is a fluorescence standard curve of the positive control plasmid of the present invention.

FIG. 3 is a bar graph showing the expression level of SMIM3 gene in each cell system in example 4 of the present invention.

FIG. 4 is a statistical graph showing the expression level of SMIM3 gene in patients and healthy specimens according to example 5 of the present invention.

Detailed Description

The present invention will be described in more detail with reference to the accompanying drawings and specific embodiments.

Example 1 primer probe set for detecting the expression level of SMIM3 gene according to the present invention

The primer probe set comprises a component A and a component B, wherein the component A comprises:

the upstream primer SMIM3-FP: 5' -TCATCATGACCTCGTTGTTGCT-3 (namely the nucleotide sequence shown in SEQ ID NO. 1), downstream primer SMIM3-RP: 5'-CTCAAACAGCCCCACTAAGGAT-3' (i.e., the nucleotide sequence shown in SEQ ID NO. 2) and the probe SMIM 3-probe: FAM-ACTGCAGTAATCATCTATCGCATGCGGAC-BHQ (namely the nucleotide sequence shown in SEQ ID NO. 3), wherein the 5 'end of the probe SMIM3-probe is marked with FAM luminescent group, and the 3' end is marked with fluorescence quenching group BHQ;

the component B comprises:

the upstream primer ABL1-FP: 5'-TGGAGATAACACTCTAAGCATAACTAAAGGT-3' (i.e., the nucleotide sequence shown in SEQ ID NO. 4), a downstream primer ABL1-RP: 5'-GATGTAGTTGCTTGGGACCCA-3' (i.e., the nucleotide sequence shown in SEQ ID NO. 5), and the probe ABL 1-probe: FAM-CCATTTTTGGTTTGGGCTTCACACCATT-TAMRA (namely the nucleotide sequence shown in SEQ ID NO. 6), the 5 'end of the probe ABL1-probe is marked with FAM luminous group, and the 3' end is marked with fluorescence quenching group TAMRA.

Example 2 kit for detecting SMIM3 Gene expression level according to the present invention

The kit comprises a component A and a component B in the embodiment, and also comprises a positive control plasmid and an internal reference control plasmid, wherein the molar ratio of an upstream primer SMIM3-FP to a downstream primer SMIM3-RP to a probe SMIM3-probe in the component A is 3:3: 2; the molar ratio of the upstream primer ABL1-FP, the downstream primer ABL1-RP and the probe ABL1-probe in the component B is 3:3: 2;

wherein the positive control plasmid is a positive plasmid of SMIM3 gene fragment shown in SEQ ID NO.7 inserted into the XhoI/KpnI enzyme cutting site of the GV219 plasmid;

the internal reference plasmid is formed by inserting the ABL1 gene segment shown in SEQ ID NO.8 into the XhoI/KpnI enzyme cutting site of the GV219 plasmid.

Embodiment 3 the detection of the sensitivity of the positive control plasmid and the internal reference plasmid and the drawing of the fluorescence standard curve of the present invention specifically comprise the following steps:

in the first step, the positive control plasmid of example 2 was diluted in sterile double-distilled water for injection in a 10-fold gradientObtaining positive control plasmid standard solution containing different copy numbers of SMIM3 gene fragments, wherein the copy number of SMIM3 gene fragments in each 1 mu L of positive control plasmid is 10⁶、10⁵、10⁴、10³、10²；

The internal reference plasmid in example 2 was diluted in sterile double-distilled water for injection in 10-fold gradient to obtain standard solutions of the internal reference plasmid containing different copy numbers of the ABL1 gene fragment, wherein the copy number of the ABL1 gene fragment in each 1. mu.L of the standard solution of the internal reference plasmid was 10⁶、10⁵、10⁴、10³、10²；

And secondly, respectively carrying out PCR reaction on the positive control plasmid solution and the internal reference plasmid solution with different concentrations obtained in the first step, wherein the PCR reaction system (10 mu L) of the positive control plasmid: 1 μ L of positive control plasmid, 0.3 μ L of forward primer SMIM3-FP (10 μ M), 0.3 μ L of reverse primer SMIM3-RP (10 μ M), 0.2 μ L of probe SMIM3-probe (10 μ M), 5 μ L of 2 × TaqMan Universal PCR public System (available from ABI, USA), and balance water;

PCR reaction of internal reference control plasmid (10 μ L): 1 μ L of internal reference plasmid, 0.3 μ L of upstream primer ABL1-FP, 0.3 μ L of downstream primer ABL1-RP (10 μ M), 0.2 μ L of 10 μ M probe ABL1-probe (10 μ M), 5 μ L of 2 × TaqMan universal PCR public system, and the balance of water;

the PCR conditions for the positive control plasmid and the internal control plasmid were: 2min at 50 ℃ for 1 cycle; 10min at 95 ℃ for 1 cycle; 50 cycles of 95 ℃ for 15s and 60 ℃ for 1 min;

thirdly, after PCR reaction, RQ-PCR detection is respectively carried out on the amplified positive control plasmid solution and the amplified internal reference control plasmid solution by using a fluorescent real-time quantitative PCR instrument (Quant Studio 5 type, ABI company, USA), and the RQ-PCR fluorescence standard curve of the obtained internal reference control plasmid is shown as the figure 1, and the functional formula is as follows:

log ₁₀ ABL1＝(Ct-41.65)/-3.52

in the formulaABL1The copy number of the ABL1 gene in the sample,Ctthe number of cycles required for the amplification curve to reach a threshold value of0.082; the correlation coefficient of the standard curve function is 1, and the sensitivity of the internal reference ABL1 gene reaches 100 copies;

the RQ-PCR fluorescence standard curve of the positive control plasmid is shown in FIG. 2, and is a function of:

log ₁₀ SMIM3＝(Ct-40.36)/-3.32

in the formulaSMIM3The copy number of the SMIM3 gene in the sample,Ctthe threshold was 0.082 for the number of cycles required for the amplification curve to reach the threshold; the correlation coefficient of the standard curve function is 0.995, and the sensitivity of the SMIM3 gene fragment reaches 100 copies.

The kit in example 2 was used for quantitative determination of the relative expression of SMIM3 gene in Kasumi-1, HEL, SKNO-1, HL-60, BV173, NALM-6, SUPB15, BALL-1, K562, RPMI8226, KM3, MOLP-2, SKO-007 and RAMOS fourteen tumor cell lines (all provided by the first subsidiary hospital of Zheng State university), each cell line was tested in three replicates, specifically comprising the following steps:

firstly, extracting RNA in each cell by using a TRIzol kit according to the instruction of the TRIzol kit (purchased from Invitrogen company in America), and detecting the concentration and purity of the RNA by using an ND-1000 spectrophotometer to ensure that the ratio of A260 to A280 of the RNA of each cell is between 1.8 and 2.0; then reverse transcribing the purified RNA from each cell into cDNA using a reverse transcription kit (ABI, USA);

secondly, taking the cDNA of each purified cell as a template, adding the component A to carry out PCR reaction on the cDNA template of each cell respectively, wherein a PCR system (10 mu L): mu.L of cDNA, 0.3 mu.L of upstream primer SMIM3-FP (10 mu.M), 0.3 mu.L of downstream primer SMIM3-RP (10 mu.M), 0.2 mu.L of probe SMIM3-probe (10 mu.M), 5 mu.L of 2 xTaqMan universal PCR public system, and the balance of water;

and (3) taking the cDNA of each purified cell as a template, adding the component B to carry out PCR reaction on the cDNA template of each cell respectively, wherein the PCR system (10 mu L): mu.L of cDNA, 0.3 mu.L of upstream primer ABL1-FP (10 mu.M), 0.3 mu.L of downstream primer ABL1-RP (10 mu.M), 0.2 mu.L of probe ABL1-probe (10 mu.M), 5 mu.L of 2 XTaqMan universal PCR public system, and the balance of water;

the PCR conditions of the above cells were: 2min at 50 ℃ for 1 cycle; 10min at 95 ℃ for 1 cycle; 50 cycles of 95 ℃ for 15s and 60 ℃ for 1 min;

thirdly, after the PCR reaction is finished, adding the component A into each cell by using a fluorescent real-time quantitative PCR instrument to perform RQ-PCR, so as to obtain the cycle number of each cell reaching the threshold value of 0.082 by using the component A for amplification, and calculating the copy number of the SMIM3 gene segment in each cell according to the positive control plasmid fluorescence standard curve obtained in the embodiment 3;

respectively adding the component B into each cell by using a fluorescent real-time quantitative PCR instrument to perform RQ-PCR to obtain the cycle number of each cell reaching the threshold value of 0.082 by using the component B for amplification, and calculating according to the internal reference control plasmid fluorescence standard curve obtained in the example 3 to obtain the copy number of the ABL1 gene in each cell; the ratio of the copy number of the SMIM3 gene fragment to the copy number of the ABL1 gene in the same cell is the relative expression amount of the SMIM3 gene in the cell, and the results are shown in Table 1 and FIG. 3.

TABLE 1 relative expression amounts of SMIM3 gene in respective tumor cells

Cell name	Cell type	Relative expression level of SMIM3 Gene%
			Kasumi-1	Human acute myeloid leukemia cell line	173.02%
SKNO-1	Human acute myeloid leukemia cell line	239.47%
			HL-60	Human acute promyelocytic leukemia cell line	425.23%
HEL	Human erythroleukemia cell line	393.74%
			SUPB15	Acute stranguria of human bodyBlast cell leukemia cell line	37.06%
NALM6	Human acute B lymphocyte leukemia cell line	0.31%
			BALL-1	Human acute B lymphocyte leukemia cell line	0.20%
BV173	Human acute B lymphocyte leukemia cell line	8.61%
			K562	Acute transformation cell line of human chronic granulocytic leukemia	14.44%
KM3	Human myeloma cell line	11.27%
			MOLP2	Human myeloma cell line	0.33%
RPMI8226	Human myeloma cell line	21.27%
			SKO007	Human myeloma cell line	8.03%
RAMOS	Human Burkitt lymphoma cell line	0.58%

The results showed that SMIM3 was expressed in all of the 14 hematological tumor cell lines described above, with relatively high expression, up to 173% or more, in acute myeloid leukemia cell lines (Kasumi-1, SKNO-1, HL-60, HEL), and relatively low expression in acute lymphoblastic leukemia cell lines (BV 173, NALM-6, SUPB15 and BALL-1), slow granulocyte cell line (K562), myeloma cell lines (RPMI 8226, KM3, MOLP-2, SKO-007) and lymphoma cell line (RAMOS).

Example 5 the kit of example 2 was used to quantitatively determine the expression level of SMIM3 gene in bone marrow cells of acute leukemia patients (including 239 primary patients with AML and 83 primary patients with ALL, both provided in the first subsidiary hospital of zheng state university), and the expression level of SMIM3 gene in 22 healthy bone marrow specimens was used as a control, and specifically included the following steps:

first, RNA in each bone marrow sample was extracted using a TRIzol kit (available from Invitrogen, usa) according to the instructions of the TRIzol kit, and then purified RNA of each cell was reverse-transcribed into cDNA using a reverse transcription kit (ABI, usa);

and secondly, respectively taking the cDNA of each purified sample as a template, adding the component A to carry out PCR reaction on the cDNA template of each sample, wherein a PCR system (10 mu L): mu.L of cDNA, 0.3 mu.L of upstream primer SMIM3-FP (10 mu.M), 0.3 mu.L of downstream primer SMIM3-RP (10 mu.M), 0.2 mu.L of probe SMIM3-probe (10 mu.M), 5 mu.L of 2 xTaqMan universal PCR public system, and the balance of water;

and (3) taking the cDNA of each purified cell as a template, adding the component B to carry out PCR reaction on the cDNA template of each cell respectively, wherein the PCR system (10 mu L): mu.L of cDNA, 0.3 mu.L of upstream primer ABL1-FP (10 mu.M), 0.3 mu.L of downstream primer ABL1-RP (10 mu.M), 0.2 mu.L of probe ABL1-probe (10 mu.M), 5 mu.L of 2 XTaqMan universal PCR public system, and the balance of water;

the PCR conditions of the above cells were: 2min at 50 ℃ for 1 cycle; 10min at 95 ℃ for 1 cycle; 50 cycles of 95 ℃ for 15s and 60 ℃ for 1 min;

thirdly, after the PCR reaction is finished, adding the component A into each cell by using a fluorescent real-time quantitative PCR instrument to perform RQ-PCR, so as to obtain the cycle number of each sample reaching the threshold value of 0.082 by using the component A for amplification, and calculating the copy number of the SMIM3 gene fragment in each sample according to the positive control plasmid fluorescence standard curve obtained in the embodiment 3;

respectively adding the component B into each sample by using a fluorescent real-time quantitative PCR instrument to perform RQ-PCR, obtaining the cycle number of each sample reaching the threshold value of 0.082 by using the component B for amplification, and calculating according to the internal reference control plasmid fluorescence standard curve obtained in the embodiment 3 to obtain the copy number of the ABL1 gene in each sample;

the ratio of the copy number of the SMIM3 gene fragment to the copy number of the ABL1 gene in the same sample cell is the relative expression amount of the SMIM3 gene in the cell, and the result is shown in FIG. 4.

The results showed that SMIM3 gene was relatively low expressed in bone marrow samples of the normal group (22 healthy persons), the SMIM3 median value was 368.89% in the primary AML group consisting of 239 primary AML patients, and the SMIM3 median value was 408.37% in the primary ALL group consisting of 83 primary ALL patients. The statistical results show that the SMIM3 level of the primary AML group is significantly higher than that of the normal group (P < 0.0001), the SMIM3 level of the primary ALL group is significantly higher than that of the normal group (P < 0.0001), and the SMIM3 level of the primary AML group is not significantly different from that of the primary ALL group (P = 0.784), which indicates that the expression level of the SMIM3 gene can be used for auxiliary diagnosis of acute leukemia.

Sequence listing

<110> first subsidiary Hospital of Zhengzhou university

<120> primer probe set, kit and method for quantitatively detecting SMIM3 gene expression level

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

tcatcatgac ctcgttgttg ct 22

<210>2

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ctcaaacagc cccactaagg at 22

<210>3

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

actgcagtaa tcatctatcg catgcggac 29

<210>4

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

tggagataac actctaagca taactaaagg t 31

<210>5

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gatgtagttg cttgggaccc a 21

<210>6

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ccatttttgg tttgggcttc acaccatt 28

<210>7

<211>2344

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

acactactgg gctccaagac tgctcaaggt ctcactgata gtcaaggctt gtgctccttt 60

ttttcagaag agtaagatta aagaaaacca ctgtgaatta aaaagtgtgg gtgccaacat 120

gggacgggag tcccccctca ctccatggat gacatagagg gggcagaaga ttacagaatt 180

ggcattgtcc tgcgtggaag ctgggccacc cacagtggcg tgggaagcct ctcagatgct 240

ggattctaat gggctcttga tcaccttgga ttgggctatt tcattgttat cacaaaataa 300

acaggatgct ccaagtcatg ttatggcaga gaaccaacca gcttcacact ggtcctctaa 360

accaatcctc acaacaggac tgggagacag gtgttacctt tcccacttta cagagaatga 420

aacagagtgg caaagcctcc gaaggaccct acacttcgga catcgcaaag caggatctga 480

gtcccggctc ctctgtccaa acctacttgctaggctttct ttcccatgtc tactctatag 540

ctggaaaggt cgtggaggac acattttagg ccaaccctct cggtttacaa tccagagagg 600

ggagaccctc agaagccaag cgacatgtcc acggctacgc ggcgagtgtg tggcaacgtg 660

gaaggggagc ccgagacgcc ctggtctctc ccttctctcg caggttcctt tctccccgaa 720

cgcagcccgc aggggacgct ggaggaggag ctgagctgga gttgccgggg ccccgggacc 780

gggcgttccg ggggcggtcc ccagcagccg cgcattccag agccagcagc gcgtcctggc 840

cgctcctgcg ctctcccgcc tcccggggct cggaggagcc ggggcacgtt ccaggagctg 900

cctagggctg aggttccagg cctgggggtc gcttccagct gccagatccc gtgcagtcct 960

ggggaccctg agaagcaccg agccatccct gacccaggaa ctttccgcag actcgccgcc 1020

atctgggagt gaagcaacat ggatgcagtc agccaagtcc ccatggaagt cgtgcttccc 1080

aagcacatcc tggatatctg ggttattgtc ctcatcatcc tggccaccat tgtcatcatg 1140

acctcgttgt tgctgtgccc agccactgca gtaatcatct atcgcatgcg gactcatccg 1200

atccttagtg gggctgtttg agagcctccc aagagggccg ggtgagggat gaggacaggc 1260

atcctatccc cagcctcttc ctgtcttcag aaaagcagca ggagggactt tggggcatgg 1320

acctgagttc tggttttgat tctgccacga gccagctgtg tgaatttggt caagggacct 1380

aactctctga gttccaggtt ccttatcttt caaatgggga tggtgatccc tgccctttct 1440

acctcatagg gatgtgagaa ccacctgact tagtggatgt gaaagctgtt tgtgatcagt 1500

aaagctacca cagatataag ggtgttatgc tgaatcctga gaagctttca agaaccagag 1560

aacctgattg ctgatgatgg ccttaaaggt ggtgagggag atactgggggcagagcagac 1620

tttgccagtg cccctcaggt caaaccaagc caagagcacc ctgtccccat tccaaggggc 1680

cagcagcact ttggcccaaa gtattttctt taaggtgcca ttccttcatg ttttctcagt 1740

ttggagggtg atgggtagag ctttccagaa ccttctccat tccagaatct ctgcccctgt 1800

gtaatctgaa ggaaggctgt gccatctttg ggcactgcca agggagttgg ggtgatgggc 1860

ttctttctgc actggagtct cacatctgtt agctttgaca ctcaagcaat gttggaaaat 1920

gcagggtgac tgagttccct gcccagcttt cgggatctct ggcccccatc cccttgtgtg 1980

tgtccctctg cccagctcct gctgtaatta gctccacgtg tacccccttc actccctccc 2040

accagctctg cagccagcct atggcaatta tattttaaga ggtgttccca ggacttttgg 2100

gacctactaa aacaatgatg gttattttag atgtgatgat ttatatttat gtagagatat 2160

ttctggacca ctcaagctct tcgataccaa aatcaggagc atcttgggat ttattaaatt 2220

atgtaagaag atagcacaga tatcgggata ttattgtgtg aaaatgctgc ttttactttg 2280

atgtgatctc attgatgtac acaaccaagt tccaataaag tgctagaatg tgcaaaaaaa 2340

aaaa 2344

<210>8

<211>5578

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gttaacaggc gcgtcccggc caggcggaga cgcggccgcg gccatgggcg ggcgcgggcg 60

cgcggggcgg cggtgagggc ggctggcggg gccgggggcg ccgggggggc gcgcgggccg 120

agccgggcct gagccgggcc cgcggaccga gctgggagag gggttccggc ccccgacgtg 180

ctggcgcggg aaaatgttgg agatctgcct gaagctggtg ggctgcaaat ccaagaaggg 240

gctgtcctcg tcctccagct gttatctgga agaagccctt cagcggccag tagcatctga 300

ctttgagcct cagggtctga gtgaagccgc tcgttggaac tccaaggaaa accttctcgc 360

tggacccagt gaaaatgacc ccaacctttt cgttgcactg tatgattttg tggccagtgg 420

agataacact ctaagcataa ctaaaggtga aaagctccgg gtcttaggct ataatcacaa 480

tggggaatgg tgtgaagccc aaaccaaaaa tggccaaggc tgggtcccaa gcaactacat 540

cacgccagtc aacagtctgg agaaacactc ctggtaccat gggcctgtgt cccgcaatgc 600

cgctgagtat ctgctgagca gcgggatcaa tggcagcttc ttggtgcgtg agagtgagag 660

cagtcctggc cagaggtcca tctcgctgag atacgaaggg agggtgtacc attacaggat 720

caacactgct tctgatggca agctctacgt ctcctccgag agccgcttca acaccctggc 780

cgagttggtt catcatcatt caacggtggc cgacgggctc atcaccacgc tccattatcc 840

agccccaaag cgcaacaagc ccactgtcta tggtgtgtcc cccaactacg acaagtggga 900

gatggaacgc acggacatca ccatgaagca caagctgggc gggggccagt acggggaggt 960

gtacgagggc gtgtggaaga aatacagcct gacggtggcc gtgaagacct tgaaggagga 1020

caccatggag gtggaagagt tcttgaaaga agctgcagtc atgaaagaga tcaaacaccc 1080

taacctggtg cagctccttg gggtctgcac ccgggagccc ccgttctata tcatcactga 1140

gttcatgacc tacgggaacc tcctggacta cctgagggag tgcaaccggc aggaggtgaa 1200

cgccgtggtg ctgctgtaca tggccactca gatctcgtca gccatggagt acctggagaa 1260

gaaaaacttc atccacagag atcttgctgc ccgaaactgc ctggtagggg agaaccactt 1320

ggtgaaggta gctgattttg gcctgagcag gttgatgaca ggggacacct acacagccca 1380

tgctggagcc aagttcccca tcaaatggac tgcacccgag agcctggcct acaacaagtt 1440

ctccatcaag tccgacgtct gggcatttgg agtattgctt tgggaaattg ctacctatgg 1500

catgtcccct tacccgggaa ttgacctgtc ccaggtgtat gagctgctag agaaggacta 1560

ccgcatggag cgcccagaag gctgcccaga gaaggtctat gaactcatgc gagcatgttg 1620

gcagtggaat ccctctgacc ggccctcctt tgctgaaatc caccaagcct ttgaaacaat 1680

gttccaggaa tccagtatct cagacgaagt ggaaaaggag ctggggaaac aaggcgtccg 1740

tggggctgtg agtaccttgc tgcaggcccc agagctgccc accaagacga ggacctccag 1800

gagagctgca gagcacagag acaccactga cgtgcctgag atgcctcact ccaagggcca 1860

gggagagagc gatcctctgg accatgagcc tgccgtgtct ccattgctcc ctcgaaaaga 1920

gcgaggtccc ccggagggcg gcctgaatga agatgagcgc cttctcccca aagacaaaaa 1980

gaccaacttg ttcagcgcct tgatcaagaa gaagaagaag acagccccaa cccctcccaa 2040

acgcagcagc tccttccggg agatggacgg ccagccggag cgcagagggg ccggcgagga 2100

agagggccga gacatcagca acggggcact ggctttcacc cccttggaca cagctgaccc 2160

agccaagtcc ccaaagccca gcaatggggc tggggtcccc aatggagccc tccgggagtc 2220

cgggggctca ggcttccggt ctccccacct gtggaagaag tccagcacgc tgaccagcag 2280

ccgcctagcc accggcgagg aggagggcgg tggcagctcc agcaagcgct tcctgcgctc 2340

ttgctccgcc tcctgcgttc cccatggggc caaggacacg gagtggaggt cagtcacgct 2400

gcctcgggac ttgcagtcca cgggaagaca gtttgactcg tccacatttg gagggcacaa 2460

aagtgagaag ccggctctgc ctcggaagag ggcaggggag aacaggtctg accaggtgac 2520

ccgaggcaca gtaacgcctc cccccaggct ggtgaaaaag aatgaggaag ctgctgatga 2580

ggtcttcaaa gacatcatgg agtccagccc gggctccagc ccgcccaacc tgactccaaa 2640

acccctccgg cggcaggtca ccgtggcccc tgcctcgggc ctcccccaca aggaagaagc 2700

tggaaagggc agtgccttag ggacccctgc tgcagctgag ccagtgaccc ccaccagcaa 2760

agcaggctca ggtgcaccag ggggcaccag caagggcccc gccgaggagt ccagagtgag 2820

gaggcacaag cactcctctg agtcgccagg gagggacaag gggaaattgt ccaggctcaa 2880

acctgccccg ccgcccccac cagcagcctc tgcagggaag gctggaggaa agccctcgca 2940

gagcccgagc caggaggcgg ccggggaggc agtcctgggc gcaaagacaa aagccacgag 3000

tctggttgat gctgtgaaca gtgacgctgc caagcccagc cagccgggag agggcctcaa 3060

aaagcccgtg ctcccggcca ctccaaagcc acagtccgcc aagccgtcgg ggacccccat 3120

cagcccagcc cccgttccct ccacgttgcc atcagcatcc tcggccctgg caggggacca 3180

gccgtcttcc accgccttca tccctctcat atcaacccga gtgtctcttc ggaaaacccg 3240

ccagcctcca gagcggatcg ccagcggcgc catcaccaag ggcgtggtcc tggacagcac 3300

cgaggcgctg tgcctcgcca tctctaggaa ctccgagcag atggccagcc acagcgcagt 3360

gctggaggcc ggcaaaaacc tctacacgtt ctgcgtgagc tatgtggatt ccatccagca 3420

aatgaggaac aagtttgcct tccgagaggc catcaacaaa ctggagaata atctccggga 3480

gcttcagatc tgcccggcga cagcaggcag tggtccagcg gccactcagg acttcagcaa 3540

gctcctcagt tcggtgaagg aaatcagtga catagtgcag aggtagcagc agtcaggggt 3600

caggtgtcag gcccgtcgga gctgcctgca gcacatgcgg gctcgcccat acccgtgaca 3660

gtggctgaca agggactagt gagtcagcac cttggcccag gagctctgcg ccaggcagag 3720

ctgagggccc tgtggagtcc agctctacta cctacgtttg caccgcctgc cctcccgcac 3780

cttcctcctc cccgctccgt ctctgtcctc gaattttatc tgtggagttc ctgctccgtg 3840

gactgcagtc ggcatgccag gacccgccag ccccgctccc acctagtgcc ccagactgag 3900

ctctccaggc caggtgggaa cggctgatgt ggactgtctt tttcattttt ttctctctgg 3960

agcccctcct cccccggctg ggcctccttc ttccacttct ccaagaatgg aagcctgaac 4020

tgaggccttg tgtgtcaggc cctctgcctg cactccctgg ccttgcccgt cgtgtgctga 4080

agacatgttt caagaaccgc atttcgggaa gggcatgcac gggcatgcac acggctggtc 4140

actctgccct ctgctgctgc ccggggtggg gtgcactcgc catttcctca cgtgcaggac 4200

agctcttgat ttgggtggaa aacagggtgc taaagccaac cagcctttgg gtcctgggca 4260

ggtgggagct gaaaaggatc gaggcatggg gcatgtcctt tccatctgtc cacatcccca 4320

gagcccagct cttgctctct tgtgacgtgc actgtgaatc ctggcaagaa agcttgagtc 4380

tcaagggtgg caggtcactg tcactgccga catccctccc ccagcagaat ggaggcaggg 4440

gacaagggag gcagtggcta gtggggtgaa cagctggtgc caaatagccc cagactgggc 4500

ccaggcaggt ctgcaagggc ccagagtgaa ccgtcctttc acacatctgg gtgccctgaa 4560

agggcccttc ccctccccca ctcctctaag acaaagtaga ttcttacaag gccctttcct 4620

ttggaacaag acagccttca cttttctgag ttcttgaagc atttcaaagc cctgcctctg 4680

tgtagccgcc ctgagagaga atagagctgc cactgggcac ctgcgcacag gtgggaggaa 4740

agggcctggc cagtcctggt cctggctgca ctcttgaact gggcgaatgt cttatttaat 4800

taccgtgagt gacatagcct catgttctgt gggggtcatc agggagggtt aggaaaacca 4860

caaacggagc ccctgaaagc ctcacgtatt tcacagagca cgcctgccat cttctccccg 4920

aggctgcccc aggccggagc ccagatacgg gggctgtgac tctgggcagg gacccggggt 4980

ctcctggacc ttgacagagc agctaactcc gagagcagtg ggcaggtggc cgcccctgag 5040

gcttcacgcc gggagaagcc accttcccac cccttcatac cgcctcgtgc cagcagcctc 5100

gcacaggccc tagctttacg ctcatcacct aaacttgtac tttatttttc tgatagaaat 5160

ggtttcctct ggatcgtttt atgcggttct tacagcacat cacctctttg cccccgacgg 5220

ctgtgacgca gccggaggga ggcactagtc accgacagcg gccttgaaga cagagcaaag 5280

cgcccaccca ggtcccccga ctgcctgtct ccatgaggta ctggtccctt ccttttgtta 5340

acgtgatgtg ccactatatt ttacacgtat ctcttggtat gcatctttta tagacgctct 5400

tttctaagtg gcgtgtgcat agcgtcctgc cctgccccct cgggggcctg tggtggctcc 5460

ccctctgctt ctcggggtcc agtgcatttt gtttctgtat atgattctct gtggtttttt 5520

ttgaatccaa atctgtcctc tgtagtattt tttaaataaa tcagtgttta cattagaa 5578

Claims (5)

1. A primer probe group for quantitatively detecting the expression level of SMIM3 gene, which is characterized in that: the paint comprises a component A and a component B, wherein the component A comprises:

upstream primer SMIM3-FP of nucleotide sequence shown in SEQ ID NO.1

A downstream primer SMIM3-RP of the nucleotide sequence shown in SEQ ID NO.2,

and a probe SMIM3-probe containing a nucleotide sequence shown in SEQ ID NO.3, wherein the 5 'end of the probe SMIM3-probe is marked with a FAM luminous group, and the 3' end is marked with a fluorescence quenching group BHQ;

the component B comprises:

an upstream primer ABL1-FP of the nucleotide sequence shown in SEQ ID NO.4,

a downstream primer ABL1-RP of the nucleotide sequence shown in SEQ ID NO.5,

and a probe ABL1-probe containing a nucleotide sequence shown in SEQ ID NO.6, wherein the 5 'end of the probe ABL1-probe is marked with FAM luminous group, and the 3' end is marked with fluorescence quenching group TAMRA.

2. A kit for quantitatively detecting the expression level of SMIM3 gene, which is characterized in that: comprising the primer probe set of claim 1, a positive control plasmid comprising the SMIM3 gene fragment set forth in SEQ ID No.7, and an internal control plasmid comprising the ABL1 gene fragment set forth in SEQ ID No. 8.

3. The kit for quantitatively detecting the expression level of SMIM3 gene according to claim 2, wherein: the molar ratio of the upstream primer SMIM3-FP, the downstream primer SMIM3-RP and the probe SMIM3-probe in the component A is 3:3:2, and the molar ratio of the upstream primer ABL1-FP, the downstream primer ABL1-RP, the probe ABL1-probe in the component B is 3:3: 2.

4. The kit for quantitatively detecting the expression level of SMIM3 gene according to claim 2, wherein: the positive control plasmid is a positive plasmid in which a SMIM3 gene fragment shown in SEQ ID No.7 is inserted into the XhoI/KpnI enzyme cutting site of the GV219 plasmid, and the internal reference plasmid is an ABL1 gene fragment shown in SEQ ID No.8 is inserted into the XhoI/KpnI enzyme cutting site of the GV219 plasmid.

5. A method for quantitatively detecting the expression level of SMIM3 gene, which is characterized by comprising the following steps: the method comprises the following steps:

firstly, extracting RNA in a sample to be detected, and performing reverse transcription to obtain cDNA;

secondly, drawing a fluorescence standard curve of the positive control plasmid and a fluorescence standard curve of the internal reference control plasmid;

and thirdly, taking the cDNA obtained in the first step as a template, respectively adding the component A and the component B for amplification reaction, respectively carrying out RQ-PCR detection, obtaining the cycle number of the SMIM3 gene segment and the cycle number of the ABL1 gene segment in the sample, respectively calculating by using the fluorescence standard curve of the positive control plasmid and the fluorescence standard curve of the internal reference control plasmid in the second step to obtain the copy number of the SMIM3 gene segment and the copy number of the ABL1 gene in the sample, and obtaining the ratio of the copy number of the SMIM3 gene segment to the copy number of the ABL1 gene in the sample, namely the SMIM3 gene expression quantity in the sample.

Images