CN111100877A

CN111100877A - Preparation method and application of hypertrophic cardiomyopathy mouse model

Info

Publication number: CN111100877A
Application number: CN201811249586.XA
Authority: CN
Inventors: 杜杰; 张晓萍; 刘旭霞
Original assignee: BEIJING INSTITUTE OF HEART LUNG AND BLOOD VESSEL DISEASES
Current assignee: BEIJING INSTITUTE OF HEART LUNG AND BLOOD VESSEL DISEASES
Priority date: 2018-10-25
Filing date: 2018-10-25
Publication date: 2020-05-05
Anticipated expiration: 2038-10-25
Also published as: CN111100877B

Abstract

The invention discloses a preparation method and application of a hypertrophic cardiomyopathy mouse model. The method of the invention comprises the following steps: (1) construction of CRISPR/Cas9 gene editing plasmid and identification of in vitro shearing efficiency, (2) construction and genotyping of MYBPC3T2535G knock-in mice, and (3) phenotypic confirmation of hypertrophic cardiomyopathy of MYBPC3T2535G knock-in mice. The invention establishes a heterozygote-form hypertrophic cardiomyopathy mouse model by using a CRISPR/Cas9 gene editing technical method, and provides a new research platform for researching the pathogenic mechanism and drug development of hypertrophic cardiomyopathy.

Description

Preparation method and application of hypertrophic cardiomyopathy mouse model

Technical Field

The invention belongs to the technical field of animal genetic engineering, and particularly relates to a preparation method and application of a hypertrophic cardiomyopathy mouse model.

Background

Hypertrophic Cardiomyopathy (HCM) is a myocardial disease characterized by myocardial hypertrophy and mainly shows that the myocardial asymmetric hypertrophy, the diastolic filling of the left ventricle is limited, the compliance of the ventricular wall is reduced, echocardiography prompts that the left ventricular wall thickness or the ventricular septum thickness is more than or equal to 15mm, or the thickness of a patient with definite family history is more than or equal to 13mm, usually without the expansion of the left ventricular cavity, and the left ventricular thickening caused by load increase such as hypertension, aortic stenosis and congenital infravalvular septum of the aorta is required to be eliminated. Clinically, patients with hypertrophic cardiomyopathy often have severe symptoms, are easy to suffer from exertional dyspnea, angina pectoris, syncope, atrial or ventricular arrhythmia and sudden death, the incidence rate of HCM is about 1/500, and the patients cause severe burden to families and society and are the most common cause of the sudden death of teenagers.

HCM is a genetic cardiovascular disease, mostly inherited in autosomal dominant form 50% of HCM patients are genetically predisposed, sporadic cases increase year by year, and The causative genes reported to be associated with The disease are mainly more than 10 Cardiac sarcomere genes, totaling several hundred mutation sites, The current treatment options for HCM are drug-based therapies aimed at alleviating The associated symptoms and slowing down The progression of The disease, but not for The genetic causes of HCM, until now, more than 16 different genes, more than 1400 mutations have been identified as The underlying causes of HCM, and in 2017 Mohamed IA et al report The number of mutations in The Hypertrophic Cardiomyopathy-associated proteins, genes and each gene (The Role of Cardiac Myosin Binding protein C3in Hypertrophic myocardial pathophysiology-Progress and Noopcodes for myoglobin C6335 and mychromatographic BPH 7), most of The mutated genes are found in My c-Binding protein C and My 6335 coding heavy chain Myosin B7.

MYBPC (myosin binding protein C) consists of 3 subtypes of MYBPC3, which are present in the bones MYBPC1 and MYBPC2, as well as in the myocardium. The cDNA of MYBPC3in the myocardium of mice consists of 35 exons, including 7 immunoglobulin (IgI) domains, 3 fibronectin type III (FnIII) domains (C1-10), a 105 residue region between C1-C2 (called MYBPC motif) and proline/alanine. The rich (PA) region near the N-terminus, domain C5 carries an added proline-rich 25 amino acid insertion in addition to the 3 phosphorylation sites in the Ig domain (C0) at the N-terminus and the b-sheet rich MYBPC motif. The N-terminal C0 and C1 domains may interact with the S2 region of myosin (myosin) and actin (actin) through binding bases, the C-terminal being involved in the anchoring of MYBPC3 to thick silk (Thin filament). MYBPC3 is thought to be involved in filament assembly and regulation of myocardial contraction by modifying the actin-myosin association. Ca²⁺Calponin kinase II (C)Phosphorylation of MYBPC3 by aMKII), Protein Kinase A (PKA), and Protein Kinase C (PKC) is essential for regulating actin-myosin binding and sarcomere contractility (Mohamed IA, et al, The Role of Cardiac myolytic binding Protein C3in Hypertropic cardio-myopathicity-Progress and NovelTherapeutic opportunities. J Cell physiology.2017 Jul; 232(7):1650-1659.).

The cause of cardiomyopathy is not yet known. In the past decades, a large number of mutation sites were discovered and prepared into transgenic mice, and there were tens of studies in which the myocardial hypertrophy phenotype appeared. With the development of genetic engineering technology, the success of gene knock-in mouse preparation makes it possible to reproduce human cardiomyopathy gene mutation mice, which is not only helpful to understand the relationship between genotype and clinical phenotype and to discuss the mechanism of diseases caused by these mutation sites, but also provides animal models for the drug development of cardiomyopathy.

In 2008, a preparation method of a MYBPC3 gene knock-in mouse is reported, wherein a gene recombination method is used for introducing G-to-A conversion on the last nucleotide of exon 6 of a MYBPC3 gene in the mouse through a gene targeting technology by using a Cre/lox system. Both heterozygous and homozygous MYBPC3 survived well. However, homozygous MYBPC3 mice developed HCM, and heterozygous MYBPC3 mice did not exhibit the HCM phenotype.

The CRISPR/Cas9 gene editing technology is a technology for editing a target gene by an RNA-guided Cas9 nuclease, and can complete the editing of deleting and inserting a DNA nucleotide sequence. The CRISPR/Cas9 gene editing technology has progressed rapidly since the first report in 2013. Compared with a gene recombination technology, the CRISPR/Cas9 gene editing technology is more convenient and can complete gene editing more quickly.

Disclosure of Invention

The technical problem to be solved by the invention is to obtain a myocardial hypertrophy mouse model by using a CRISPR/Cas9 gene editing technology.

In a first aspect, the invention provides a method for preparing a mouse model with hypertrophic cardiomyopathy.

The preparation method of the mouse model with hypertrophic cardiomyopathy protected by the invention comprises the following steps (1) or (2):

the (1) comprises the following steps: carrying out gene knock-in on a T2535G locus of a MYBPC3 gene of a mouse, and further mutating the T2535G locus of the MYBPC3 gene on one of two homologous chromosomes of the mouse from a base T to a base G to obtain a hypertrophic cardiomyopathy mouse model;

the (2) comprises the following steps: carrying out gene knock-in on a T2535G locus of a MYBPC3 gene of a mouse, and further mutating the T2535G loci of the MYBPC3 gene on two homologous chromosomes of the mouse from a base T to a base G to obtain a hypertrophic cardiomyopathy mouse model.

In the method, the T2535G site of the MYBPC3 gene is located at the 113 th position of the mouse chromosome 2 exon 24, namely the 2535 th position of a cDNA sequence of the MYBPC3 gene.

In the above method, the CRISPR/Cas9 system comprises a gRNA; the target sequence of the gRNA is a DNA molecule shown in SEQ ID NO.1 or SEQ ID NO. 2.

Further, the method comprises the step of using a mixture of gRNA, Cas9mRNA and donor DNA;

the gRNA is an RNA molecule obtained by in vitro transcription by taking a DNA molecule shown in SEQ ID NO.19 or SEQ ID NO.20 as a template;

the Cas9mRNA can be obtained through purchase or can be prepared by using conventional technical means in the prior art, and the Cas9mRNA has a cap and a polyA tail structure, can be used together with in vitro transcription gRNA, and realizes the editing of a target point.

The donor DNA sequence is shown as SEQ ID NO. 5.

Still further, the method may comprise the steps of:

1) mixing the gRNA, the Cas9mRNA and the donor DNA to obtain an injection;

2) injecting the injection into the cell cytoplasm of the mouse single-cell embryo by adopting a microinjection method to obtain an injected embryo;

3) transplanting the injected embryo into an oviduct of a surrogate mother mouse, and obtaining an F0 surrogate mouse after the development is finished;

4) and continuously breeding the F0 mouse generation for multiple generations, and identifying and obtaining a hypertrophic cardiomyopathy mouse model from offspring.

In the step 1), the gRNA and the Cas9mRNA can recognize and cut DNA near the T2535G site of the MYBPC3 gene in the mouse genome DNA at fixed points, then the donor DNA is randomly integrated to the cutting site through a DNA repair process, and finally the point mutation of T2535G appears on the MYBPC3 gene of the mouse genome DNA is constructed.

The mass ratio of the gRNA, the Cas9mRNA, and the donor DNA can be 1: (2-2.5): (2-2.5). In a specific embodiment of the invention, the mass ratio of the gRNA, the Cas9mRNA and the donor DNA is 1: 2: 2.

in the 2), the donor of the mouse single-cell embryo may be a C57BL/6J mouse.

The step of culturing the embryo after the injection in a mouse embryo culture medium is further included between the step 2) and the step 3);

in the step 3), the live single-cell embryo is transplanted into the ampulla of the oviduct of the female mouse which appears with the pseudopregnancy after the embolism for 0.5 day; after the in vivo development of the surrogate mother mouse is completed, the surrogate mother mouse farads to obtain an F0 mouse; the F0 mouse is subjected to molecular identification to obtain a MYBPC3T2535G knock-in heterozygous mouse.

The primer pair for molecular identification consists of a single-stranded DNA molecule shown in SEQ ID NO.3 and a single-stranded DNA molecule shown in SEQ ID NO. 4. And (3) identification: the MYBPC3T2535G gene knock-in hybrid mouse is a hybrid mutant mouse obtained by mutating a MYBPC3 gene T2535G locus on one of two homologous chromosomes of a wild-type mouse from a base T to a base G and keeping the base of a MYBPC3 gene T2535G locus on the other homologous chromosome unchanged.

15-25 embryos can be transplanted into each generation of pregnant female mice.

The surrogate mother mouse can be a BALB/c mouse.

In the step 4), the F0 mouse is continuously propagated for multiple generations, and the method for identifying and obtaining the hypertrophic cardiomyopathy mouse model from the offspring is as follows: hybridizing an F0-generation MYBPC3T2535G gene knock-in heterozygous mouse with a C57BL/6J mouse to obtain an F1-generation mouse, identifying through the primer pair, selecting a mouse with the same genotype as the F0-generation MYBPC3T2535G gene knock-in heterozygous mouse from the F1-generation mouse, and hybridizing the mouse with the C57BL/6J mouse to obtain an F2-generation mouse; after F5 generations are propagated, the primer pair is adopted to carry out genotype identification on the F5-generation MYBPC3T2535G gene knock-in heterozygous mouse to obtain the F5-generation MYBPC3T2535G gene knock-in heterozygous mouse with the same genotype as the F0-generation MYBPC3T25 2535G gene knock-in heterozygous mouse, namely the hypertrophic cardiomyopathy mouse model.

In a second aspect, the invention provides a hypertrophic cardiomyopathy mouse model prepared according to the method.

In a third aspect, the invention features a product for use in preparing a mouse model of hypertrophic cardiomyopathy.

The product for preparing the hypertrophic cardiomyopathy mouse model comprises the gRNA, the Cas9mRNA and the donor DNA.

In the above product, the mass ratio of the gRNA, the Cas9mRNA, and the donor DNA may be 1: (2-2.5): (2-2.5).

In a fourth aspect, the invention provides a new use of the method or the hypertrophic cardiomyopathy mouse model or the product.

The invention protects the application of the method or the mouse model with hypertrophic cardiomyopathy or the product in developing and/or screening substances for treating hypertrophic cardiomyopathy.

Further, the substance may be a drug or a protein.

The invention has the beneficial effects that:

1) the invention adopts CRISPR/Cas9 gene editing technology to construct a myocardial hypertrophy mouse model, which is simpler, quicker and higher in success rate than the previously published gene recombination method.

2) The MYBPC3T2535G knock-in heterozygous mouse prepared by the CRISPR/Cas9 gene editing technology has a cardiac hypertrophy phenotype at the age of 12 weeks, and compared with the HCM phenotype of only a homozygous mouse reported in the previous published article, the MYBPC3T2535G knock-in heterozygous mouse can well repeat human HCM diseases, and the MYBPC3T2535 is an important disease animal model.

3) The invention establishes a heterozygote-form myocardial hypertrophy mouse model by using CRISPR/Cas9 gene editing technology, and provides a new research platform for researching pathogenic mechanism and drug development of hypertrophic cardiomyopathy.

The MYBPC3T2535G gene knock-in mouse model is prepared by using CRISPR/Cas9 gene editing technology. The heterozygous mouse phenotype of the MYBPC3T2535G knock-in mouse shows HCM, successfully reproduces the occurrence and development process of human HCM diseases, and provides an animal model for discussing the mechanism of diseases caused by mutation sites and the drug development of cardiomyopathy.

Drawings

FIG. 1 is a target design map of MYBPC3T 2535G.

FIG. 2 shows the genotyping of MYBPC3T2535G knock-in mice.

FIG. 3 shows heart/body weight ratio and heart/tibia length ratio of MYBPC3T2535G knock-in mice of different weeks of age.

Fig. 4 is a pathological section of a longitudinal section of a heart at 12 weeks of age of a MYBPC3T2535G knock-in mouse.

FIG. 5 shows the mRNA expression results of myocardial hypertrophy marker molecules in MYBPC3T2535G knock-in mice at 12 weeks of age.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

All animals in the following examples were bred and bred at the SPF (specific Pathologen free) grade laboratory animal center.

NIH/3T3 cells (mouse embryonic fibroblast cell line) in the following examples were purchased from cell banks of Chinese academy of sciences (Yueyanglu 320, 200031, Shanghai Xuhui area); the product number is GNM 6.

The C57BL/6J mice and BALB/C mice in the following examples were purchased from Beijing Huafukang Biotech GmbH.

The PX459 plasmid in the following examples, designated entirely as pSpCas9(BB) -2A-Puro V2.0, is available from Addgene, USA under the accession # 62988.

The T2535G site of the MYBPC3 gene in the examples described below is located at position 113 on exon 24 of mouse chromosome 2, i.e. position 2535 of the cDNA sequence of the MYBPC3 gene. The nucleotide at position T2535G of the MYBPC3 gene of wild-type mice is homozygous T, transformed from the human C2526G locus, and is described in the literature: liu X, Jiang T, PiaoC, Li X, Guo J, Zheng S, Zhang X, Cai T, Du J. screening Mutations of MYBPC3in114 unreported substrates with Hypertrophic Carbodynopathic Programming by Targeted delivery and New production sequencing Sci Rep.2015 Jun 19; 5: 11411.

Example 1 construction of CRISPR/Cas9 Gene editing plasmid and preparation of gRNA, Cas9mRNA and donor DNA

Construction of CRISPR/Cas9 gene editing plasmid

1. Selection of target sequence and synthesis of sgRNA single-stranded DNA sequence

(1) Selection of target sequences

A cutting target site of Cas9 is designed and searched according to a T2535G site of MYBPC3 gene by using an MIT's online CRISPR tool website (http:// CRISPR. MIT. edu /). The target sequences finally selected according to the scoring conditions of the MIT's online CRISPR tool website are as follows:

target sequence 1: 5'-cgatcatgcgcctcgcctcgTGG-3' (SEQ ID NO.1, score: 99);

target sequence 2: 5'-tgcgtagactcgcatctcatAGG-3' (SEQ ID NO.2, score: 88).

Target sequence 1 and target sequence 2 are shown in FIG. 1.

(2) Synthesis of sgRNA single-stranded DNA sequence

Single-stranded DNA sequences shown in a target sequence 1 and a target sequence 2 and a complementary single-stranded DNA sequence thereof are synthesized by Shanghai biological technology Limited company, and the enzyme cutting site of BbsI is added so as to facilitate the enzyme cutting connection to PX459 plasmid. The specific sequence is as follows:

target sequences 1-S: 5'-CACCcgaggcgaggcgcatgatcg-3', respectively;

target sequence 1-AS: 5'-cgatcatgcgcctcgcctcgCAAA-3', respectively;

target sequence 2-S: 5'-CACCatgagatgcgagtctacgca-3', respectively;

target sequence 2-AS: 5'-tgcgtagactcgcatctcatCAAA-3' are provided.

2. Plasmid construction

(1) Annealing of single stranded DNA

Annealing the target sequence 1-S and the target sequence 1-AS in a PCR instrument to obtain the double-stranded DNA A.

Annealing the target sequence 2-S and the target sequence 2-AS in a PCR instrument to obtain the double-stranded DNA B.

The annealing conditions were as follows: 30 minutes at 37 ℃; 95 degrees for 5 minutes and then 5 degrees per minute down to 25 degrees.

(2) Linearization of plasmids

The PX459 plasmid was cleaved with BbsI enzyme (available from NEB under stock No. NEB # R3539), incubated at 37 ℃ for 30 minutes to nick the PX459 plasmid, and then the BbsI enzyme was inactivated at 65 ℃ for 20 minutes to obtain a linearized PX459 plasmid.

(3) Connection of

Diluting the double-stranded DNA A and the double-stranded DNA B formed by annealing in the step (1) by 200 times respectively, and then connecting the double-stranded DNA A and the double-stranded DNA B with the linearized PX459 plasmid obtained in the step (2) respectively by using T7 ligase (purchased from NEB company, with the product number of NEB # M0318) to obtain recombinant plasmids PX459-sgRNA1 and PX459-sgRNA2 respectively.

The linking system is as follows: PX459(100ng) 2. mu.L, double-stranded DNA (double-stranded DNA A or double-stranded DNA B) 2. mu. L, T7 ligase buffer (10X) 2. mu. L, ATP (10mM) 1. mu. L, T7 ligase 0.5. mu.L, ddH₂O make up to 20. mu.L.

The ligation reaction conditions were as follows: ligation was performed at 25 degrees for 30 min and then T7 ligase was inactivated at 65 degrees for 10 min.

(4) Sequencing verification of recombinant plasmids

Recombinant plasmids PX459-sgRNA1 and PX459-sgRNA2 were transformed into E.coli Stbl3, respectively, and then plated with ampicillin-resistant plates to select monoclonal bacteria. Then adding the mixture into an LB liquid culture medium for amplification, and extracting plasmids. And sequencing the extracted plasmid.

The sequencing result shows that: both target sequence 1 and target sequence 2 have been successfully inserted into PX459 plasmid, respectively.

Secondly, detecting the target point shearing efficiency and confirming the shearing site

1. Transfection of cells in vitro

Recombinant plasmid PX459-sgRNA1, recombinant plasmid PX459-sgRNA2 and empty plasmid PX459 were transfected into NIH/3T3 cells respectively with Lipofectamine 3000 transfection reagent (purchased from Life Technologies, under the code of L3000001), and after 48 hours of transfection, more than 90% of the cells were observed to have green fluorescence by a fluorescence microscope, and when the transfection efficiency was 90%, the transfected cells were collected.

2. Extraction of genomic DNA

The transfected cells obtained in step 1 were collected and their genomic DNA was extracted.

3. Design of primers

Designing a high-specificity primer near a T2535G target point of MYBPC3 gene, wherein the primer sequence is as follows:

an upstream primer: 5'-atgtcccagatgctcctgcg-3' (SEQ ID NO. 3);

a downstream primer: 5'-cgtgtgtaatgcaaggcagttttcc-3' (SEQ ID NO. 4).

4. PCR amplification

And (3) performing PCR amplification on the genome DNA template obtained in the step 2 by using the primer designed in the step 3 and high-fidelity DNA polymerase (purchased from Nanjing Nuojingzu Biotech company, with the product number of P211) to obtain a PCR product with the size of 520bp and containing the T2535G target fragment, and purifying the PCR product.

5. Enzyme digestion

200ng of the purified 520bp PCR product was denatured, cleaved with T7 endonuclease (available from NEB, Inc., having NEB # M0302L), and subjected to agarose gel electrophoresis. Since the T7 endonuclease recognizes and cleaves an incompletely matched DNA fragment, a DNA sequence that has been cleaved by the CRISPR/Cas9 gene editing system can be recognized and cleaved by the T7 endonuclease.

6. Sequencing identification

The PCR product was subjected to sanger sequencing after gel cutting and purification. After the sequencing fragment is aligned with the original genomic sequence, the cleavage site is confirmed.

The specificity of the targeting identification primer and the feasibility of enzyme digestion and sequencing identification are confirmed through enzyme digestion and sequencing identification.

Design and synthesis of trinor and Donor sequence

Designing a donor sequence according to the sgRNA sequence, wherein the designed donor sequence is as follows: 5'-agctacaggtggatgaggctcaactttgatctgctgcgggagctgagccacgaggcgaggcgcatgatcg agggtgtagcctaGgagatgcgagtctacgcagtcaatgccgtgggaatgtccaggccca-3' (SEQ ID NO.5), wherein the capital G is the target site for which mutation is desired. The donor sequence was synthesized by Shanghai Biotech, Inc.

Preparation of tetra, gRNA

1. Preparation of in vitro transcription template of gRNA

And (3) carrying out PCR amplification on the genomic DNA template obtained in the step (2) by respectively adopting MYBPC3-T7-S1/T7-gRNA-R and MYBPC3-T7-S2/T7-gRNA-R primers to respectively obtain an in-vitro transcription template of the gRNA, wherein the sequences of the primers are as follows (the upper case partial sequence is a target sequence):

MYBPC3-T7-S1： 5’-ttaatacgactcactataggTGCGTAGACTCGCATCTCATgttttagagctagaaatagc-3’(SEQ ID NO.6)；

MYBPC3-T7-S2： 5’-ttaatacgactcactataggCGATCATGCGCCTCGCCTCGgttttagagctagaaatagc-3’(SEQ ID NO.7)；

T7-gRNA-R：5’-aaaagcaccgactcggtgcc-3’(SEQ ID NO.8)。

the PCR product sequence of MYBPC3-T7-S1/T7-gRNA-R primer pair is specifically as follows: 5'-ttaatacgactcactataggTGCGTAGACTCGCATCTCATgttttagagctagaaatagcgcaagttaaa ataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttt-3' (SEQ ID NO. 19);

the PCR product sequences of the MYBPC3-T7-S2/T7-gRNA-R primer pair are as follows: 5'-ttaatacgactcactataggCGATCATGCGCCTCGCCTCGgttttagagctagaaatagcgcaagttaaa ataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttt-3' (SEQ ID NO. 20).

2. In vitro transcription of gRNAs

The PCR products obtained in step 1 were used as in vitro transcription templates of grnas, and grnas were transcribed in vitro using T7 in vitro transcription kit (purchased from Ambion, inc., product number AM1334) to obtain grnas (gRNA1 and gRNA2), respectively, which were transcribed in vitro. The transcribed RNA was extracted with Trizol, and the in vitro transcribed gRNA was recovered and purified and dissolved in 20. mu.L of RNase-free sterile double distilled water and stored at-80 ℃ for further use.

Fifth, Cas9mRNA acquisition

Cas9mRNA (available from Sigma under the CAS9MRNA-1EA) has a cap and polyA tail structure and can be used with in vitro transcribed gRNAs.

Example 2 construction and genotyping of MYBPC3T2535G knock-in mice

First, construction of MYBPC3T2535G knock-in mouse

MYBPC3T2535G knock-in mice were constructed based on grnas (gRNA1 and gRNA2), Cas9mRNA and donor DNA prepared in steps three, four and five of example 1, according to the method in the experimental manual for mouse embryo manipulation. The method comprises the following specific steps:

1. c57BL/6J mouse super-volleyball

Male mice, 4 at 10 weeks of age, and female mice, 12 at 6 weeks of age. Female mice were 13: pregnant mare serum gonadotropin PMSG (7.5 IU/mouse) was injected at 00 days 13: 00 injections of HCG (7.5 IU/mouse), day 17: 003 female mice and 1 male mouse are combined in cages, 8: 00-9: 00 female mice were examined for vaginal emboli, and several hundred 0.5 day embryos from C57BL/6J mice were punched out of the oviducts of the female mice.

2. Prokaryotic injection

The gRNA solution (gRNA1 solution or gRNA2 solution), Cas9mRNA solution, and donor DNA solution (solvents of each solution were sterile double distilled water) were mixed well to give final concentrations of gRNA (gRNA1 or gRNA2), Cas9mRNA, and donor DNA of 50 ng/. mu.l, 100 ng/. mu.l, and 100 ng/. mu.l, respectively, to obtain injections. An injection of exogenous mixed RNA and DNA was injected into the cytoplasm of C57BL/6J mouse zygote, followed by injection into mouse embryo culture medium (purchased from Millipore corporation,

m2Medium (1X), Liquid, w Phenol Red, cat # MR-015-D). Exogenous gRNA1 or gRNA2 and Cas9mRNA can cut DNA near the T2535G site of MYBPC3 gene on mouse chromosome 2 at fixed points, and then random integration donor DNA is carried out to the cutting site through a DNA repair process, so that the point mutation of T2535G appears on the MYBPC3 gene of the finally constructed mouse genome DNA.

3. Embryo transfer

After 6 hours of culture, the survival rate of the embryo cells was observed, and the live embryos were transplanted into the ampulla of the oviduct of a female mouse (surrogate mother mouse) with a pseudo-pregnant plug receptor for 0.5 day, and the number of fertilized eggs (embryos) transplanted to each mouse was 25 embryos. Recipient mice born 21 days after transplantation to give F0 generation mice.

Molecular characterization of MYBPC3T2535G knock-in mice

1. Extraction of genomic DNA

The weaned mice were tailed and the resulting tissue was used for genomic DNA extraction, while wild-type mice were used as controls.

2. PCR amplification

And (3) performing PCR amplification by using the extracted genome DNA as a template and adopting an upstream primer and a downstream primer to obtain a PCR product. The primer sequences are as follows:

an upstream primer: 5'-atgtcccagatgctcctgcg-3' (SEQ ID NO. 3);

a downstream primer: 5'-cgtgtgtaatgcaaggcagttttcc-3' (SEQ ID NO.4)

3. Electrophoresis and sequencing

And (3) detecting a PCR product by electrophoresis, and sending the PCR product to Shanghai to carry out sequencing, thereby finally obtaining a MYBPC3T2535G knock-in heterozygous mouse (F0 generation). The electrophoretogram and sequencing results of the PCR products are shown in FIG. 2. From the electropherogram it appears that: the length of PCR products of MYBPC3T2535G knock-in hybrid mice and wild-type mice is 520 bp. The sequencing result shows that: the sequences of PCR products of MYBPC3T2535G gene knock-in hybrid mice are shown as SEQ ID NO.21 and SEQ ID NO.22, and the sequence of PCR products of wild type mice is shown as SEQ ID NO. 22. As can be seen from the sequencing peak plots: the MYBPC3 gene T2535G locus on one of two homologous chromosomes of the MYBPC3T2535G knock-in heterozygous mouse is mutated from a base T to a base G (the base at the 304 th position of a PCR product is changed from T to G).

The MYBPC3T2535G gene knock-in hybrid mouse is a hybrid mutant mouse obtained by mutating a MYBPC3 gene T2535G locus on one of two homologous chromosomes of a wild-type mouse from a base T to a base G.

Example 3 phenotypic characterization of MYBPC3T2535G knock-in heterozygous mice

Propagation and genotype stability identification of MYBPC3T2535G gene knock-in heterozygous mice

Hybridizing F0-generation MYBPC3T2535G gene knock-in heterozygous mice obtained in example 2 with C57BL/6J mice to obtain F1-generation mice, selecting mice with the same genotype as the F0-generation MYBPC3T2535G gene knock-in heterozygous mice from the F1-generation mice according to the genotype identification method in example 2, and hybridizing the mice with the C57BL/6J mice to obtain F2-generation mice; after the F5 generation is propagated, the genotype identification is carried out on the F5 generation MYBPC3T25 2535G knock-in heterozygous mice, and the results show that: the genotype of the F5-generation MYBPC3T2535G gene knock-in hybrid mouse is consistent with that of the F0-generation MYBPC3T2535G gene knock-in hybrid mouse, and the genotype is stably inherited.

Phenotypic identification of MYBPC3T2535G knock-in heterozygous mice

F5 generation MYBPC3T2535G gene knock-in heterozygous mice and littermate control wild mice at different ages of weeks (4, 8, 12, 16, 24), hearts are taken, heart/body weight ratio (HW/BW), heart/tibia length ratio (HW/TL) are respectively calculated, and heart mediastinum and left ventricle hypertrophy are detected by HE staining of mouse heart pathology, and the specific detection steps refer to the methods in the documents of "Blankenburg R, β -myostatin heart chair variant Val606Met mice top mill hypertrophic calcium in mice heart pathology, and butyl exaerbates HCM phenol synthesis in nucleic acid other HCM mutation.

As a result, it was found that the MYBPC3T2535G gene knock-in heterozygous mice developed HCM symptoms at 12 weeks of age (fig. 3). Hypertrophy of the heart mediastinum and left ventricle was also shown by HE staining of mouse heart pathology (fig. 4).

Third, labeled molecule detection of myocardial hypertrophy

The relative expression levels of marker molecules ANP, BNP, β -MHC and SK-ACT of F5 generation MYBPC3T2535G gene knock-in heterozygous mice and littermate control wild mice at 8-week and 12-week ages are detected by real-time fluorescent quantitative PCR, and the primer sequences are as follows:

ANP-S：5’-ATCTGCCCTCTTGAAAAGCA-3’(SEQ ID NO.9)；

ANP-AS：5’-ACACACCACAAGGGCTTAGG-3’(SEQ ID NO.10)；

BNP-S：5’-TATCTGTCACCGCTGGGAGG-3’(SEQ ID NO.11)；

BNP-AS：5’-TTGTGAGGCCTTGGTCCTTC-3’(SEQ ID NO.12)；

β-MHC-S：5’-GCAGCAGAACCCACCCAAGT-3’(SEQ ID NO.13)；

β-MHC-AS：5’-ATAGGGGTTGACGGTGACGC-3’(SEQ ID NO.14)；

α-skeletal actin-S：5’-CCCCTGAGGAGCACCCGACT-3’(SEQ ID NO.15)；

α-skeletal actin-AS：5’-CGTTGTGGGTGACACCGTCCC-3’(SEQ ID NO.16)；

GAPDH-S：5’-GTGAAGGTCGGTGTGAACG-3’(SEQ ID NO.17)；

GAPDH-AS：5’-TCGTTGATGGCAACAATCTC-3’(SEQ ID NO.18)。

the results showed that the marker molecules for cardiac hypertrophy were significantly up-regulated at 12 weeks of age (fig. 5). It was further demonstrated that MYBPC3T2535G knock-in heterozygous mice develop HCM symptoms at 12 weeks of age.

Thus, MYBPC3T2535G knock-in heterozygous mice can serve as a mouse animal model of HCM disease after 12 weeks of age.

Sequence listing

<110> research institute of cardiovascular and cerebrovascular diseases in Beijing

Preparation method and application of <120> myocardial hypertrophy mouse model

<160>22

<170>PatentIn version 3.5

<210>1

<211>23bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

cgatcatgcg cctcgcctcg tgg 23

<210>2

<211>23bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tgcgtagact cgcatctcat agg 23

<210>3

<211>20bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgtcccaga tgctcctgcg 20

<210>4

<211>25bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

cgtgtgtaat gcaaggcagt tttcc 25

<210>5

<211>130bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

agctacaggt ggatgaggct caactttgat ctgctgcggg agctgagcca cgaggcgagg 60

cgcatgatcg agggtgtagc ctaggagatg cgagtctacg cagtcaatgc cgtgggaatg 120

tccaggccca 130

<210>6

<211>60bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ttaatacgac tcactatagg tgcgtagact cgcatctcat gttttagagc tagaaatagc 60

<210>7

<211>60bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ttaatacgac tcactatagg cgatcatgcg cctcgcctcg gttttagagc tagaaatagc 60

<210>8

<211>20bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

aaaagcaccg actcggtgcc 20

<210>9

<211>20bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

atctgccctc ttgaaaagca 20

<210>10

<211>20bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

acacaccaca agggcttagg 20

<210>11

<211>20bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

tatctgtcac cgctgggagg 20

<210>12

<211>20bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ttgtgaggcc ttggtccttc 20

<210>13

<211>20bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

gcagcagaac ccacccaagt 20

<210>14

<211>20bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

ataggggttg acggtgacgc 20

<210>15

<211>20bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

cccctgagga gcacccgact 20

<210>16

<211>21bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

cgttgtgggt gacaccgtcc c 21

<210>17

<211>19bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

gtgaaggtcg gtgtgaacg 19

<210>18

<211>20bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

tcgttgatgg caacaatctc 20

<210>19

<211>122bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

ttaatacgac tcactatagg tgcgtagact cgcatctcat gttttagagc tagaaatagc 60

gcaagttaaa ataaggctag tccgttatca acttgaaaaa gtggcaccga gtcggtgctt 120

tt 122

<210>20

<211>122bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

ttaatacgac tcactatagg cgatcatgcg cctcgcctcg gttttagagc tagaaatagc 60

gcaagttaaa ataaggctag tccgttatca acttgaaaaa gtggcaccga gtcggtgctt 120

tt 122

<210>21

<211>520bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

atgtcccaga tgctcctgcg gcccctaaga tcagcaacgt gggcgaggac tcctgcactg 60

tgcagtggga accgcctgcc tatgatggcg ggcagccggt cctgggtgag ttccccgggc 120

acagggacag ccaagggcag ctgtcacctg agtgacaggg caccggcccg acttctcatc 180

tcctctctca ggatacatcc tggagcgcaa gaagaaaaag agctacaggt ggatgaggct 240

caactttgat ctgctgcggg agctgagcca cgaggcgagg cgcatgatcg agggtgtagc 300

ctaggagatg cgagtctacg cagtcaatgc cgtgggaatg tccaggccca gccctgcctc 360

tcagcccttc atgcctattg gtgagcctgc cagatcccca gaatgcaggg accaaggggg 420

tggatggttg cagcctctta gccggcaggc ggcctctgca cagggctttg cacatggtct 480

ctagtgctct cagggggaaa actgccttgc attacacacg 520

<210>22

<211>520bp

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

atgtcccaga tgctcctgcg gcccctaaga tcagcaacgt gggcgaggac tcctgcactg 60

tgcagtggga accgcctgcc tatgatggcg ggcagccggt cctgggtgag ttccccgggc 120

acagggacag ccaagggcag ctgtcacctg agtgacaggg caccggcccg acttctcatc 180

tcctctctca ggatacatcc tggagcgcaa gaagaaaaag agctacaggt ggatgaggct 240

caactttgat ctgctgcggg agctgagcca cgaggcgagg cgcatgatcg agggtgtagc 300

ctatgagatg cgagtctacg cagtcaatgc cgtgggaatg tccaggccca gccctgcctc 360

tcagcccttc atgcctattg gtgagcctgc cagatcccca gaatgcaggg accaaggggg 420

tggatggttg cagcctctta gccggcaggc ggcctctgca cagggctttg cacatggtct 480

ctagtgctct cagggggaaa actgccttgc attacacacg 520

Claims

1. A preparation method of a mouse model with hypertrophic cardiomyopathy comprises the following steps (1) or (2):

2. The method of claim 1, wherein: the T2535G site of the mouse MYBPC3 gene is knocked in by using a CRISPR/Cas9 system.

3. The method of claim 2, wherein: the CRISPR/Cas9 system includes a gRNA; the target sequence of the gRNA is a DNA molecule shown in SEQ ID NO.1 or SEQ ID NO. 2.

4. A method according to any one of claims 1 to 3, wherein: the method includes the step of using a mixture of gRNA, Cas9mRNA, and donor DNA;

or, the gRNA is an RNA molecule obtained by in vitro transcription by using a DNA molecule shown in SEQ ID NO.19 or SEQ ID NO.20 as a template;

or, the donor DNA sequence is shown as SEQ ID NO. 5.

5. The method of claim 4, wherein: the method comprises the following steps:

1) mixing the gRNA, the Cas9mRNA and the donor DNA to obtain an injection;

6. The method according to claim 4 or 5, characterized in that: the mass ratio of the gRNA, the Cas9mRNA and the donorDNA is 1: (2-2.5): (2-2.5).

7. The method of claim 5, wherein: the donor of the mouse single-cell embryo is a C57BL/6J mouse;

or the surrogate mother mouse is a BALB/c mouse.

8. A product for making a mouse model of hypertrophic cardiomyopathy comprising a gRNA of claim 4, a Cas9mRNA of claim 4, and a donor DNA of claim 4.

9. Use of the method of any one of claims 1 to 6 or the mouse model of hypertrophic cardiomyopathy of claim 7 or the product of claim 8 for developing and/or screening a substance for treating hypertrophic cardiomyopathy.

10. Use according to claim 9, characterized in that: the substance is a drug or a protein.