CN111088396A - Triple real-time fluorescence PCR method for simultaneously detecting haemophilus parasuis, porcine parvovirus and porcine circovirus type 2 - Google Patents
Triple real-time fluorescence PCR method for simultaneously detecting haemophilus parasuis, porcine parvovirus and porcine circovirus type 2 Download PDFInfo
- Publication number
- CN111088396A CN111088396A CN201911112927.3A CN201911112927A CN111088396A CN 111088396 A CN111088396 A CN 111088396A CN 201911112927 A CN201911112927 A CN 201911112927A CN 111088396 A CN111088396 A CN 111088396A
- Authority
- CN
- China
- Prior art keywords
- hps
- ppv
- pcv2
- porcine
- mul
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a triple real-time fluorescence PCR method for simultaneously detecting Haemophilus Parasuis (HPS), Porcine Parvovirus (PPV) and porcine circovirus type 2 (PCV2) by utilizing specific primers, which comprises the following steps: (1) respectively synthesizing specific primers corresponding to HPS, PPV and PCV 2; (2) extracting DNA of a ground sample of the pig tissue; (3) placing all the specific primers in the step (1) in a triple fluorescence PCR reaction system, and carrying out PCR amplification by using the DNA in the step (2) as a template; analyzing whether the pig is infected with at least one of HPS, PPV and PCV2 according to the melting curve. The invention provides convenience for the research of multiplex fluorescence PCR, has wide application range and wide scientific research value and application prospect.
Description
Technical Field
The invention belongs to the technical field of swine pathogen detection, and particularly relates to a triple real-time fluorescence PCR method for simultaneously detecting bacterial and viral infections (HPS, PPV and PCV2) in a pig body.
Background
With the expansion of the breeding scale, the infected diseases in the pig body are increased day by day, which brings huge economic loss to the production of the pig industry. When sows are infected with Porcine Parvovirus (PPV), abortion, stillbirth or mass death of piglets can occur, once a pig farm is infected, 100% of pigs are infected within 3 months, and the infected pigs are infected for a long time and are detoxified. Porcine circovirus type 2 (PCV2) has strong pathogenicity and can infect pigs of different ages of days. After the pregnant sow is infected, the pregnant sow is vertically infected by placenta to a piglet, and a primary sow and a new pig group generate breeding obstacles. The 2 diseases present similar symptoms in clinic, and mixed infection often occurs, so that clinical diagnosis is very difficult, and differential diagnosis must be carried out by relying on laboratory detection technology. In addition to causing reproductive disorders, porcine circovirus also causes severe immunosuppression in swine herds, which is susceptible to secondary or concurrent infectious diseases. Clinically, the morbidity and mortality of the single circovirus infection is low, and more than 80 percent of cases belong to secondary infection. In pig farms, a mixed infection of circovirus and haemophilus parasuis is found to be common. The haemophilus parasuis infection can cause haemophilus parasuis disease of pigs, and the major characteristics of the haemophilus parasuis infection are that multiple cellulose serositis and arthritis are used, so that great loss is caused to pig raising production.
At present, the research on the swine disease molecular detection technology at home and abroad mostly focuses on the differential diagnosis of the mixed infection of viral diseases such as porcine circovirus, porcine parvovirus, porcine pseudorabies virus, classical swine fever virus and the like, but the rapid diagnosis of the mixed infection of the existing viral diseases and bacterial diseases does not attract attention. Real-time fluorescence quantitative PCR is a quantitative detection method developed in recent years, has the characteristics of quantification, rapidness, high sensitivity, strong specificity and the like compared with the traditional PCR, and is widely applied. The multiple real-time fluorescent dye PCR technology developed at present can distinguish different nucleic acid fragments through Tm values in the same reaction system. The invention develops a method for simultaneously detecting HPS, PPV and PCV2 infection in one reaction system by utilizing different Tm values. The establishment of the invention provides technical support for the diagnosis of the pathogen and the purification of the disease in the pig farm.
Disclosure of Invention
The invention aims to solve the technical problem of providing a method for simultaneously detecting 3 common pig pathogens by multiple real-time fluorescent PCR (polymerase chain reaction), which can detect three common pig pathogens of porcine circovirus type 2, porcine parvovirus and haemophilus parasuis on the premise of rapidness, reliability, high sensitivity, strong specificity and low price.
In order to solve the technical problems, the invention provides a method for simultaneously detecting 3 common pathogens of breeding pigs by a multiple real-time fluorescence PCR method, which comprises the following steps:
(1) specific primers of porcine circovirus type 2 (PCV2), Porcine Parvovirus (PPV) and Haemophilus Parasuis (HPS) are respectively designed and synthesized;
(2) DNA in the specimen was extracted and the procedure was carried out according to the instruction of TaKaRa MiniBESTUniversal Genomic DNA Extraction Kit Ver.5.0 Kit (cas no:9765) from TaKara MiniBESTUniversal Genomic DNA Biotech Co., Ltd.
(3) Placing all the specific primers in the step 1) into a multiplex fluorescence PCR reaction system, carrying out PCR amplification by using the DNA in the step 2) as a template, and analyzing whether a disease sample carries at least one of PCV2, PPV and HPS according to a melting curve.
The improvement of the method for simultaneously detecting 3 pathogens by multiple real-time fluorescent quantitative PCR of the invention is as follows:
the PCV2 amplification primer pair is as follows:
forward direction: 5'TGCCCTAACCTATGACCC 3'
And (3) reversing: 5'TGTAGTTTGTAGTCTCAGCCAG 3'
The Tm values of the amplified fragments were: 79.79 deg.C
The primer pair for PPV amplification is as follows:
forward direction: 5'GATGGCTCAAACCGGAGGAG 3'
And (3) reversing: 5'TGGAAAGTTCACATTGGCTGC 3'
The Tm values of the amplified fragments were: 76.86 deg.C
The primer pair for HPS amplification is as follows:
forward direction: 5'CACCCTTATCCTTTGTTGCC 3'
And (3) reversing: 5'CACTTTCTGAGATTCACTCCACC 3'
The Tm values of the amplified fragments were: 83.54 deg.C
The Tm of the above fragments is conclusive data obtained after amplification, and can be set in advance by designing corresponding primers.
The method for simultaneously detecting three common pig pathogens by multiple real-time fluorescent PCR is further improved:
step 3) the multiple real-time fluorescent quantitative PCR reaction system consists of the following components: 2 XSSYBR Green PCR Mix 10. mu.L, 3. mu.L DNA from step 2), PCV2 amplification primer pair 0.5. mu. L, PPV upstream and 0.5. mu.3525 upstream and 0.5. mu.L upstream of the PCV L, HPS amplification primer pair, ddH2O is constant volume to 20 mu L;
the procedure of the multiplex fluorescence PCR reaction is as follows: 5min at 95 ℃; 40 cycles: 30s at 95 ℃, 30s at 55 ℃ and 60s at 72 ℃; the melting curve program is 95 ℃ for 15s, 60 ℃ for 60s and 95 ℃ for 15 s; fluorescence signals were collected starting at 60 ℃.
In the invention, whether the pathological sample carries at least one of PPV, PCV2 and HPS is analyzed according to the melting curve, and the method comprises the following specific steps: according to the peak shown by the melting curve, a peak with a Tm value of 79.79 appears, indicating that PCV2 virus exists; a peak with a Tm value of 76.86 is shown, indicating PPV virus; a peak with a Tm value of 83.54 was observed, indicating the presence of HPS bacteria;
the technical scheme of the invention is as follows:
first, PCR primer design
The sequence analysis results of the currently registered porcine circovirus type 2 PCV2, porcine parvovirus PPV and Haemophilus parasuis HPS are searched from NCBI, and primers are respectively designed by using primer design software. The design of the primers is continuously adjusted, primers capable of effectively distinguishing three pathogen Tm values are selected, and the problems of the length of amplified fragments and dimers between the primers are taken into consideration when the primers are designed.
TABLE 1 PCR primers designed in the present invention
The second step is that: the Extraction of DNA from the pathological sample (which is a conventional technique and can be replaced by other brands of kits) is carried out according to the instruction of TaKaRa MiniBEST Universal Genomic DNA Extraction KitVer.5.0 kit (cas no:9765) of TaKara MiniBEST, Inc., and the specific operation steps are as follows:
1. and (3) cracking tissues or cells, namely ①, aseptically taking 2-25 mg of animal tissues, placing the animal tissues in a 2mL centrifuge tube, shearing the animal tissues into fragments as much as possible by using scissors, and grinding some hard tissues by using liquid nitrogen.
② adding 180 μ L Buffer GL, 20 μ L protease K and 10 μ L RNase A (10mg/mL), and bathing in 56 deg.C water bath until the tissue is completely lysed (2-3 h, the difficult-to-lyse material can prolong the lysis time or even lyse overnight). The sample can be taken out from time to shake or suck to accelerate lysis.
③ mu.L Buffer GB and 200. mu.L 100% ethanol were added to the lysate, and the mixture was pipetted well and mixed.
2. The Spin Column was mounted on a Collection Tube, the solution was transferred to the Spin Column, centrifuged at 12000rpm for 2min, and the filtrate was discarded.
3. mu.L of Buffer WA WAs added to Spin Column, centrifuged at 12000rpm for 1min, and the filtrate WAs discarded.
4. mu.L of Buffer WB was added to Spin Column, centrifuged at 12000rpm for 1min, and the filtrate was discarded.
Note) please confirm that the specified volume of 100% ethanol had been added to Buffer WB.
Buffer WB was added around the Spin Column wall to help completely flush out the salt adhering to the wall.
5. And repeating the operation step 4.
6. Spin columns were mounted on a Collection Tube and centrifuged at 12000rpm for 2 min.
7. The Spin Column is placed on a new centrifuge tube with 1.5mL, 50-200 μ L of sterilized water or Elution Buffer is added to the center of the Spin Column membrane, and the mixture is allowed to stand at room temperature for 5 min.
Note) it is advantageous to increase the Elution efficiency when the sterilized water or the elusion Buffer is heated to 65 ℃ for use.
The DNA was eluted by centrifugation at 8.12000rpm for 2 min. If a larger yield is required, the supernatant can be added into the center of the SpinColumn membrane again or 50-200 mu L of sterilized water or Elution Buffer is added, and after standing for 5min at room temperature, the mixture is centrifuged at 12000rpm for 2min to elute DNA.
9. Quantification of genomic DNA. The extracted genomic DNA can be quantified by electrophoresis or absorbance measurement.
The third step: multiplex fluorescent PCR
Multiplex fluorescent PCR reaction (20. mu.L total reaction): 2 XSSYBRGreen PCR Mix 10. mu.L, 3. mu.L of the DNA extracted in the second step and the primers in the first step (0.5. mu.L each of PCV2, PPV, HPS upstream and downstream primers) to supplement ddH2O to 20. mu.L. The reaction was performed on a Quanstudio5 fluorescent quantitative PCR instrument, and the amplification procedure was: 5min at 95 ℃; 40 cycles: 30s at 95 ℃, 30s at 55 ℃ and 60s at 72 ℃; the melting curve program is 95 ℃ for 15s, 60 ℃ for 60s and 95 ℃ for 15 s; fluorescence signals were collected starting at 60 ℃.
The fourth step: determination of detection result
The Tm value of each pathogen was determined by analysis of the melting curve by the software.
Aiming at the problem of one-time detection after mixed infection of viral diseases and bacterial diseases in the pig industry, the invention designs 3 pairs of specific primers, so that Tm values of the 3 amplification products can be obviously distinguished; the invention designs that the size of the amplified product fragment at the same annealing temperature is between 160-360 bp. According to the multiple fluorescent dye PCR reaction system and the amplification system established by the invention, the detection effect of simultaneously detecting 3 pathogens, namely porcine circovirus type 2 PCV2, porcine parvovirus PPV and haemophilus parasuis HPS, by one fluorescent PCR reaction can be realized.
By adopting the technical method, the outstanding technical progress of the invention is as follows:
(1) a primer for simultaneously detecting the simultaneous infection of bacteria and viruses in common mixed infection of pigs and a SYBR Green I multiple real-time fluorescent PCR system are designed, a probe is not used, and the defects that the existing detection method for the mixed infection of the bacteria and the viruses needs to process samples respectively, the operation is complex, the detection sensitivity is not high, the specificity is not strong, the repeatability is not good and the like are overcome.
2) The multiplex real-time fluorescence quantitative PCR detection method can simultaneously detect 2 virus diseases and 1 bacterial disease in common pig infectious pathogens, and belongs to precedent in the domestic multiplex real-time fluorescence quantitative PCR method.
In conclusion, the invention utilizes the fluorescent quantitative PCR technology, and the method simultaneously detects 3 common porcine pathogens of porcine circovirus type 2, porcine parvovirus PPV and haemophilus parasuis HPS through one-time multiple fluorescent PCR reaction. The method also relates to a primer design method in the multiplex real-time fluorescence PCR reaction, and reaction system parameters and program parameters for simultaneously detecting 3 common pig pathogens. The invention provides convenience for the research of multiplex fluorescence PCR, is suitable for departments such as pig farms, slaughterhouses, port inspection and quarantine and the like, and has wide scientific research value and application prospect.
Drawings
The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.
FIG. 1 is a flow chart of the operation of the present invention.
FIG. 2 is the test result of example 1 of the present invention, which contains the melting curve of 3 common pathogens of swine (PCV2, PPV, HPS) simultaneously detected by a multiplex PCR of a specimen containing standard Haemophilus parasuis, porcine circovirus type 2, porcine parvovirus, and a negative control is set, and the result of the melting curve shows no amplification product, thus proving that the specificity of the method is good. FIG. 3 is a melting curve diagram of 2 samples of example 2, which are obtained by extracting DNA from the samples, selecting 10 samples for detection, and performing a single fluorescent quantitative amplification.
Detailed Description
Example 1 and 3 establishment of basic detection method for common pathogens of pigs
The first step is as follows: primer synthesis
3 kinds of pathogenic primer sequences designed by the invention (see table 1) are entrusted to Shanghai Biotechnology company technical service company to synthesize primers.
The second step is that: positive sample total DNA minibody extraction
20mg of positive pig disease sample respectively containing pig PCV2, PPV and HPS is placed in a 1.5mL centrifuge tube, and then the operation is carried out according to the instruction of TaKaRa MiniBEST Universal Genomic DNA Extraction KitVer.5.0 kit (cas no:9765) of TaBiotechnology, Inc., and the specific operation steps are as follows:
1. and (3) cracking tissues or cells, namely ①, aseptically taking 2-25 mg of animal tissues, placing the animal tissues in a 2mL centrifuge tube, shearing the animal tissues into fragments as much as possible by using scissors, and grinding some hard tissues by using liquid nitrogen.
② adding 180 μ L Buffer GL, 20 μ L protease K and 10 μ L RNase A (10mg/mL), and bathing in 56 deg.C water bath until the tissue is completely lysed (2-3 h, the difficult-to-lyse material can prolong the lysis time or even lyse overnight). The sample can be taken out from time to shake or suck to accelerate lysis.
③ mu.L Buffer GB and 200. mu.L 100% ethanol were added to the lysate, and the mixture was pipetted well and mixed.
2. The Spin Column was mounted on a Collection Tube, the solution was transferred to the Spin Column, centrifuged at 12000rpm for 2min, and the filtrate was discarded.
3. mu.L of Buffer WA WAs added to Spin Column, centrifuged at 12000rpm for 1min, and the filtrate WAs discarded.
4. mu.L of Buffer WB was added to Spin Column, centrifuged at 12000rpm for 1min, and the filtrate was discarded.
Note) please confirm that the specified volume of 100% ethanol had been added to Buffer WB.
Buffer WB was added around the Spin Column wall to help completely flush out the salt adhering to the wall.
5. And repeating the operation step 4.
6. Spin columns were mounted on a Collection Tube and centrifuged at 12000rpm for 2 min.
7. The Spin Column is placed on a new centrifuge tube with 1.5mL, 50-200 μ L of sterilized water or Elution Buffer is added to the center of the Spin Column membrane, and the mixture is allowed to stand at room temperature for 5 min.
Note) it is advantageous to increase the Elution efficiency when the sterilized water or the elusion Buffer is heated to 65 ℃ for use.
The DNA was eluted by centrifugation at 8.12000rpm for 2 min. If a larger yield is required, the supernatant can be added into the center of the SpinColumn membrane again or 50-200 mu L of sterilized water or Elution Buffer is added, and after standing for 5min at room temperature, the mixture is centrifuged at 12000rpm for 2min to elute DNA.
9. Quantification of genomic DNA. The extracted genomic DNA can be quantified by electrophoresis or absorbance measurement.
The third step: multiplex fluorescent PCR
Multiplex fluorescent PCR reaction system (total reaction volume 20. mu.L): 2 × SYBRGreen IPCR Mix10 μ L,3 μ L DNA extracted in the second step and the pathogen primers in the first step (PCV2, PPV, 0.5 μ L each for the upstream and downstream primers HPS), make up for ddH2O to 20. mu.L. A negative control was also set. The reaction was performed on a Quanstudio5 fluorescent quantitative PCR instrument, and the amplification procedure was: 5min at 95 ℃ for 40 cycles; 30s at 95 ℃, 30s at 56 ℃ and 60s at 72 ℃; the dissolution curve program was 95 ℃ for 15s, 60 ℃ for 60s, 95 ℃ for 15 s; fluorescence signals were collected starting at 60 ℃.
The fourth step: result detection
The amplification results were analyzed according to the dissolution profile automatically generated by the Quanstudio5 fluorescence quantitative PCR instrument.
The experimental results of this example are shown in FIG. 2. FIG. 2 is a graph in which the abscissa represents Tm value and the ordinate represents Derivative (rate of change in fluorescence signal value of amplification product); the dissolution curve shows three peaks, each peak corresponds to the Tm values of the three porcine common pathogen amplified fragments PCV2, PPV and HPS which are 79.79, 76.86 and 83.54 respectively on the abscissa, and the negative control has no peak and no amplification product on the surface. Experimental results show that the method can accurately and effectively detect 3 common pig pathogens PCV2, PPV and HPS simultaneously.
Note: the Tm value can only specifically represent an amplification product of a porcine pathogen.
Example 2, swine food sample from a pig farm in a horsehouse.
The first step is as follows: primer synthesis
Same as the first step in example 1
The second step is that: sampling of pathological material
The sampling site was a Living horse shop in Henan province. Selecting sick pigs with obvious disease symptoms in a pig farm, and taking lungs aseptically after slaughtering. Put into a sampling box for storage and taken back to the laboratory. A total of 10 samples were collected.
The third step: and extracting DNA from the sample.
The procedure was identical to the second step in example 1.
The fourth step: multiplex fluorescent PCR
The same procedure as in the fourth step of example 1.
The fifth step: result detection
The same as the fifth step in example 1.
In example 2, the test results of 2 samples are shown in FIG. 3. Melting curves for multiple pathogen infection in 2 samples are shown in figure 3. Of the 10 samples, there were 0 cases infected with PCV2 alone, 1 case infected with PPV alone, and 1 case infected with HPS alone. There were 2 cases of mixed infection with PCV2 and PPV, 5 cases of mixed infection with PCV2 and HPS, 0 case of mixed infection with HPS and PPV, and 1 case of mixed infection with PCV2, HPS and PPV.
Claims (2)
1. The method for simultaneously detecting haemophilus parasuis, porcine parvovirus and porcine circovirus type 2 by triple real-time fluorescent PCR is characterized by comprising the following steps of:
(1) respectively synthesizing specific primers corresponding to Haemophilus Parasuis (HPS), Porcine Parvovirus (PPV) and porcine circovirus type 2 (PCV 2);
the HPS amplification primer pair comprises:
forward direction: 5'CACCCTTATCCTTTGTTGCC 3'
And (3) reversing: 5'CACTTTCTGAGATTCACTCCACC 3'
The PPV amplification primer pair comprises:
forward direction: 5'GATGGCTCAAACCGGAGGAG 3'
And (3) reversing: 5'TGGAAAGTTCACATTGGCTGC 3'
The PCV2 amplification primer pair is as follows:
forward direction: 5'TGCCCTAACCTATGACCC 3'
And (3) reversing: 5'TGTAGTTTGTAGTCTCAGCCAG 3'
(2) Extracting DNA of the pig tissue sample, and operating according to the instruction of TaKaRa MiniBEST Universal genomic DNA Extraction Kit Ver.5.0 Kit (cas no:9765) of TaKaRa MiniBEST;
(3) placing all the specific primers in the step 1) in a multiplex fluorescence PCR reaction system, and carrying out PCR amplification by taking the DNA in the step 2) as a template; analyzing the tissue sample for infection with at least one of HPS, PPV, PCV2 according to the melting curve; the method specifically comprises the following steps: according to the peak shown by the melting curve, the Tm value is 83.54 ℃, indicating HPS; a peak with a Tm value of 76.86 is shown, indicating PPV virus; a peak with a Tm value of 79.79 ℃ was observed, indicating PCV2 virus.
2. The method for simultaneously detecting three swine pathogens according to claim 1, wherein the method comprises the following steps: the multiple fluorescence PCR reaction system in the step 3) consists of the following components: 2 XSYBR Green PCR Mix10 muL, DNA 3 muL in step 2), 0.5 muL of each upstream and downstream of the HPS amplification primer pair in step 1) and 0.5 muL of each upstream and downstream of the PCV2 amplification primer pair, and ddH is used for the DNA 3 muL, the upstream and downstream of the HPS amplification primer pair are respectively 0.5 muL and 0.5 muL2O, performing constant volume to 20 mu L;
the multiple fluorescent PCR reaction program is as follows: 5min at 95 ℃; 40 cycles: 30s at 95 ℃, 30s at 56 ℃ and 60s at 72 ℃; the melting curve program is 95 ℃ for 15s, 60 ℃ for 60s and 95 ℃ for 15 s; fluorescence signals were collected starting at 60 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911112927.3A CN111088396A (en) | 2019-11-14 | 2019-11-14 | Triple real-time fluorescence PCR method for simultaneously detecting haemophilus parasuis, porcine parvovirus and porcine circovirus type 2 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911112927.3A CN111088396A (en) | 2019-11-14 | 2019-11-14 | Triple real-time fluorescence PCR method for simultaneously detecting haemophilus parasuis, porcine parvovirus and porcine circovirus type 2 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111088396A true CN111088396A (en) | 2020-05-01 |
Family
ID=70393215
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911112927.3A Pending CN111088396A (en) | 2019-11-14 | 2019-11-14 | Triple real-time fluorescence PCR method for simultaneously detecting haemophilus parasuis, porcine parvovirus and porcine circovirus type 2 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111088396A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114480743A (en) * | 2022-03-15 | 2022-05-13 | 龙岩学院 | Primer and method for simultaneously detecting porcine circovirus type 2 and porcine parvovirus type 2 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090162398A1 (en) * | 2007-12-21 | 2009-06-25 | Wyeth | Methods and Compositions for Immunizing Pigs Against Porcine Circovirus |
| CN102071259A (en) * | 2009-11-25 | 2011-05-25 | 河南农业大学 | Multiplex real-time fluorescence PCR (polymerase chain reaction) detection primer and method for porcine rabies virus, porcine parvovirus and porcine circovirus type 2 |
| CN102174653A (en) * | 2011-03-01 | 2011-09-07 | 广西壮族自治区兽医研究所 | Haemophilus parasuis real-time fluorescent quantitative PCR (polymerase chain reaction) detection method |
| CN104830995A (en) * | 2015-04-16 | 2015-08-12 | 内蒙古必威安泰生物科技有限公司 | Multiplex RT-PCR detection kit for simultaneously detecting or diagnosing swine multi-virus infection, and application thereof |
| CN208250276U (en) * | 2018-02-02 | 2018-12-18 | 王阜生 | A kind of kit of the multiple pathogens of synchronous detection schweineseuche disease |
-
2019
- 2019-11-14 CN CN201911112927.3A patent/CN111088396A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090162398A1 (en) * | 2007-12-21 | 2009-06-25 | Wyeth | Methods and Compositions for Immunizing Pigs Against Porcine Circovirus |
| CN102071259A (en) * | 2009-11-25 | 2011-05-25 | 河南农业大学 | Multiplex real-time fluorescence PCR (polymerase chain reaction) detection primer and method for porcine rabies virus, porcine parvovirus and porcine circovirus type 2 |
| CN102174653A (en) * | 2011-03-01 | 2011-09-07 | 广西壮族自治区兽医研究所 | Haemophilus parasuis real-time fluorescent quantitative PCR (polymerase chain reaction) detection method |
| CN104830995A (en) * | 2015-04-16 | 2015-08-12 | 内蒙古必威安泰生物科技有限公司 | Multiplex RT-PCR detection kit for simultaneously detecting or diagnosing swine multi-virus infection, and application thereof |
| CN208250276U (en) * | 2018-02-02 | 2018-12-18 | 王阜生 | A kind of kit of the multiple pathogens of synchronous detection schweineseuche disease |
Non-Patent Citations (3)
| Title |
|---|
| YAN JIANG等: ""Development of multiplex oligonucleotide microarray for simultaneous detection of six swine pathogens"", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| 罗尚星等: ""副猪嗜血杆菌、PCV2及PRRSV多联 RT-PCR检测方法的"", 《中国兽医学报》 * |
| 胡斌: ""猪细小病毒、猪圆环病毒病Ⅱ型和副猪嗜血杆菌SYBR Green I多重荧光定量PCR检测方法的建立"", 《中国学位论文全文数据库》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114480743A (en) * | 2022-03-15 | 2022-05-13 | 龙岩学院 | Primer and method for simultaneously detecting porcine circovirus type 2 and porcine parvovirus type 2 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN110551846B (en) | Cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| Greiser-Wilke et al. | Diagnostic methods for detection of Classical swine fever virus—status quo and new developments | |
| EP4219743A1 (en) | Sample nucleic acid measurement test kit, reagent, and application thereof | |
| CN111254223A (en) | Reaction system and kit for detecting African swine fever virus nucleic acid and application of reaction system and kit | |
| US10161005B2 (en) | Method for detecting telomerase via washing-free anchored-extension and telomeric-binding amplification, and kit | |
| CN105256048B (en) | Multiple PCR detection primer group and probe group for oral pathogenic bacteria and application thereof | |
| CN111286559B (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN115029459A (en) | Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application | |
| CN107699635B (en) | Fluorescent RPA (reverse transcriptase amplification) detection method for porcine epidemic diarrhea virus | |
| CN106434935B (en) | Compositions and methods for identifying Pasteurella multocida and/or Haemophilus parasuis | |
| CN114196766B (en) | Molecular marker, primer pair, kit and method for specifically identifying rice ralstonia solanacearum Xoo | |
| CN108707697B (en) | LAMP (loop-mediated isothermal amplification) detection primer pair and detection method for seneca valley virus | |
| CN101225440B (en) | Detection method of leptospira | |
| CN108070636A (en) | A kind of processing method and kit of fluorescent PCR amplified sample | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN111088396A (en) | Triple real-time fluorescence PCR method for simultaneously detecting haemophilus parasuis, porcine parvovirus and porcine circovirus type 2 | |
| CN105154584A (en) | HRM (high-resolution melting) label-free probe method, primer and probe for quickly differentiating PRRSV (porcine reproductive and respiratory syndrome virus) classical strains and mutant strains | |
| CN113249517A (en) | Primer, probe and kit for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of bovine plague | |
| CN115725756A (en) | RPA primer group, reagent and kit for detecting treponema pallidum and application of RPA primer group, reagent and kit | |
| CN104313163B (en) | Method and kit for triple PCR detection of porcine infectious actinobacillus pleuropneumonia serum types 2, 3 and 6 and application of porcine infectious actinobacillus pleuropneumonia serum types 2, 3 and 6 | |
| Anghel et al. | African swine fever virus genome detection using Real Time Q PCR polymerase chain reaction method-comparison of two sample specimen (blood and organs) | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe | |
| RU2808238C1 (en) | Method, composition and kit for fluorescent quantitative pcr and their application | |
| CN115820818B (en) | One-step method nucleic acid detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20200501 |