CN111088373A

CN111088373A - Detection primer pair, kit, method and application of sheep PRL gene insertion/deletion polymorphism

Info

Publication number: CN111088373A
Application number: CN202010098388.9A
Authority: CN
Inventors: 张清峰; 蓝康澍; 曹如; 潘传英; 林春建; 王权锋; 李若亮; 兰天鑫; 蓝贤勇
Original assignee: Tianjin Aoqun Animal Husbandry Co ltd
Current assignee: Tianjin Aoqun Animal Husbandry Co ltd
Priority date: 2020-02-18
Filing date: 2020-02-18
Publication date: 2020-05-01
Anticipated expiration: 2040-02-18
Also published as: CN111088373B

Abstract

The invention relates to a primer pair for detecting sheep PRL gene insertion/deletion polymorphism, which can be used for PCR amplification of a fragment containing the sheep PRL gene intron region insertion/deletion polymorphism site. The invention can simply, quickly, low-cost and accurately detect the genotype of the insertion/deletion polymorphic site, and the insertion/deletion polymorphic site detected by the invention can be used as a molecular marker site of the lamb number, thereby accelerating the establishment of a sheep population with excellent lamb number property and improving the speed of fine breed breeding.

Description

Detection primer pair, kit, method and application of sheep PRL gene insertion/deletion polymorphism

Technical Field

The invention belongs to the technical field of biotechnology and livestock breeding, and particularly relates to a detection primer pair, a kit, a method and application of sheep PRL gene insertion/deletion polymorphism.

Background

Sheep is deeply loved by consumers by the performance of producing meat, milk and cashmere, and the social demand for products such as mutton, goat milk, cashmere and the like is higher and higher along with the improvement of the living standard of people. In order to realize the high-yield, high-quality and high-efficiency sheep breeding target, people research sheep, on the molecular level, perform genetic analysis and research on the gene structure and function of the sheep by taking DNA polymorphism as a marker, screen and detect DNA marker sites closely related to the sheep lambing number character, and can accelerate the establishment of a sheep population with excellent lambing number character according to the association of the gene polymorphism and the lambing number character, and the marker has the advantages of universality, genetic stability, high accuracy and the like, thereby being widely applied to various fields.

Molecular Marker Assisted Selection (MAS) is a common method for molecular genetic markers, and breeding is performed by genotype analysis of molecular markers linked to target genes.

In recent years, with the upgrading of sequencing technology and the reduction of sequencing cost, insertion/deletion (indel) mutation has been receiving attention as an important molecular genetic marker. Insertions and deletions (InDels), which are structures distributed in large numbers throughout the genome due to polymerase slippage, transposons, unequal crossing, etc., can sometimes lead to gain or loss of biological function, constitute an important component of the natural mutation pool. The most common classes of InDels include single base pair insertions and deletions, monomeric base pair extensions and multiple base pair extensions, however relatively few InDels contain random sequences and transposon insertions in the genome. InDels is more valuable because it can be easily identified by genotyping using gel. In some previous studies, InDels was also found to be more polymorphic than microsatellite markers. Today, InDels has been used in a variety of applications, including population genetics, taxonomic diagnostic markers, genetic map construction, and association maps in different crops, with less research and application of indel markers in breeding traits for animal breeding. Some of the reports on indels in sheep have shown that: in the aspect of growth, it is reported that a 16bp indel exists in the KDM6A gene intron region of the northern Shaanxi white cashmere goat, which can significantly affect the growth traits of the goat such as body height, chest depth, body length and the like (Wang.et al., 2018); in reproduction, it has been reported that a 26bp indel of goat CTNNB1 is very significantly correlated with the number of first-born lambs of goats (zhang. et al, 2018); also, association analysis was performed by chen et al on three indel sites of goat SPEF2, and SPEF12 was found to have a significant effect on the number of lambs born by the goat (chen et al, 2018). These studies all show that InDels has important significance and reference value for animal molecular breeding.

The Prolactin (PRL) gene belongs to a member of the growth hormone/prolactin family. The name comes at first from its ability to stimulate the epithelial cell proliferation of the pigeon crop to produce crop milk. Cooke et al found that a typical prolactin consists of 5 exons and 4 introns. Prolactin is present in all vertebrates, is secreted by milk trophoblasts of the anterior pituitary, and acts in the form of paracrine, autocrine, and the like, thereby acting as a classical endocrine regulator on various physiological activities of animals. The sheep maintains high PRL in the estrus season, and the PRL in the estrus season is reduced to low concentration. High concentrations of PRL were also maintained during lactation in sheep. Wu et al (1995) showed that only decidua cells in the human utero-placental body express PRLmRNA, and that there is a close link between the level of prolactin gene expression and the prolactin production by individual decidua cells, which in turn is directly related to the process of decidualization that persists throughout the entire pregnancy of humans. Prolactin has a wide range of actions, and can not only promote mammary gland development and milk production, stimulate corpus luteum to secrete progesterone and the like, but also widely influence the development of an immune system and regulate water-salt balance. The ZHAO Xiu-hua et al (2007) study showed that mice unable to synthesize prolactin had an anogenital capacity due to ovulation, fertilization, pre-implantation development and implantation defects. Therefore, the research on the mutation of the PRL gene has important significance for quickly breeding sheep populations with excellent lambing number characters and achieving higher economic effect.

Through a search, no published patent literature relevant to the present patent application has been found.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides a detection primer pair, a kit, a method and application of PRL gene insertion/deletion polymorphism of sheep.

The technical scheme adopted by the invention for solving the technical problems is as follows:

a primer pair for detecting an insertion/deletion polymorphism of a sheep PRL gene, which can be used for PCR amplification of a fragment containing the insertion/deletion polymorphism site of an intron region of the sheep PRL gene.

Furthermore, the insertion/deletion polymorphic site is 23-bp insertion/deletion polymorphic site at position NC-040271.1: g.3422967-34262989 of the sheep PRL gene.

Moreover, the primer pair is:

an upstream primer: SEQ NO. 15 '-GGGAAGGGAAGAGAAACAGAGG-3' (22 nt);

a downstream primer: SEQ NO. 25 '-GCTTGTAGGGTGGAACACTGA-3' (21 nt).

The primer pair for detecting the sheep PRL gene insertion/deletion polymorphism is applied to the aspect of auxiliary selection breeding of sheep lambing number molecular markers.

A kit for detecting the sheep PRL gene insertion/deletion polymorphism, which comprises the primer pair.

A method for detecting sheep PRL gene insertion/deletion polymorphism by using the primer pair comprises the following steps:

and (2) taking the genomic DNA of the sheep to be detected as a template and a primer pair as an amplification primer, amplifying a fragment containing the insertion/deletion polymorphic site of the intron region of the PRL gene of the sheep by utilizing PCR (polymerase chain reaction), carrying out electrophoresis on an amplification product, and identifying the genotype of the insertion/deletion polymorphic site according to an electrophoresis result.

Moreover, the reaction procedure adopted by the PCR amplification is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 68 ℃ for 30s, extension at 72 ℃ for 12-24 s, and 18 cycles, wherein the annealing temperature is reduced by 1 ℃ after each cycle; annealing at 50 ℃ for 30s, extending at 72 ℃ for 12-24 s, and performing 25-30 cycles; extending for 10min at 72 ℃;

or, agarose gel with the mass concentration of 3.0-3.5% is adopted during electrophoresis.

Furthermore, according to the electrophoresis results, the insertion/insertion genotype II of the insertion/deletion polymorphic site is expressed as a 110bp one-stripe, the insertion/deletion genotype ID is expressed as two-stripe of 110bp and 87bp, and the deletion/deletion genotype DD is expressed as a 87bp one-stripe.

The detection method of the sheep PRL gene insertion/deletion polymorphism is applied to the sheep lambing number molecular marker-assisted selective breeding.

Moreover, the applications are: the insertion/deletion genotype of the insertion/deletion polymorphic site obtained by the detection method is applied to the aspect of DNA markers for improving the number of lambs born in the 1 st sheep and/or the average number of lambs born.

The invention has the advantages and positive effects that:

1. according to the invention, a primer is designed according to the insertion/deletion polymorphic site (reference sequence NC-040271.1: g.3422967-34262989) of the intron region of the PRL gene of the sheep, and the genotype of the insertion/deletion polymorphic site can be detected simply, quickly, at low cost and accurately by using the genomic DNA of the sheep as a template through sequence amplification and electrophoretic identification.

2. The invention carries out genotype and gene frequency analysis on PRL gene insertion/deletion polymorphic sites (reference sequence NC-040271.1: g.3422967-34262989) of sheep (such as Australian white sheep), and carries out correlation analysis on the insertion/deletion polymorphic sites and sheep production traits.

3. The method takes the sheep whole genome DNA to be detected as a template, amplifies partial fragments of the sheep PRL gene by PCR, then carries out agarose gel electrophoresis, and identifies the sheep PRL gene according to the electrophoresis result

NC-040271.1 genotype of 23-bp insertion/deletion polymorphic site at position 3422967-34262989. The different genotypes of the 23-bp insertion/deletion polymorphic site have obvious correlation with the lambing number character of Australian white sheep, and DNA markers for improving the lambing number and average lambing number character of the No.1 fetus of the sheep exist. The method for detecting the sheep PRL gene insertion/deletion polymorphism can be applied to sheep molecular marker-assisted selective breeding, and the establishment of an excellent sheep genetic resource population is accelerated.

Drawings

FIG. 1 is a drawing showing the result of agarose gel electrophoresis of an amplification product of the sheep PRL gene (primer pair P1) according to the present invention; m represents Marker;

FIG. 2 is a sequence diagram of PCR amplification products of the sheep PRL gene in the invention; wherein: the black box indicates the 23-bp insert:

NC-040271.1:g.3422967_34262989delGAGTCTTTATGAAGAGAAACACC。

Detailed Description

The following detailed description of the embodiments of the present invention is provided for the purpose of illustration and not limitation, and should not be construed as limiting the scope of the invention.

The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.

Preferably, the insertion/deletion polymorphic site is 23-bp insertion/deletion polymorphic site at position NC-040271.1: g.3422967-34262989 of the sheep PRL gene.

Preferably, the primer pair is:

an upstream primer: SEQ NO. 15 '-GGGAAGGGAAGAGAAACAGAGG-3' (22 nt);

a downstream primer: SEQ NO. 25 '-GCTTGTAGGGTGGAACACTGA-3' (21 nt).

taking the genomic DNA of a sheep to be detected as a template, taking a primer pair as an amplification primer, amplifying a fragment containing the insertion/deletion polymorphic site of the intron region of the PRL gene of the sheep by utilizing PCR (polymerase chain reaction), carrying out electrophoresis on an amplification product, and identifying the genotype of the insertion/deletion polymorphic site according to an electrophoresis result;

wherein the insertion/deletion polymorphic sites are selected from 23-bp insertion/deletion polymorphic sites at positions NC-040271.1: g.3422967-34262989 of the sheep PRL gene.

Preferably, the reaction procedure adopted by the PCR amplification is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 68 ℃ for 30s, extension at 72 ℃ for 12-24 s, and 18 cycles, wherein the annealing temperature is reduced by 1 ℃ after each cycle; annealing at 50 ℃ for 30s, extending at 72 ℃ for 12-24 s, and performing 25-30 cycles; extension at 72 ℃ for 10 min.

Preferably, agarose gel with mass concentration of 3.0-3.5% is adopted during electrophoresis.

Preferably, according to the electrophoresis result, the insertion/insertion genotype II of the insertion/deletion polymorphic site is expressed as a 110bp strip, the insertion/deletion genotype ID is expressed as two strips of 110bp and 87bp, and the deletion/deletion genotype DD is expressed as a 87bp strip.

Preferably, the insertion/deletion genotype of the insertion/deletion polymorphic site serves as a DNA marker for increasing the number of lambs born in sheep fetus 1 and/or the average number of lambs born.

More specifically, the relevant preparation steps are as follows:

the invention utilizes a PCR method to detect insertion/deletion polymorphism which is possibly generated by mutation of g.3422967-34262989 locus (reference sequence: NC-040271.1) of the found sheep PRL gene, and carries out correlation analysis on the polymorphism and the sheep lambing number character to verify whether the polymorphism exists as a molecular marker for marker-assisted selection in sheep molecular breeding.

1. Experimental drugs and reagents

1.1 Biochemical and biological reagents ① Taq DNA polymerase (available from Fermantas, MBI), ② proteinase K (available from Huamei bioengineering Co., Ltd.), ③ Marker I (available from Tiangen Biochemical technology, Beijing, Ltd.).

1.2 general reagents: citric acid, sodium citrate, glucose, Tris, EDTA, NaCl, NaOH, KCl and Na₂HPO₄、KH₂PO₄Tris saturated phenol, chloroform, isoamyl alcohol, absolute ethyl alcohol, sodium acetate, Sodium Dodecyl Sulfate (SDS), Ethidium Bromide (EB), bromophenol blue, dimethyl benzene cyanide FF, acetic acid, sucrose, boric acid, agarose and the like.

1.3 solution and buffer: all solutions and buffer solutions are prepared by deionized ultrapure water; the autoclaving condition was 15bf/in (1.034X 10)⁵Pa) and 25 min. The reagent preparation methods refer to molecular cloning experimental guidelines compiled by Sambrook et al;

1) solution for extracting tissue-like DNA

① 2mol/L NaCl 11.688g is dissolved in water, the volume is determined to be 100mL, and the autoclave is sterilized;

② tissue DNA extract (100mL), lmol/L Tris-HCl (pH8.0) lmL, 0.5mol/L EDTA (pH8.0)20mL, and 2mol/L NaCl 5mL, to 100 mL.

2) Solutions for agarose gel electrophoresis analysis

① 0.5.5 × TBE buffer solution, taking 10 × TBE 50mL to fix the volume to 1000 mL;

② sample buffer solution containing bromophenol blue with final mass concentration of 0.25% and xylene blue FF with final mass concentration of 0.25%, and the solvent is 40.0% (w/v) sucrose water solution.

2. Design of sheep PRL gene InDel site amplification primer

The sequence of the sheep PRL gene (NC _040271.1) was searched at NCBI, and primers capable of amplifying DNA fragments at a plurality of candidate InDel sites of the PRL gene were designed using Primer 5.0, wherein the PCR Primer pair capable of amplifying the 1 st intron region g.3422967_34262989InDel site of the sheep PRL gene was P1 (Primer design completion time 2019, 10 months and 1 days).

The sequences of the primer pair P1 are shown in Table 1.

TABLE 1 sheep PRL Gene InDel site amplification primer table

The above primer pair P1 amplified the sheep genome, and was able to amplify a fragment containing a candidate InDel site (NC-040271.1: g.3422967-34262989) of the 1 st intron region of the sheep PRL gene. Theoretically, when the sequence GAGTCTTTATGAAGAGAAACACC between g.3422967_34262989 is inserted, the PCR amplification of P1 with the primer pair results in a 110bp band; when the GAGTCTTTATGAAGAGAAACACC sequence between g.3422967_34262989 bits is deleted, the PCR amplification with primer pair P1 resulted in a band of 87bp size; when the sequence GAGTCTTTATGAAGAGAAACACC between g.3422967_34262989 shows an insertion on one allele and a deletion on the other allele, PCR amplification with primer pair P1 resulted in bands of size 110bp and 87bp, respectively.

3. PCR amplification of sheep PRL gene fragment to be detected by primer pair P1

3.1 Collection of sheep ear tissue samples

The animals used in the experiment were 922 samples in total, and the specific information is shown in table 2. The lambing number character data is measured by original seed field workers, individual ear tissue samples are adopted, the samples are preserved by 70% ethanol, and the ice box is placed at minus 80 ℃ for freezing storage after being brought back to a laboratory at low temperature.

TABLE 2 sample information

3.2 extraction and isolation of genomic DNA from tissue samples

Reference is made to the molecular cloning guidelines (2002) compiled by Sambrook et al and to the following documents: lanxian warrior sheep important function gene genetic variation and the relation between the genetic variation and economic traits [ D. ] in doctor academic thesis of university of agriculture and forestry in northwest, 2007, Shaanxi Yangling.

3.3 agarose gel electrophoresis detection of DNA

Reference is made to the molecular cloning guidelines (2002) compiled by Sambrook et al.

3.4 purification of DNA

3.5 spectrophotometric detection of DNA

The OD values of the DNA samples at 260nm and 280nm were measured by an ultraviolet photometer. Calculation of DNA content and OD₂₆₀/OD₂₈₀The ratio of (a) to (b). Such as OD₂₆₀/OD₂₈₀The ratio is less than 1.6, which indicates that the sample contains more protein or phenol, and purification is required; if the ratio is greater than 1.8, then RNA purification removal should be considered.

DNA concentration (ng/. mu.L) ═ 50 XOD₂₆₀Value x dilution factor.

After the DNA detection, a certain amount of the DNA was taken out and diluted to 20 ng/. mu.L, and stored at-20 ℃ for later use, and the rest at-80 ℃.

3.6PCR amplification

The PCR reaction system adopts a mixed sample adding method, namely the total amount of various reaction components is calculated according to the quantity of various components required by each reaction system and the quantity of PCR reactions required by 1 reaction, the reaction components are added into 1 1.5mL centrifuge tube, the centrifuge tubes are mixed fully and evenly and then are centrifuged instantly, the reaction components are subpackaged into 0.2mL Eppendorf PCR tubes, template DNA (sheep genome DNA with the concentration of 20 ng/mu L) is added, and PCR amplification is carried out after the centrifugation instantly; the PCR reaction system comprises 2 XTaq PCR Supermix (comprising Taq DNA polymerase, dNTPs and reaction buffer solution, the concentration is 2X) 6.5 mu L; upstream primer 0.25 μ L; 0.25 μ L of the downstream primer (concentration of upstream primer and downstream primer is 10 pmol/. mu.L); 0.5 μ L of genomic DNA; 5.5 mu L of deionized water; a total of 13. mu.L.

3.7 procedure for PCR reaction

Pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 68 ℃ for 30s, extension at 72 ℃ for 12s, and 18 cycles, wherein the annealing temperature is reduced by 1 ℃ after each cycle; annealing at 50 ℃ for 30s, extending at 72 ℃ for 12s, and performing 25 cycles; extension at 72 ℃ for 10 min.

Agarose gel electrophoresis detection analysis of PCR amplification products

Agarose gel electrophoresis detection is divided into 3 steps: 1) preparing 3.5% agarose gel, dyeing by using nucleic acid dye, spotting 4.5 mu L, and performing electrophoresis at 120V for 1.0-1.2 h after spotting; 2) when the DNA fragments with different molecular weights are clearly separated, imaging in a BIO-RADGel Doc 2000 gel imaging system; 3) analyzing the polymorphism of the InDel locus according to the agarose gel electrophoresis result;

for the 23-bp insertion/deletion polymorphic site existing at g.3422967_34262989 site of the Australian white sheep PRL gene, the analysis result of the polymorphism of the insertion/deletion mutation (InDel) in different sheep individuals is shown in figure 1, after the detection of the PCR amplification product (primer pair P1) by agarose gel electrophoresis, the insertion/insertion genotype (II) of the amplified corresponding insertion/deletion polymorphic site shows 110bp one stripe, the insertion/deletion genotype (ID) shows two stripes of 110bp and 87bp, and the deletion/deletion genotype (DD) shows 87bp one stripe. The results of the analysis were verified by sequencing, see FIG. 2.

5. Frequency statistical analysis of sheep PRL gene InDel locus

1) Gene and genotype frequency

Genotype frequencyThe ratio is the ratio of the number of individuals with a certain genotype to the total number of individuals in a population. P_YY＝N_YYN, wherein P_YYRepresents the YY genotype frequency of a certain locus; n is a radical of_YYRepresenting the number of individuals in the population having a YY genotype; and N is the total number of detection groups.

Gene frequency refers to the relative ratio of a certain number of genes in a population to the total number of its alleles. The formula for the calculation can be written as: p_Y＝(2N_YY+N_Ya1+N_Ya2+N_Ya3+N_Ya4+……+N_Yan)/2N

In the formula, P_YIndicating allele Y frequency, N_YYRepresenting the number of individuals in the population having the YY genotype, N_YaiRepresenting the number of individuals having the Yai genotype in the population, a1-an is n mutually different multiple alleles of allele Y.

2) Statistical results

The genotype frequencies and allele frequencies of 23-bp insertion/deletion polymorphic sites at g.3422967-34262989 sites in the PRL gene from the Australian white sheep sample are shown in Table 3.

TABLE 3 frequency distribution table of InDel locus gene of Australian white sheep PRL gene

6. Association analysis of sheep PRL gene InDel site gene effect

Genotype data: carrying out agarose gel electrophoresis on the genotype identified after PCR amplification;

production data: data for lambs per litter in Australian white sheep.

And (3) correlation analysis model: the SPSS (18.0) software was used to analyze breeds for the correlation of various factors with lambing number traits. The resulting data is first analyzed descriptively by statistics to determine if outliers exist. The effect of the genotype was then analyzed using analysis of variance, a multivariate linear model, based on the characteristics of the data. In the data processing process, the effects of individuals, the interaction between genes and the genotype are taken into considerationAnd determining a model to perform correlation analysis. Furthermore, the trade-off is made according to actual conditions, and the complete model: y is_ijlm＝μ+S_i+HYS_j+G_l+e_ijlm(ii) a Wherein, Y_ijlm: (ii) an individual phenotype record; μ: an overall mean; s_i: farrowing age effect; HYS_j: the mean value of sheep population; g_l: the fixing effect of the genotype; e.g. of the type_ijlm: random error. Results of the first births were analyzed using analysis of variance, the results of which are shown in table 4.

TABLE 4 analysis of variance of PRL gene InDel locus and number of lambs per litter in Australian white sheep

Note: the average over-shoulder letters a and b differ by a very significant difference (P < 0.05); the average shoulder letters differ by a and c1 indicating that the difference is extremely significant (P < 0.01);

as can be seen from Table 4, the polymorphism of the PRL gene 23-bp InDel has a significant influence on the number of first-birth lambs and the average lambs of Australian white sheep (P is less than 0.05), and the ID genotype individual character is superior to that of II and DD genotype individuals. Therefore, the ID genotype of the 23-bp insertion/deletion polymorphic site (NC-040271.1: g.3422967-34262989) of the sheep PRL gene can be used as a DNA molecular marker of the sheep lambing number.

In a word, the invention utilizes a PCR amplification method to detect the genotype of the 23-bp insertion/deletion polymorphic site (NC-040271.1: g.3422967-34262989) of the sheep PRL gene, and the genotype is associated and analyzed with the number of lambs born in the first five fetuses of Australian white sheep, so that a molecular marker which can be used as an auxiliary selection in molecular breeding of the number of lambs born in sheep is discovered, and the breeding speed of improved varieties is accelerated. The detection method of the sheep PRL gene insertion/deletion polymorphism, which is established by the invention, provides theoretical and practical basis for realizing Marker Assisted Selection (MAS) of sheep lambing number characters by using InDel.

The related sequences of the invention are as follows:

1. artificially synthesized SEQ NO.1

Gggaagggaagagaaacagagg 22

2. Artificially synthesized SEQ NO.2

Gcttgtagggtggaacactga 21

3. NC-040271.1 g.3422967-34262989 bit insertion sequence

Gagtctttatgaagagaaacacc 23

Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the embodiments disclosed.

Sequence listing

<110> Tianjin Olympic group animal husbandry Co., Ltd

<120> detection primer pair, kit, method and application of PRL gene insertion/deletion polymorphism of sheep

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>22

<212>DNA

<213> upstream primer (Unknown)

<400>1

gggaagggaa gagaaacaga gg 22

<210>2

<211>21

<212>DNA

<213> downstream primer (Unknown)

<400>2

gcttgtaggg tggaacactg a 21

<210>3

<211>23

<212>DNA

<213> NC-040271.1: g.3422967-34262989 bit insertion sequence (Unknown)

<400>3

gagtctttat gaagagaaac acc 23

Claims

1. A primer pair for detecting sheep PRL gene insertion/deletion polymorphism is characterized in that: the primer pair can be used for PCR amplification of a fragment containing the sheep PRL gene intron region insertion/deletion polymorphic site.

2. The pair of primers for detecting an insertion/deletion polymorphism of a PRL gene in sheep according to claim 1, wherein: the insertion/deletion polymorphic site is 23-bp insertion/deletion polymorphic site at position NC-040271.1: g.3422967-34262989 of the sheep PRL gene.

3. The pair of primers for detecting an insertion/deletion polymorphism of a PRL gene in sheep according to claim 1 or 2, wherein: the primer pair is as follows:

an upstream primer: SEQ NO. 1;

a downstream primer: SEQ NO. 2.

4. Use of the pair of primers for detecting an insertion/deletion polymorphism of a PRL gene in sheep as set forth in any one of claims 1 to 3 in molecular marker-assisted selective breeding of lambing number in sheep.

5. A detection kit for an sheep PRL gene insertion/deletion polymorphism comprising a primer set according to any one of claims 1 to 3.

6. A method for detecting an sheep PRL gene insertion/deletion polymorphism using a primer set according to any one of claims 1 to 3, characterized in that: the method comprises the following steps:

7. The method for detecting an insertion/deletion polymorphism of a PRL gene in sheep according to claim 6, wherein: the reaction procedure adopted by the PCR amplification is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 68 ℃ for 30s, extension at 72 ℃ for 12-24 s, and 18 cycles, wherein the annealing temperature is reduced by 1 ℃ after each cycle; annealing at 50 ℃ for 30s, extending at 72 ℃ for 12-24 s, and performing 25-30 cycles; extending for 10min at 72 ℃;

8. The method for detecting an insertion/deletion polymorphism of a PRL gene in sheep according to claim 6 or 7, characterized in that: according to the electrophoresis result, the insertion/insertion genotype II of the insertion/deletion polymorphic site is expressed as a 110bp strip, the insertion/deletion genotype ID is expressed as two strips of 110bp and 87bp, and the deletion/deletion genotype DD is expressed as a 87bp strip.

9. Use of a method of detecting an insertion/deletion polymorphism in a PRL gene in a sheep according to any one of claims 6 to 8 in molecular marker assisted selective breeding of lambs in sheep.

10. Use according to claim 9, characterized in that: the application is as follows: the insertion/deletion genotype of the insertion/deletion polymorphic site obtained by the detection method is applied to the aspect of DNA markers for improving the number of lambs born in the 1 st sheep and/or the average number of lambs born.