CN111088262A - Method for improving flavone content of safflower hairy roots by transferring CTMYB1 gene - Google Patents
Method for improving flavone content of safflower hairy roots by transferring CTMYB1 gene Download PDFInfo
- Publication number
- CN111088262A CN111088262A CN202010059959.8A CN202010059959A CN111088262A CN 111088262 A CN111088262 A CN 111088262A CN 202010059959 A CN202010059959 A CN 202010059959A CN 111088262 A CN111088262 A CN 111088262A
- Authority
- CN
- China
- Prior art keywords
- safflower
- gene
- ctmyb1
- hairy roots
- flavone
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Abstract
The invention discloses a method for improving flavone content of safflower hairy roots by transferring CTMYB1 gene. The method comprises the following steps: (1) the CTMYB1 gene is obtained by cloning from the safflower by adopting a gene cloning method; (2) constructing and transforming a vector; (3) induction of safflower hairy roots; (4) identifying the transgenic hairy roots; (5) GUS staining to identify the transformation efficiency; (6) and (3) measuring the content of the total flavonoids by an aluminum trichloride method. The invention has the advantages of improving the content of flavonoid active ingredients in the hairy roots of the safflower, further obtaining a large amount of safflower flavone in a short time, and providing a novel high-quality medicine source for the commercial production and utilization of the safflower flavone in China.
Description
Technical Field
The invention relates to a method for improving the flavone content of safflower hairy roots, in particular to a method for improving the flavone content of safflower hairy roots by transferring CTMYB1 gene.
Background
Safflower (Latin scientific name: Carthamus tinctorius L.): from the order of Dicotyledoneae, the subclass Hepialidae, the order of Campanulales, the family of Compositae, the subfamily Convolvulaceae, the family of Cynara, the genus of Carthamus, the species of Carthamus. Alias: the red-bluish flowers, the red-thorn flowers, the dried tubular flowers, the orange red, the narrow floral tubes, the 5-split tips, the slit shapes and the yellow anthers, which are combined into tubes, are higher than the slivers, and the stigma is exposed at the center. Has special fragrance and slightly bitter taste. The preferred one is long, bright red, soft. Mainly produced in Henan, Hunan, Sichuan, Xinjiang, Tibet, etc. Promoting blood circulation, dredging channels, removing blood stasis, and relieving pain, and can be used for treating amenorrhea, dysmenorrhea, lochiorrhea, thoracic obstruction, cardialgia, blood stasis, abdominal pain, pricking pain in chest and hypochondrium, traumatic injury, and pyocutaneous disease with swelling and pain. Has effects of promoting blood circulation, removing blood stasis, eliminating dampness, and relieving swelling. The safflower oil is edible oil which is recognized in the world and has the functions of eating, health care and beauty treatment.
Safflower has a great development potential as a crop with extremely high medicinal and industrial values. In recent years, safflower is a typical crop which is not fully utilized due to low yield, incapability of keeping up with product development and the like, and has small planting area in China. At present, no report related to the large-scale obtaining of the content of the safflower flavonoids active ingredients through CTMYB1 gene overexpression is found.
Disclosure of Invention
The invention aims to solve the problem of low yield of safflower flavone at present and provides a method for improving the content of safflower hairy root flavone by transferring CTMYB1 gene. The invention has the characteristics of improving the content of flavonoid active ingredients in the hairy roots of the safflower, further obtaining a large amount of safflower flavone in a short time and providing a novel high-quality medicine source for the commercial production and utilization of the safflower flavone in China.
The technical scheme of the invention is as follows: a method for improving the flavone content of safflower hairy roots by transferring CTMYB1 genes comprises the following steps:
(1) the CTMYB1 gene is obtained by cloning from the safflower by adopting a gene cloning method;
(2) constructing and transforming a vector;
(3) induction of safflower hairy roots;
(4) identifying the transgenic hairy roots;
(5) GUS staining to identify the transformation efficiency;
(6) and (3) measuring the content of the total flavonoids by an aluminum trichloride method.
In the method for improving the content of the flavone in the hairy roots of the safflower by transferring the CTMYB1 gene, in the step (1), total RNA of the leaves of the safflower is extracted by a TRIzol method, reverse transcription operation is carried out, and cDNA is used as a PCR template; the reverse transcription Reaction system is 20 mu L, and contains 2 mu L LRNase-free Water, 10 mu L2 XTS Reaction Mix, 4 mu L total RNA, 1 mu L gDNA Remover, 1 mu L0.5 g/mu L absorbed Oligo (dT) Primer, 1 mu L0.1 g/mu L Random Primer and 1 mu L MixransScript RT/RI Enzyme Mix; the reverse transcription program is 5min at 25 ℃, 1h at 42 ℃, 5min at 75 ℃ for inactivation, 5min at room temperature for cooling, and centrifugation is carried out after the reaction is finished to be used as a template of PCR reaction; the sequence of the upstream primer is 5'-ATGGGAAGAGCTCCTTGTTGT-3', and the sequence of the downstream primer is 5'-TCACAAGTTCTCATCTCCATCCTG-3'; the PCR reaction was performed in 20. mu.L total, containing 1. mu.L of reverse transcription product, 1. mu.L of each of 10mmol/L of upstream and downstream primers, 10. mu.L of REMIX and ddH2O to make up 20. mu.L.
In the method for improving the content of the flavone in the safflower hairy root by transferring the CTMYB1 gene, the PCR reaction program comprises the following steps: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 45s, extension at 72 ℃ for 1min,31 cycles, final extension at 72 ℃ for 10min, and detection by 1% agarose gel electrophoresis after PCR is finished;
the PCR product is subjected to gel cutting, recovery and Purification by using TaKaRa MiniBEST Plasmid Purification Kit Ver 4.0, then is connected to pMD19-T Vector (TaKaRa), is subjected to heat shock transformation to escherichia coli DH5 α, is subjected to Ampicillin (Ampicillin) resistance screening, a monoclonal strain is selected for liquid culture, a M13 primer is used for bacterial liquid PCR detection, a bacterial liquid containing positive plasmids is selected for bidirectional sequencing by using an M13 primer, and sequencing results are spliced to obtain the CTMYB1 gene.
In the method for improving the content of the flavone in the safflower hairy roots by transforming the CTMYB1 gene, in the step (2), an 8bp vector homologous sequence and an enzyme cutting site are added in front of an upstream primer and a downstream primer according to a homologous recombination method, wherein the upstream primer CTMYB1-F is ' 5' -CCATGGAGATGGGAAGAGCTCCTTGTTGT ' and the downstream primer CTMYB1-R ' 5'-GGTGACCTCACAAGTTCTCATCTCCATCCTG-3' ', and the enzyme cutting site is Nco I and Eco 91I; performing PCR amplification by taking a T carrier as a template, wherein the PCR method and the system are the same as those in the step (1), and the gel cutting, recovery and purification are the same as those in the step (1); carrying out double enzyme digestion on pCAMBIA3301 with Nco I and Eco 91I; the enzyme cutting system is 10 mu L, 1 mu L of each plasmid DNA 6 mu L, Nco I and Eco91I, 10 Xbuffer Fly 1 mu L, ddH2O are supplemented to 10 mu L, and the mixture is placed at 37 ℃ for 2 h; the CTMYB1 fragment was ligated to purified pCAMBIA3301 by homologous recombination, in 10. mu.L, containing 1. mu.L of PCR-purified product, 5 Xligation-Free Cloning Master Mix 4. mu. L, pCAMBIA 33012. mu.L, supplemented to 10. mu.L with ddH 2O: the reaction condition is ice bath for 30 min; the method for transforming the heat shock into the escherichia coli and sequencing are the same as the step (1); preparing and transforming agrobacterium tumefaciens, transferring the pCAMBIA3301 empty vector into agrobacterium tumefaciens A4, and identifying agrobacterium rhizogenes A4 of transferred GUS gene and CTMYB1 gene by PCR; the reaction program is pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 45s, extension at 72 ℃ for 1min,31 cycles, final extension at 72 ℃ for 10min, and detection by 1% agarose gel electrophoresis after PCR.
In the method for improving the content of flavone in the hairy roots of the safflower by transferring the CTMYB1 gene, in the step (3), two bottles of 15-30-day-old aseptic seedlings of the safflower are taken; one group was added to 50ml of the infection solution A "50 ml OD-600-0.6 Agrobacterium A4" to completely immerse both hypocotyls and cotyledons in the liquid for 10 minutes. One group is added into 50ml of infection liquid B, namely 50ml of OD value-600-0.6 agrobacterium A4 with GUS reporter gene; the other group is added into 50ml of infection liquid C, wherein 50ml of OD value is-600-0.6, agrobacterium tumefaciens A4 carries CTMYB1 gene; adding into MS culture medium at 25 deg.C, dark culturing for 24-72 hr, transferring MS solid culture medium containing 200mg/ml of cephalosporin for 15 days, differentiating hypocotyl and cotyledon to form hairy root, cutting off 2-4CM hairy root, adding 100mg/ml of cephalosporin MS solid culture medium, screening and culturing, screening out hairy root with high growth speed after 15 days, subculturing on MS solid culture medium containing 50mg/ml of cephalosporin, subculturing for 2 times to obtain detoxified hairy root, cutting off 2-4CM hairy root, adding MS liquid culture medium, performing amplification culture, and further screening on MS culture medium to obtain wild type, GUS reporter gene and transgenic sterile hairy root.
In the method for improving the flavone content of the safflower hairy roots by transferring the CTMYB1 gene, in the step (4), total DNA of the hairy roots is extracted by adopting a CTAB method, GUS primers are designed to be 5'-AACGGGGAAACTCAGCAAGC-3' and 5'-CAAATCGCCGCTTTGGACATA-3', and a target gene is 285 bp; the CTMYB1 primer is designed to have an upstream primer sequence of 5'-ATGGGAAGAGCTCCTTGTTGT-3', a downstream primer sequence of 5'-TCACAAGTTCTCATCTCCATCCTG-3' and a target gene of 750 bp; identifying hairy roots transformed with GUS gene and CTMYB1 gene by PCR, wherein the reaction program is pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 45s, extension at 72 ℃ for 1min, and 31 cycles; finally, extending for 10min at 72 ℃; after the PCR reaction, the PCR product was detected by electrophoresis on a 1% agarose gel.
In the method for improving the content of the flavone in the safflower hairy roots by transferring the CTMYB1 gene, in the step (5), (1) precooled 90% acetone is used for fixing for 10min, and the safflower hairy roots are stored at 4 ℃ for standby; rinsing with staining buffer without X-Gluc; (2) soaking in precooled staining buffer, vacuumizing for 10min, and incubating at 37 ℃; (3) rinsing the sample with 50%, 70% and 100% ethanol successively, and soaking for 5min each time; (4) adding 100% ethanol for soaking until complete decolorization; (5) stereomicroscope photographic recordings.
In the method for improving the flavone content of the safflower hairy root by transferring the CTMYB1 gene, in the step (6), the total flavone content of the wild type, the GUS reporter gene and the transgenic sterile hairy root obtained in the step (3) is measured; determining the ultrasonic extraction efficiency by measuring the total flavone by an aluminum trichloride method, and drawing a standard curve of the total flavone: weighing 3.6mg of rutin standard, and adding 20mL of 80% methanol into a volumetric flask to obtain a rutin standard solution at constant volume; respectively sucking 4.0, 2.0, 1.0, 0.5, 0.25, 0.125, 0.063 and 0.031mL rutin standard solution, and placing in a 10mL volumetric flask; adding 0.1mol/L of 2mL of aluminum trichloride solution and 1mol/L of 3mL of potassium acetate solution, fixing the volume with 80% methanol solution, shaking up, standing at room temperature for 30min, setting a blank control with 80% methanol solution as a sample, setting a detection wavelength to be 420nm, and measuring the absorbance. And (3) drawing a standard curve by taking the concentration mg/mL of rutin as an abscissa and the absorbance value A as an ordinate, and calculating the content according to a linear investigation result.
Compared with the prior art, the invention has the following beneficial effects:
the invention belongs to the technical field of genetic engineering, and relates to a method for improving the content of secondary flavone in safflower hairy roots by transferring endogenous CTMYB1 gene. In the prior art, the yield of the safflower flavone is low, and the requirement of human beings on the secondary flavone of the safflower cannot be met. According to the invention, a coding sequence of a CTMYB1 gene is cloned from safflower, a plant high-efficiency overexpression vector is constructed, and safflower hairy roots of the CTMYB1 gene are obtained by genetically transforming safflower explants (stems and leaves). The hairy roots are added into 100mg/ml cefMS solid medium for screening culture. After 15 days, the hairy roots of the safflower with high growth speed are screened out and subcultured on an MS solid culture medium containing 50mg/ml of cephalosporin. After subculture for 2 times, detoxified hairy roots of safflower are obtained. Then 2-4CM hairy roots are cut off and added into MS liquid culture medium for amplification culture. Thereby obtaining the safflower hairy roots which grow fast and have more lateral root branches. And finally, screening on an MS culture medium to obtain a wild type, a GUS reporter gene and a transgenic sterile hairy root. And measuring the content of total safflower flavone in wild type, GUS gene reporter gene and transgenic hairy root of safflower by using an aluminum trichloride method. The invention has the advantages that: the content of the effective components of the total flavonoids in the hairy roots of the safflower is obviously improved; provides a novel high-quality medicine source for producing the safflower secondary flavone with important clinical requirements: the invention has reliable effect; the cost of the raw safflower flavone is low; the production process has no environmental pollution; therefore, the genetic engineering means is utilized to transform the safflower transcription factor CTMYB1 gene into a safflower explant to obtain an overexpressed transgenic safflower hairy root, and a large amount of carthamin can be obtained in a short time through subculture and enlarged shaking culture, so that a novel high-quality medicine source is provided for the commercial production and utilization of the carthamin in China.
Experiments prove that:
the case of the vector (pCAMBIA3301) of examples 1 to 3 of the present invention is shown in FIG. 1; the induction process and efficiency of the safflower hairy root are as follows, aseptic seedling of safflower (figure 2), agrobacteria A4 infection (figure 3), growing safflower hairy root (figure 4), and shaking culture to obtain a large amount of safflower hairy root (figure 5).
The hairy root induction efficiency of Agrobacterium on safflower is shown in Table 1.
TABLE 1 hairy root Induction efficiency of Agrobacterium on safflower
The transformation efficiencies identified by GUS staining are shown in Table 2.
TABLE 2 transformation efficiency of GUS staining identification
In conclusion, the invention has the advantages of improving the content of flavonoid active ingredients in the hairy roots of the safflower, further obtaining a large amount of safflower flavone in a short time, and providing a novel high-quality medicine source for the commercial production and utilization of the safflower flavone in China.
Drawings
FIG. 1 is a diagram showing the condition of the vector of the present invention (pCAMBIA 3301);
FIG. 2 is a diagram of a safflower aseptic seedling in the process of inducing hairy roots of safflower according to the present invention;
FIG. 3 is a graph showing Agrobacterium A4 infection during induction of hairy roots of safflower according to the present invention;
FIG. 4 is a diagram of the developed hairy roots of safflower during the induction process of hairy roots of safflower according to the present invention;
FIG. 5 shows that a large amount of hairy roots of safflower are obtained by shaking culture in the process of inducing hairy roots of safflower according to the present invention;
FIG. 6 shows the results of measuring the content of flavonoids in wild-type, GUS reporter gene and transgenic sterile hairy roots obtained in the examples of the present invention.
Detailed Description
The invention is further illustrated by the following figures and examples, which are not to be construed as limiting the invention.
Example 1:
(1) the CTMYB1 gene is obtained by cloning from the safflower by adopting a gene cloning method;
the method comprises the steps of extracting 15-30d total RNA of safflower leaves by a TRIzol method, carrying out reverse transcription operation according to the instruction of a full-scale gold biological reagent company, taking cDNA as a PCR template, carrying out gel cutting, recycling and purifying on a PCR product by using TaKaRa MiniBESTplasmid Purification Kit Ver 4.0, connecting the PCR product to pMD19-T Vector (TaKaRa), carrying out heat shock transformation on Escherichia coli DH5 α, carrying out Ampicillin (Ampicillin) resistance screening, selecting a monoclonal strain for carrying out liquid culture, carrying out PCR detection on the strain by using an M13 primer, selecting a sequencing solution containing positive plasmids, sending the sequencing solution to Beijing Okoku tripod biotechnology limited company for carrying out bidirectional sequencing by using an M13 primer, and splicing sequencing results.
(2) Constructing and transforming a vector;
according to the homologous recombination method, an 8bp vector homologous sequence and an enzyme cutting site are added in front of an upstream primer and a downstream primer, and the upstream primer and the downstream primer are consistent with the above. And performing PCR amplification by using the T vector as a template, wherein the PCR method and the system are the same as the above, and the gel cutting, recovering and purifying are the same as the above. pCAMBIA3301 was double digested with Nco I and Eco 91I. The cleavage system was as described above. The CTMYB1 fragment was ligated to purified pCAMBIA 3301. Homologous recombination was used for vector ligation, and the system was as above. The heat shock transformation into E.coli was performed in the same manner and the sequencing was performed as described above. Agrobacterium rhizogenes A4 transformed with GUS gene and CTMYB1 gene was identified by PCR. The reaction procedure was as above. After the PCR was finished, the detection was carried out by 1% agarose gel electrophoresis.
(3) Induction of safflower hairy roots;
taking two bottles of 15-30-day-old safflower aseptic seedlings. 50ml of the infection solution A (50ml OD value (600)0.6 Agrobacterium A4) were added. Adding into MS culture medium at 25 deg.C, and culturing in dark for 24-72 hr. After the dark culture is finished, the hypocotyls and cotyledons are differentiated to form hairy roots 15 days after the transfer of MS solid medium containing 200mg/ml of cephalosporin. Shearing off 2-4CM hairy root, adding 100mg/ml solid medium of cephalosporin MS, and screening and culturing. After 15 days, the hairy roots of the safflower with high growth speed are screened out and subcultured on an MS solid culture medium containing 50mg/ml of cephalosporin. After subculture for 2 times, detoxified hairy roots of safflower are obtained. Then 2-4CM hairy roots are cut off and added into MS liquid culture medium for amplification culture. And finally, continuously screening on an MS culture medium to obtain a wild type, a GUS reporter gene and a transgenic sterile hairy root.
(4) Identifying the transgenic hairy roots;
total DNA of hairy roots was extracted by CTAB method, and GUS primer and CTMYB1 primer were identical to above. Hairy roots transformed with GUS gene and CTMYB1 gene were identified by PCR and the reaction procedure was as above. After the PCR reaction, the PCR product was detected by electrophoresis on a 1% agarose gel.
(5) GUS staining to identify the transformation efficiency;
the identification method was consistent with the above.
(6) And (3) measuring the content of the total flavonoids by an aluminum trichloride method.
The method for measuring total flavonoids by the aluminum trichloride method is consistent with the method. And (4) carrying out total flavone content determination on the wild type, the GUS reporter gene and the transgenic sterile hairy root obtained in the step (3).
Example 2:
(1) the CTMYB1 gene is obtained by cloning from the safflower by adopting a gene cloning method;
(2) constructing and transforming a vector;
(3) induction of safflower hairy roots (A4/3301-GUS/3301-CTMYB);
taking two bottles of 15-30-day-old safflower aseptic seedlings. Was added to 50ml of the staining solution B (50ml OD value (600)0.6 Agrobacterium A4 with GUS reporter gene). Adding into MS culture medium at 25 deg.C, and culturing in dark for 24-72 hr. After the dark culture is finished, the hypocotyls and cotyledons are differentiated to form hairy roots 15 days after the transfer of MS solid medium containing 200mg/ml of cephalosporin. Shearing off 2-4CM hairy root, adding 100mg/ml solid medium of cephalosporin MS, and screening and culturing. After 15 days, the hairy roots of the safflower with high growth speed are screened out and subcultured on an MS solid culture medium containing 50mg/ml of cephalosporin. After subculture for 2 times, detoxified hairy roots of safflower are obtained. Then 2-4CM hairy roots are cut off and added into MS liquid culture medium for amplification culture. And finally, continuously screening on an MS culture medium to obtain a wild type, a GUS reporter gene and a transgenic sterile hairy root.
(4) Identifying the transgenic hairy roots;
(5) GUS staining to identify the transformation efficiency;
(6) and (3) measuring the content of the total flavonoids by an aluminum trichloride method.
Example 3:
(1) the CTMYB1 gene is obtained by cloning from the safflower by adopting a gene cloning method;
(2) constructing and transforming a vector;
(3) induction of safflower hairy roots (A4/3301-GUS/3301-CTMYB);
taking two bottles of 15-30-day-old safflower aseptic seedlings. Was added to 50ml of the infection C (50ml OD value (600)0.6 Agrobacterium A4 with CTMYB1 gene). Adding into MS culture medium at 25 deg.C, and culturing in dark for 24-72 hr. After the dark culture is finished, the hypocotyls and cotyledons are differentiated to form hairy roots 15 days after the transfer of MS solid medium containing 200mg/ml of cephalosporin. Shearing off 2-4CM hairy root, adding 100mg/ml solid medium of cephalosporin MS, and screening and culturing. After 15 days, the hairy roots of the safflower with high growth speed are screened out and subcultured on an MS solid culture medium containing 50mg/ml of cephalosporin. After subculture for 2 times, detoxified hairy roots of safflower are obtained. Then 2-4CM hairy roots are cut off and added into MS liquid culture medium for amplification culture. And finally, continuously screening on an MS culture medium to obtain a wild type, a GUS reporter gene and a transgenic sterile hairy root.
(4) Identifying the transgenic hairy roots;
(5) GUS staining to identify the transformation efficiency;
(6) and (3) measuring the content of the total flavonoids by an aluminum trichloride method.
Sequencing result of coding region of CTMYB1 gene (full length of CDNA):
ATGGGAAGAGCTCCTTGTTGTTCCAAGGTGGGTTTACACCGAGGTGCATGGTCGACCGAAGAAGATAAACTTCTCACGGACCACATTCAAACCCACGGCGAAGGCCAATGGCGTTCCATGCCCTCCAAAGCCGGGTTGCTTAGATGCGGAAAGAGTTGCAGGTTGAGATGGATGAATTATCTCCGGCCAGGTATCAAGAGAGGAAACTTCACGGCCGATGAGAACGAAACCATCATAAATCTCCATGCCATCCACGGCAGCCGATGGTCGTTCATCGCCACGAAACTCGTGGGTCGAACCGACAATGAGATCAAGAACCACTGGAACTCGCACCTTAAACACAAAGTGCTCCCGCCGGCCGACGTCCCCAGAAAAAACAAAAAACAAAAAAGGAAAGTATCCGACAAGTCAAAGAAGAAAGTCAAAGTCGCGGCAGAGAAAGCAGTTGAAATCGTTCATAACGAGCCGGATGTTTCGCCCACTTCGTCGTCGAGTCTAAGGAAGAATGTGAGTTTTGACAACGGAGGTACGACGAGCGGTGCATCGTCGAGCTGTACATTTGAACCCGACGTCGTAACGGCGGACTTCCGGTGGCCGGAGGTGTTCGAGATCGACGGTGCGTCGAGCTTCGATGATCTGAATATGGACGGTCTAGATTTAATGATGTTGAAAGATGATGAAAGTGAGATGTTAGAGAAGTTATATGATGAGTGTTGGCACTTGATCCAGGATGGAGATGAGAACTTGTGA
sequence listing
<110> Guizhou university
<120> method for improving flavone content of safflower hairy roots by transferring CTMYB1 gene
<130>2020
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>750
<212>DNA
<213>CTMYB1
<400>1
atgggaagag ctccttgttg ttccaaggtg ggtttacacc gaggtgcatg gtcgaccgaa 60
gaagataaac ttctcacgga ccacattcaa acccacggcg aaggccaatg gcgttccatg 120
ccctccaaag ccgggttgct tagatgcgga aagagttgca ggttgagatg gatgaattat 180
ctccggccag gtatcaagag aggaaacttc acggccgatg agaacgaaac catcataaat 240
ctccatgcca tccacggcag ccgatggtcg ttcatcgcca cgaaactcgt gggtcgaacc 300
gacaatgaga tcaagaacca ctggaactcg caccttaaac acaaagtgct cccgccggcc 360
gacgtcccca gaaaaaacaa aaaacaaaaa aggaaagtat ccgacaagtc aaagaagaaa 420
gtcaaagtcg cggcagagaa agcagttgaa atcgttcata acgagccgga tgtttcgccc 480
acttcgtcgt cgagtctaag gaagaatgtg agttttgaca acggaggtac gacgagcggt 540
gcatcgtcga gctgtacatt tgaacccgac gtcgtaacgg cggacttccg gtggccggag 600
gtgttcgaga tcgacggtgc gtcgagcttc gatgatctga atatggacgg tctagattta 660
atgatgttga aagatgatga aagtgagatg ttagagaagt tatatgatga gtgttggcac 720
ttgatccagg atggagatga gaacttgtga 750
Claims (8)
1. A method for improving the flavone content of safflower hairy roots by transferring CTMYB1 gene is characterized in that: the method comprises the following steps:
(1) the CTMYB1 gene is obtained by cloning from the safflower by adopting a gene cloning method;
(2) constructing and transforming a vector;
(3) induction of safflower hairy roots;
(4) identifying the transgenic hairy roots;
(5) GUS staining to identify the transformation efficiency;
(6) and (3) measuring the content of the total flavonoids by an aluminum trichloride method.
2. The method for improving the content of flavone in safflower hairy roots by transferring CTMYB1 gene according to claim 1, which comprises the following steps: in the step (1), total RNA of the safflower leaves is extracted by a TRIzol method, reverse transcription operation is carried out, and cDNA is used as a PCR template; the reverse transcription Reaction system is 20 mu L and contains 2 mu L LRNase-free Water, 10 mu L2 XTS Reaction Mix, 4 mu L total RNA, 1 mu L gDNA Remover, 1 mu L0.5 g/mu L absorbed Oligo (dT) Primer, 1 mu L0.1 g/mu L Random Primer and 1 mu L Mixrans Script RT/RI Enzyme Mix; the reverse transcription program is 5min at 25 ℃, 1h at 42 ℃, 5min at 75 ℃ for inactivation, 5min at room temperature for cooling, and centrifugation is carried out after the reaction is finished to be used as a template of PCR reaction; the sequence of the upstream primer is 5'-ATGGGAAGAGCTCCTTGTTGT-3', and the sequence of the downstream primer is 5'-TCACAAGTTCTCATCTCCATCCTG-3'; the PCR reaction was performed in 20. mu.L total, containing 1. mu.L of reverse transcription product, 1. mu.L of each of 10mmol/L of upstream and downstream primers, 10. mu.L of REMIX and ddH2O to make up 20. mu.L.
3. The method for improving the content of flavone in safflower hairy roots by transferring CTMYB1 gene according to claim 2, which comprises the following steps: the PCR reaction program is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 45s, extension at 72 ℃ for 1min,31 cycles, final extension at 72 ℃ for 10min, and detection by 1% agarose gel electrophoresis after PCR is finished;
the PCR product is subjected to gel cutting, recovery and Purification by using TaKaRa MiniBEST Plasmid Purification Kit Ver 4.0, then is connected to pMD19-T Vector (TaKaRa), is subjected to heat shock transformation to escherichia coli DH5 α, is subjected to Ampicillin (Ampicillin) resistance screening, a monoclonal strain is selected for liquid culture, a M13 primer is used for bacterial liquid PCR detection, a bacterial liquid containing positive plasmids is selected for bidirectional sequencing by using an M13 primer, and sequencing results are spliced to obtain the CTMYB1 gene.
4. The method for improving the content of flavone in safflower hairy roots by transferring CTMYB1 gene according to claim 1, which comprises the following steps: in the step (2), an 8bp vector homologous sequence and an enzyme cutting site are added in front of an upstream primer and a downstream primer according to a homologous recombination method, wherein the upstream primer CTMYB1-F is ' 5' -CCATGGAGATGGGAAGAGCTCCTTGTTGT ' and the downstream primer CTMYB1-R is ' 5'-GGTGACCTCACAAGTTCTCATCTCCATCCTG-3' ', and the enzyme cutting sites are Nco I and Eco 91I; performing PCR amplification by taking a T carrier as a template, wherein the PCR method and the system are the same as those in the step (1), and the gel cutting, recovery and purification are the same as those in the step (1); carrying out double enzyme digestion on pCAMBIA3301 with Nco I and Eco 91I; the enzyme cutting system is 10 mu L, 1 mu L of each plasmid DNA 6 mu L, Nco I and Eco91I, 10 Xbuffer Fly 1 mu L, ddH2O are supplemented to 10 mu L, and the mixture is placed at 37 ℃ for 2 h; the CTMYB1 fragment was ligated to purified pCAMBIA3301 by homologous recombination, in 10. mu.L, containing 1. mu.L of PCR-purified product, 5 Xligation-Free Cloning Master Mix 4. mu. L, pCAMBIA 33012. mu.L, supplemented to 10. mu.L with ddH 2O: the reaction condition is ice bath for 30 min; the method for transforming the heat shock into the escherichia coli and sequencing are the same as the step (1); preparing and transforming agrobacterium tumefaciens, transferring the pCAMBIA3301 empty vector into agrobacterium tumefaciens A4, and identifying agrobacterium rhizogenes A4 of transferred GUS gene and CTMYB1 gene by PCR; the reaction program is pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 45s, extension at 72 ℃ for 1min,31 cycles, final extension at 72 ℃ for 10min, and detection by 1% agarose gel electrophoresis after PCR.
5. The method for improving the content of flavone in safflower hairy roots by transferring CTMYB1 gene according to claim 1, which comprises the following steps: in the step (3), two bottles of 15-30-day-old aseptic seedlings of safflower are taken; one group was added to 50ml of the infection solution A "50 ml OD-600-0.6 Agrobacterium A4" to completely immerse both hypocotyls and cotyledons in the liquid for 10 minutes. One group is added into 50ml of infection liquid B, namely 50ml of OD value-600-0.6 agrobacterium A4 with GUS reporter gene; the other group is added into 50ml of infection liquid C, wherein 50ml of OD value is-600-0.6, agrobacterium tumefaciens A4 carries CTMYB1 gene; adding into MS culture medium at 25 deg.C, dark culturing for 24-72 hr, transferring MS solid culture medium containing 200mg/ml of cephalosporin for 15 days, differentiating hypocotyl and cotyledon to form hairy root, cutting off 2-4CM hairy root, adding 100mg/ml of cephalosporin MS solid culture medium, screening and culturing, screening out hairy root with high growth speed after 15 days, subculturing on MS solid culture medium containing 50mg/ml of cephalosporin, subculturing for 2 times to obtain detoxified hairy root, cutting off 2-4CM hairy root, adding MS liquid culture medium, performing amplification culture, and further screening on MS culture medium to obtain wild type, GUS reporter gene and transgenic sterile hairy root.
6. The method for improving the content of flavone in safflower hairy roots by transferring CTMYB1 gene according to claim 1, which comprises the following steps: in the step (4), total DNA of the hairy roots is extracted by adopting a CTAB method, GUS primers are designed to be 5'-AACGGGGAAACTCAGCAAGC-3' and 5'-CAAATCGCCGCTTTGGACATA-3', and a target gene is 285 bp; the CTMYB1 primer is designed to have an upstream primer sequence of 5'-ATGGGAAGAGCTCCTTGTTGT-3', a downstream primer sequence of 5'-TCACAAGTTCTCATCTCCATCCTG-3' and a target gene of 750 bp; identifying hairy roots transformed with GUS gene and CTMYB1 gene by PCR, wherein the reaction program is pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 45s, extension at 72 ℃ for 1min, and 31 cycles; finally, extending for 10min at 72 ℃; after the PCR reaction, the PCR product was detected by electrophoresis on a 1% agarose gel.
7. The method for improving the content of flavone in safflower hairy roots by transferring CTMYB1 gene according to claim 1, which comprises the following steps: in the step (5), (1) pre-cooled 90% acetone is used for fixing for 10min, and the mixture is stored at 4 ℃ for standby; rinsing with staining buffer without X-Gluc; (2) soaking in precooled staining buffer, vacuumizing for 10min, and incubating at 37 ℃; (3) rinsing the sample with 50%, 70% and 100% ethanol successively, and soaking for 5min each time; (4) adding 100% ethanol for soaking until complete decolorization; (5) stereomicroscope photographic recordings.
8. The method for improving the content of flavone in safflower hairy roots by transferring CTMYB1 gene according to claim 1, which comprises the following steps: in the step (6), the wild type, the GUS reporter gene and the transgenic sterile hairy root obtained in the step (3) are subjected to total flavone content measurement; determining the ultrasonic extraction efficiency by measuring the total flavone by an aluminum trichloride method, and drawing a standard curve of the total flavone: weighing 3.6mg of rutin standard, and adding 20mL of 80% methanol into a volumetric flask to obtain a rutin standard solution at constant volume; respectively sucking 4.0, 2.0, 1.0, 0.5, 0.25, 0.125, 0.063 and 0.031mL rutin standard solution, and placing in a 10mL volumetric flask; adding 0.1mol/L of 2mL of aluminum trichloride solution and 1mol/L of 3mL of potassium acetate solution, fixing the volume with 80% methanol solution, shaking up, standing at room temperature for 30min, setting a blank control with 80% methanol solution as a sample, setting a detection wavelength to be 420nm, and measuring the absorbance. And (3) drawing a standard curve by taking the concentration mg/mL of rutin as an abscissa and the absorbance value A as an ordinate, and calculating the content according to a linear investigation result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010059959.8A CN111088262A (en) | 2020-01-19 | 2020-01-19 | Method for improving flavone content of safflower hairy roots by transferring CTMYB1 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010059959.8A CN111088262A (en) | 2020-01-19 | 2020-01-19 | Method for improving flavone content of safflower hairy roots by transferring CTMYB1 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111088262A true CN111088262A (en) | 2020-05-01 |
Family
ID=70398797
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010059959.8A Pending CN111088262A (en) | 2020-01-19 | 2020-01-19 | Method for improving flavone content of safflower hairy roots by transferring CTMYB1 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111088262A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111183899A (en) * | 2020-01-19 | 2020-05-22 | 贵州大学 | Method for rapidly inducing safflower hairy roots |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030027747A1 (en) * | 2001-07-12 | 2003-02-06 | Yatcilla Michael T. | Food products and dietary supplements containing phenolated proteins and process for preparing the same |
| US20080034453A1 (en) * | 1999-05-06 | 2008-02-07 | Nordine Cheikh | Annotated Plant Genes |
| US20090205063A1 (en) * | 2004-07-14 | 2009-08-13 | Mendel Biotechnology | Plant polynucleotides for improved yield and quality |
| CN102988457A (en) * | 2012-12-24 | 2013-03-27 | 重庆市中药研究院 | Total flavone extract of lonicera macranthoides leaves, and preparation method and application thereof |
| CN103288945A (en) * | 2013-06-26 | 2013-09-11 | 中国农业科学院棉花研究所 | Cotton MYB transcription factor and encoding gene and application thereof |
| CN104357479A (en) * | 2014-11-18 | 2015-02-18 | 西南大学 | Application of interference in expression of xanthein and excessive expression of lycopene in preparation of brassica plants with red petals |
| CN104845978A (en) * | 2015-05-19 | 2015-08-19 | 吉林农业大学 | Safflower MYB (v-myb myeloblastosis viral oncogene homolog (avian)) gene and application thereof |
-
2020
- 2020-01-19 CN CN202010059959.8A patent/CN111088262A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080034453A1 (en) * | 1999-05-06 | 2008-02-07 | Nordine Cheikh | Annotated Plant Genes |
| US20030027747A1 (en) * | 2001-07-12 | 2003-02-06 | Yatcilla Michael T. | Food products and dietary supplements containing phenolated proteins and process for preparing the same |
| US20090205063A1 (en) * | 2004-07-14 | 2009-08-13 | Mendel Biotechnology | Plant polynucleotides for improved yield and quality |
| CN102988457A (en) * | 2012-12-24 | 2013-03-27 | 重庆市中药研究院 | Total flavone extract of lonicera macranthoides leaves, and preparation method and application thereof |
| CN103288945A (en) * | 2013-06-26 | 2013-09-11 | 中国农业科学院棉花研究所 | Cotton MYB transcription factor and encoding gene and application thereof |
| CN104357479A (en) * | 2014-11-18 | 2015-02-18 | 西南大学 | Application of interference in expression of xanthein and excessive expression of lycopene in preparation of brassica plants with red petals |
| CN104845978A (en) * | 2015-05-19 | 2015-08-19 | 吉林农业大学 | Safflower MYB (v-myb myeloblastosis viral oncogene homolog (avian)) gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| GUAN LL等: "Carthamus tinctorius MYB transcription 1(MYB1) mRNA,complete cds", 《GENBANK DATABASE》 * |
| 张雪: "红花黄色素生物合成转录因子基因CtMYB1的克隆、表达分析及功能初步研究", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
| 董园园等: "基于红花不同组织转录组数据的转录因子分析", 《中草药》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111183899A (en) * | 2020-01-19 | 2020-05-22 | 贵州大学 | Method for rapidly inducing safflower hairy roots |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Establishment of a highly efficient transformation system for pepper (Capsicum annuum L.) | |
| EP3816292A1 (en) | Method of obtaining multi-leaf alfalfa material by means of mspalm1 artificial site-directed mutant | |
| CN103215280A (en) | Peanut SPL (squamosa promoter-binding protein-like) transcription factor gene, as well as encoded protein and application thereof | |
| CN112626082B (en) | Maize geneZmSCL14Application in regulating and controlling plant root development | |
| CN111088262A (en) | Method for improving flavone content of safflower hairy roots by transferring CTMYB1 gene | |
| CN103205427B (en) | Peanut seed embryo specificity promoter and cloning and application thereof | |
| CN106434691A (en) | Application of OsFTL12 gene in control over paddy rice reproductive growth transition and plant type establishment | |
| CN110592100A (en) | Cassava CAMTA gene and construction and disease-resistant application of suppression expression vector thereof | |
| CN109536513A (en) | Chinese cabbage Stamen development related gene B rCRF11a and its application | |
| CN102533804B (en) | Artemisia sphaerocephala krasch delta 12 fatty acid dehydrogenase (As flavin adenine dinucleotide 2 (FAD2)) gene and application | |
| CN108841853B (en) | Carrot genetic transformation method using glyphosate as screening agent | |
| KR20230001450A (en) | Method for producing cabbage plant having late-flowering trait using CRISPR/Cas complex | |
| CN103695422B (en) | Paddy rice root tip specific expression promoter Pro-Os04g24469 and application thereof | |
| CN113355337A (en) | Method for creating rehmannia heterozygosis mutant and application | |
| CN109706150B (en) | Peanut seed specific expression promoter AHSSP29 and application thereof | |
| CN113215190B (en) | Method for preparing citrus homozygous mutant by CRISPR/Cas 9-mediated gene editing technology | |
| CN112899277B (en) | Cotton pollen fertility-related long-chain non-coding RNA and application of target gene thereof | |
| CN114672489B (en) | Tobacco gland Mao Qidong seed pNtGGPPS2a and application thereof | |
| CN113234754B (en) | Efficient genetic transformation method taking abelmoschus manihot embryo as explant | |
| CN116555301B (en) | SlMETS1 gene and application thereof in regulation and control of tomato growth and development | |
| CN116554291B (en) | Pear bZIP transcription factor PubZIP914 and application thereof | |
| DE69927645T2 (en) | In a plant cell functional promoter | |
| CN116769820A (en) | Preparation method of rice germplasm with lower amylose content | |
| CN109913450B (en) | Promoter pSSP3 specifically expressed in rice stamen and application thereof | |
| CN107760679B (en) | Plant pistil specific promoter and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200501 |
|
| RJ01 | Rejection of invention patent application after publication |