CN111084884A - Function and application of RGS14 in drugs for protecting liver and maintaining lipid metabolism homeostasis - Google Patents

Abstract

The invention discloses a function and application of RGS14 in a medicament for protecting liver and maintaining fat metabolism steady state. Under the condition of high-fat high-cholesterol diet feeding, the mice with the RGS14 gene deletion show more rapid weight gain, higher liver weight and epididymis white fat weight, and the liver weight-to-weight ratio and the epididymis white fat weight-to-weight ratio are both obviously increased; pathological results show that RGS14 knockout can remarkably promote high-fat diet-induced liver lipid accumulation and promote the occurrence of obesity and non-alcoholic fatty liver disease. Further, by establishing an in vitro cell model, in vitro overexpression of RGS14 can inhibit hepatocyte lipid accumulation, while inhibition of RGS14 expression can promote hepatocyte lipid accumulation. Therefore, RGS14 can be used for preparing medicines for preventing, relieving and treating obesity and/or non-alcoholic fatty liver disease.

Description

Function and application of RGS14 in drugs for protecting liver and maintaining lipid metabolism homeostasis

Technical Field

The invention belongs to the field of functions and applications of genes, and particularly relates to a function and an application of RGS14 in a medicament for protecting liver and maintaining fat metabolism steady state.

Background

In the 21 st century, with the development of economy and change of life style, the prevalence of overweight and obesity is on the rise, and the rise speed is increased, about 14 billion adults are in an overweight state in 2005 worldwide, of which nearly 4 billion people belong to the obesity range; the data are predicted to increase to 23 hundred million and 7 hundred million respectively by 2015, in China, the prevalence rates of overweight (Body Mass Index, BMI: 25.0-29.9kg/m2) and obesity (BMI >30kg/m2) of Chinese adults in 2010 have reached 27.9% and 5.1% respectively, 67 disease burden related risk factors are tracked in a research report of 2010 global disease burden, and the results show that the Body Mass Index is increased from the tenth position in 1990 to the sixth position in 2010 and the Body Mass Index is suggested to be an important risk factor for diseases such as cardiovascular diseases and nonalcoholic fatty liver diseases. While central obesity and weight gain are major risk factors for non-alcoholic fatty liver disease. Lifestyle changes remain the primary means of treatment for obesity and non-alcoholic fatty liver disease, but few patients achieve adequate weight loss. At present, the incidence rate of the nonalcoholic fatty liver disease of obese people is about three times of the average incidence rate of the people, which indicates that the obesity and the nonalcoholic fatty liver disease have larger correlation, suggests that the two diseases cannot be treated separately in clinical treatment, prevents the occurrence of obesity, and probably has larger significance for the prevention and treatment of the nonalcoholic fatty liver disease.

Currently, nonalcoholic fatty liver disease (NAFLD) is becoming one of the most common chronic liver diseases in the world. It is expected to become the main cause of liver transplantation and end-stage liver disease by 2025. The course of non-alcoholic fatty liver disease is complex and lengthy, ranging histologically from Simple Steatosis (SS) to steatohepatitis and fibrosis. Although drugs promising for the treatment of steatohepatitis have been in the third development stage, asian patients have a representative deficiency in most drug trials. Future research should focus on the best treatment of obesity and non-alcoholic fatty liver disease in asian regions.

G Protein signaling pathway regulatory Protein 14(Regulator of G-Protein signaling, RGS14) is a member of the G Protein signaling pathway regulatory Protein family, the G Protein signaling pathway regulatory Protein (RGS) is a family of multifunctional proteins that can directly bind to activated G α and exert the activation of GTPase to terminate the G Protein signaling pathway, there are currently 21 family proteins identified in humans.

Disclosure of Invention

In order to solve the defects and shortcomings of the prior art, the invention aims to provide the function and application of RGS14 in medicaments for protecting liver and maintaining fat metabolism homeostasis by finding the correlation between the RGS14 gene expression and nonalcoholic fatty liver disease and obesity.

In order to achieve the purpose, the scheme of the invention is as follows:

in a first aspect, the present invention provides the use of RGS14 in the preparation of a medicament for protecting the liver and maintaining the homeostasis of fat metabolism.

Preferably, the RGS14, i.e., G protein signaling pathway regulatory protein 14, is used as a drug target for screening drugs for protecting liver and maintaining lipid metabolism homeostasis.

In a second aspect, the present invention provides the use of RGS14 in the preparation of a medicament for the treatment of obesity and/or non-alcoholic fatty liver disease.

Preferably, the RGS14 is capable of ameliorating and treating non-alcoholic fatty liver disease and obesity; the RGS14, namely G protein signaling pathway regulator 14, is used as a target gene for screening drugs for preventing, alleviating and/or treating obesity and/or non-alcoholic fatty liver disease.

Further, the drug is a drug that promotes RGS14 expression.

Further, the RGS14 overexpression inhibits hepatocyte lipid accumulation; when the RGS14 overexpression plasmid is constructed, the RGS14 coding sequence amplification primer comprises:

RGS14-F, the sequence of which is shown in SEQ ID NO. 2;

RGS14-R, the sequence of which is shown in SEQ ID NO. 3.

According to the invention, a wild type mouse (WT) and an RGS14 gene knockout mouse (RGS14-KO) are taken as experimental objects, the function of the RGS14 gene is researched through a high-fat diet induced obese mouse model (DlO), and the result shows that compared with the wild type WT mouse, the RGS14 gene knockout mouse shows obesity, the weight of the RGS14 gene knockout mouse is obviously higher than that of a WT mouse fed with the same feed, the white fat of epididymis of the RGS14 gene knockout mouse, the weight of the liver is heavier than that of the WT mouse, and pathological staining shows that the fatty liver of the RGS14 knockout mouse under the high-fat diet condition is seriously diseased, and the fatty degeneration is obviously increased. To further validate the effect of RGS14 on lipid accumulation in the liver, we established an L02 cell line with RGS14 overexpression and knockdown. And the accumulation degree of lipid droplets of the RGS14 over-expression cell line is lower under the condition of high-concentration fatty acid treatment, and the accumulation degree of lipid droplets of the RGS14 knock-down cell line is higher.

This indicates that the RGS14 gene knockout can aggravate the occurrence of nonalcoholic fatty liver disease and obesity, and the RGS14 gene can improve and treat the nonalcoholic fatty liver disease and obesity.

Aiming at the functions of the RGS14 gene in the nonalcoholic fatty liver disease and the obesity disease, the RGS14 has the function of maintaining and improving the nonalcoholic fatty liver disease and the obesity, and the RGS14 can be applied to the preparation of medicines for preventing, relieving and/or treating the obesity and/or the nonalcoholic fatty liver disease.

Compared with the prior art, the invention has the advantages and beneficial effects that:

pathological results in experiments show that RGS14 knockout can remarkably promote high-fat diet-induced liver paper accumulation and promote the occurrence of obesity and non-alcoholic fatty liver diseases. Further, by establishing an in vitro cell model, we demonstrated that overexpression of RGS14 can inhibit hepatocyte lipid accumulation, while inhibition of RGS14 expression can promote hepatocyte lipid accumulation. Therefore, RGS14 can be used for preparing medicines for preventing, relieving and treating obesity and/or non-alcoholic fatty liver disease. The method has the following specific advantages:

(1) the RGS14 gene is first reported to have a new function in the field of obesity and non-alcoholic fatty liver disease, namely protection against obesity and non-alcoholic fatty liver disease.

(2) Based on the protective effect of the RGS14 gene on obesity and non-alcoholic fatty liver disease, the RGS14 gene can be used for preparing a medicament for preventing, relieving and/or treating obesity and/or non-alcoholic fatty liver disease.

Drawings

FIG. 1 is a strategy for construction of RGS14 systemic knockout mice.

FIG. 2 is a graph of the results of body weights of WT and RGS14-KO mice(**：p<0.01vs WT HFHC group)。

FIG. 3 is a graph of liver weight results for WT and RGS14-KO mice(**：p<0.01vs WT HFHC group)。

FIG. 4 is a graph of the results of liver weight to body weight of WT and RGS14-KO mice(**：p<0.01vs WT HFHC group)。

FIG. 5 is a graph of the epididymal white fat weight results of WT and RGS14-KO mice(**：p<0.01vsWT HFHC group)。

FIG. 6 is a graph of the weight ratio of white fat to body weight of the epididymis of WT and RGS14-KO mice(**：p<0.01vs WT HFHC Group)。

FIG. 7 is a graph showing the results of H & E staining of the liver of WT and RGS14-KO mice

FIG. 8 shows the Western blot identification of RGS14 overexpressing cell line.

FIG. 9 shows the results of oil red O staining of control and RGS14 overexpressing cell lines.

FIG. 10 shows the Western blot identification of the RGS14 knockdown cell line.

FIG. 11 is the results of oil red O staining of the control and RGS14 knockdown cell lines.

Detailed Description

The invention is further described in detail below with reference to the figures and specific examples.

Experimental animals and breeding: wild type (C57BL/6J) (Wild type, WT) mice, RGS14 systemic knockout (RGS14-KO) mice, male, 8 weeks of age. WT mice were purchased from Beijing Huafukang Biotech Co., Ltd, RGS14-KO mice were targeted by CRISPR technology, and the construction strategy is shown in FIG. 1.

According to gene information, a CRISPR Design (website: http:// CRISPR. mit. edu /) is utilized to Design a CRISPR targeting site in a coding region of exon 3. The target sequence is:

RGS14 sgRNA：GGCCTGGGAACCTGCAGTGC TGG(SEQ ID NO.1)

construction of targeting vectors: two primers corresponding to the sgRNA were fused into a double-stranded DNA, and then ligated into a restriction enzyme-treated pUC57-sgRNA vector using T4DNA ligase. The upstream of the vector is provided with a T7 promoter which can be used for subsequent in vitro transcription experiments.

Transcription of the targeting vector: the two parts (Cas 9 protein responsible for cleavage and gRNA that directs Cas9 protein to target site) comprised by the CRIPR/Cas9 system were transcribed separately. For the Cas9 protein, its expression vector (pST 1: 374-Cas9) was digested with PmeI, the linearized plasmid recovered after purification was used as a transcription template, and in vitro transcription was performed with T7 mMESSAGENMAXINE kit (AM1345, Ambion) to obtain a capped mRNA product. And Tailing the above product with Poly (A) Tailing Kit ((Ambion) to obtain mature mRNA product: for sgRNA, in vitro transcription was performed using MEGASHORTscript (TM) Kit (AM1354, Ambion Co.) the transcribed mRNA of Cas9 and sgRNA was purified using miRNeasy Micro Kit (Qiagen, 217084).

Injecting the mature mRNA product and donor vector into mouse fertilized egg, and transplanting to surrogate mother mouse for breeding. The resulting mice were identified. And (3) taking out toe or tail tissues of the mice one week after the mice are born, extracting genomes, and screening positive initial mice by a PCR method. Randomly selecting one of the mice confirmed to have homologous recombination as F0 generation for subsequent reproduction, and finally obtaining RGS14 systemic knockout homozygous mice.

Acquisition of mouse obesity model (DIO) and fatty liver model:

the experimental animal feed formula comprises: high fat high cholesterol diet (HFHC) (available from southbound terofen diet science & ltd., cat No. IMA 2019001): percentage of heat: protein: 14 percent; fat: 42%; carbohydrate: 42%; cholesterol: 2%). The HFHC was fed for 16 weeks before analysis.

Animal feeding and environmental conditions: all experimental mice were housed in the SPF grade housing of the institutional animal institute, Wuhan university. The mouse is illuminated alternately every 12 hours at the temperature of 24 +/-2 ℃ and the humidity of 40-70 percent, and the mouse can eat freely by drinking water.

Example 1RGS14 Gene knockout promotes the development of obesity and non-alcoholic fatty liver disease

(1) Grouping experimental animals: 8-week-old, male, wild-type WT mice and RGS14-KO mice were selected and fed with HFHC, i.e., WT HFHC group and RGS14-KO HFHC group.

(2) The model adopts a high-fat high-cholesterol feed induction operation process:

HFHC was fed for 16 weeks, fasting was performed for 6 hours, and then materials were taken, white adipose Tissue of epididymis and liver Tissue were accurately weighed, and a part of liver Tissue was fixed in 10% formalin solution or embedded in o.c. t frozen section embedding medium (Tissue FreezingMedium) for pathological analysis.

(3) Terminal liver tissue sampling

1) Mice were weighed and then sacrificed by removing their necks quickly. The mice were fixed supine and their chest and abdomen hair were moistened with distilled water.

2) Clamping the middle skin of the abdomen of the mouse by a forceps, cutting the skin to the head along the middle of the abdomen to the position below the xiphoid process, cutting the skin to the tail end, exposing subcutaneous fascia, muscles and the like layer by layer, beating) the abdominal cavity of the Bupleurum, and fully exposing all internal organs.

3) The liver of the mouse was quickly found and removed, the removed liver specimen was placed on a sterile gauze piece, the residual blood on the surface of the liver was wiped off, the liver was placed in a sterile petri dish and quickly weighed.

4) Paraffin specimen: a part of the liver was excised and fixed in 10% neutral formalin. Freezing the specimen: a part of liver was cut, embedded in a tin foil mold with OCT, and frozen and fixed on dry ice.

(4) Liver tissue processing and pathological staining related experiments

1) Liver dehydration, transparency, and waxing

Cutting a part of liver lobe tissues fixed in 10% neutral formalin, placing the cut liver lobe tissues in a marked embedding frame, washing the liver lobe tissues in a small flow of running water for more than 30 minutes, and setting the following procedures on a machine according to the following procedures of ① dehydration, 75% alcohol (45 minutes), ② 75% alcohol (45 minutes), ③ 85% alcohol (45 minutes), ④ 85% alcohol (45 minutes), ⑤ 95% alcohol (45 minutes), ⑥ 95% semen sprinkling (45 minutes), ⑦ anhydrous alcohol (1 hour), ⑧ anhydrous alcohol (1 hour), then, after the completion of xylene (1 hour), soaking the liver lobe tissues in paraffin at 65 ℃ for 1 hour, after the tissue washing is completed, loading the embedding frame containing the tissues in a paraffin wax at 65 ℃ for 1 hour

2) Liver tissue section

Sections were cut using a microtome (slice thickness 5 μm).

3) Hematoxylin-eosin (HE) staining of liver tissue

And (5) carrying out HE staining on the section, and observing the fatty condition of the liver tissue.

The results of the measurement of the body weight of the mice are shown in fig. 2, the body weight of the mice in the RGS14-KO HFHC group is significantly higher than that of the WTHHFHC group from 4 weeks, i.e. the mice in the RGS14 are more likely to show obesity after gene knockout; the results of the measurement of the liver weight and the liver weight to body weight of the mice are shown in fig. 3 and 4, and the liver weight to body weight of the mice in the RGS14-KO HFHC group are higher than those in the WTHHFHC group; the results of the measurement of the white fat weight of epididymis and the white fat weight to body weight ratio are shown in fig. 5 and 6, and the white fat weight of epididymis and the white fat weight to body weight ratio of RGS14-KO HFHC group mice are both higher than that of the WT HFHC group; further pathological staining was performed, and the results are shown in FIG. 7, wherein liver steatosis and vacuolization were more significant in the RGS14-KO HFHC group mice, indicating that the fatty liver lesions in the group of mice were severe. These results all indicate that RGS14 gene knock-out promotes the development of obesity as well as non-alcoholic fatty liver disease.

Example 2 overexpression of RGS14 inhibits hepatocyte lipid accumulation, and RGS14 knockdown promotes hepatocyte lipid accumulation

RGS14 overexpression and knockdown plasmid construction

(1) Vector linearization

The pHAGE-3xflag-MCS-puro plasmid reformed in the laboratory is digested by BamHI (Thermo, FD0054) and XhoI (Thermo, FD 0694); the PLKO.1 plasmid was digested with Ecori (Thermo, FD0275) enzyme and AgeI enzyme (Thermo, FD 1464).

Amplification of the RGS14 coding sequence and annealing to oligonucleotides

Amplification primer sequences encoding RGS 14:

RGS14-F：GATCGGGTTTAAACGGATCATGCCAGGGAAGCCCAAGCA，

SEQ ID NO.2；

RGS14-R：AAGGGCCCTCTAGACTCGATCAGAGGGCTGAGTCGGTGG，SEQ ID NO.3；

RGS14 shRNA sequence

shRNA-F：

CCGGGCCTTCGTCAGCAGCAAATCTCTCGAGAGATTTGCTGCTGACGAAGGCTTTTTG，SEQ IDNO.4；

shRNA-R：

AATTCAAAAAGCCTTCGTCAGCAGCAAATCTCTCGAGAGATTTGCTGCTGACGAAGGC，SEQ IDNO.5；

(2) Linearized fragment recovery

The recovery procedure was performed using a gel DNA recovery kit (Tiangen DP208) according to the instructions.

(3) Ligation and transformation

Ligation was performed using the Novozam one-step cloning kit (Novozam, C112-01), transformed into E.coli competent, and plated on solid LB plates containing ampicillin resistance.

(4) Lentivirus packaging infection

293T cells were prepared in 60 mm dishes and transfected to a cell density of 70%. Transfection system: pMD2.G (2. mu.g), pSPAX (2. mu.g) and pHAGE-3xflag-MCS-puro (4. mu.g); pMD2.G (2. mu.g), pSPAX (2. mu.g) and pHAGE-3xflag-RGS14-puro (4. mu.g); pMD2.G (2. mu.g), pSPAX (2. mu.g) and PLKO.1 (4. mu.g); pSPAX (2. mu.g) and pHAGE-3xflag-RGS14-puro (4. mu.g); pMD2.G (2. mu.g), pSPAX (2. mu.g) and PLKO.1-RGS14-shRNA2 (4. mu.g)

Fluid changes were made 6 hours after transfection. The supernatant was harvested 48 hours after transfection.

Infecting L02 cells with the virus, adding polybrene 10 μ g to increase infection efficiency, centrifuging at 2000 rpm for 30 min to increase infection efficiency; the medium was changed to fresh medium 12 hours after virus infection.

(5) Puromycin screening

After 36 hours after viral infection, cells were screened with 2. mu.g of puromycin for 24 hours until all cells without puromycin resistance died.

(6) Western Blot identification of protein expression

1) Protein extraction

Extracting primary hepatocyte protein: adding lysis solution into primary mouse hepatocytes, centrifuging after lysis is completed, taking supernatant, and quantitatively collecting Protein samples by using BCA Protein Assay Kit (Pierec (TM), 23225).

2) Sample loading and electrophoresis

Preparing electrophoresis gel, and adding electrophoresis liquid into an electrophoresis tank. And loading the protein sample into an SDS-PAGE gel loading hole, and starting electrophoresis after the sample application is finished.

3) Rotary film

① preparing the film transfer liquid, pre-cooling at 4 deg.C.

② soaking PVDF in methanol for 15s, and placing in the membrane-transferring solution for use.

③ taking out the gel from the gel plate, washing the gel with the transfer solution, spreading the gel on the filter paper of the negative electrode, covering the PVDF film thereon, and clamping the splint.

④ putting the clamping plate into the film transferring groove, and filling the film transferring liquid to submerge the gel.

⑤ the transfer tank was powered on, the voltage was set to 250V, the current was set to 0.2A and the transfer was 1.5 h.

⑥ after the transfer, the PVDF membrane was removed.

4) Sealing of

The protein membrane was placed in a prepared TBST, and the membrane-transfer solution was washed off. Placing the protein membrane in the sealing solution, slowly shaking on a shaking table, and sealing at room temperature for 1-4 h.

5) Primary antibody incubation

① the protein membrane was washed 3 times with TBST for 5min each.

② capper seals the film into the hybridization bag and adds a primary antibody.

③ the hybridization bags were placed on a shaker at 4 ℃ overnight.

6) Incubation with secondary antibody

① the membrane was removed and washed 3 times with TBST for 5min each to recover the primary antibody.

② the membrane was placed in the corresponding secondary antibody dilution with secondary antibody and incubated for 1h in the absence of light.

7) Protein detection

After incubation, wash 3 times with TBST for 5min each. Bands of interest were detected using a Bio-Rad Chemi Doc XRS + gel imaging system.

(7) Preparation of DMEM medium containing palmitic acid and oleic acid

Heating and dissolving 200mM oleic acid solution and 20mM palmitic acid solution in a water bath at 72 ℃; 25% of the fatty acid-removed bovine albumin solution and DMEM containing 10% fetal bovine serum were dissolved by heating in a water bath at 37 ℃. And adding the oleic acid solution and the palmitic acid solution into the fatty acid-removed bovine albumin solution, fully and uniformly mixing, and adding into a DMEM culture medium. The final concentration of the fatty acid-removed bovine albumin is 0.5 percent, the final concentration of oleic acid is 1mM, and the final concentration of palmitic acid is 0.5 mM. The heating was continued for one hour in a 37 ℃ water bath and the bacteria were removed by filtration through a 0.22 μm pore size filter.

(8) Experimental group design and cell stimulation

The experimental groups included an RGS14 overexpressing cell line and its control empty vector PP6 cell line, an RGS14 knockdown cell line and its control empty vector PLKO.1 cell line. The mixture was treated with DMEM medium containing palmitic acid and oleic acid for 12 h.

(9) Oil red O dyeing

Cells were fixed with 4% paraformaldehyde at room temperature for 30 minutes, washed with PBS for 3 minutes and 2 minutes, washed with 60% isopropanol for 1 minute, and finally stained with 0.3% oil red O (solvent 60% isopropanol) for 5 minutes, and the oil red O stain was removed. Two final washes with PBS were taken immediately.

The results of the identification of the overexpression of RGS14 are shown in FIG. 8, and it can be seen that the overexpression of RGS14 protein is significant in the cells transfected with the RGS14 overexpression plasmid, indicating that the cells can be used for subsequent studies. The results of oil red O staining after the RGS14 over-expression cell line (L02-Flag-RGS14) and the control empty vector PP6 cell line (L02-PP6) are treated by DMEM medium containing palmitic acid and oleic acid for 12h are shown in FIG. 9, and red lipid droplets in cells of the L02-Flag-RGS14 group are remarkably reduced, which indicates that the RGS14 over-expression can inhibit the lipid accumulation of liver cells.

The results of the RGS14 knockdown identification are shown in FIG. 10, and it can be seen that the RGS14 protein expression is significantly reduced in the cells transfected with the RGS14 knockdown plasmid, indicating that the cells can be used for subsequent studies. The results of oil red O staining after the RGS14 knockdown cell line (L02-RGS14-shRNA) and the control empty vector PLKO.1 cell line (L02-PLKO.1) were treated for 12 hours in a DMEM medium containing palmitic acid and oleic acid are shown in FIG. 11, and red lipid droplets in the cells of the L02-RGS14-shRNA group are significantly increased, which indicates that the reduction of RGS14 expression can promote the accumulation of liver cell lipids.

Sequence listing

<110> Wuhan university

<120> function and application of RGS14 in drugs for protecting liver and maintaining lipid metabolism homeostasis

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ggcctgggaa cctgcagtgc tgg 23

<210>2

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gatcgggttt aaacggatca tgccagggaa gcccaagca 39

<210>3

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

aagggccctc tagactcgat cagagggctg agtcggtgg 39

<210>4

<211>58

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ccgggccttc gtcagcagca aatctctcga gagatttgct gctgacgaag gctttttg 58

<210>5

<211>58

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

aattcaaaaa gccttcgtca gcagcaaatc tctcgagaga tttgctgctg acgaaggc 58

Claims (6)

1. An application of RGS14 in preparing the medicines for protecting liver and maintaining the steady state of fat metabolism is disclosed.

2. The use of RGS14 according to claim 1 for the preparation of a medicament for protecting the liver and maintaining the homeostasis of fat metabolism, wherein: the RGS14, G protein signaling pathway regulator 14, is used as a drug target for screening drugs for protecting liver and maintaining lipid metabolism homeostasis.

3. An application of RGS14 in preparing the medicines for treating obesity and/or non-alcoholic fatty liver disease is disclosed.

4. The use of RGS14 in the preparation of a medicament for the treatment of obesity and/or non-alcoholic fatty liver disease according to claim 3 wherein: the RGS14 can improve and treat non-alcoholic fatty liver disease and obesity; the RGS14, namely G protein signaling pathway regulator 14, is used as a target gene for screening drugs for preventing, alleviating and/or treating obesity and/or non-alcoholic fatty liver disease.

5. The use of RGS14 in the preparation of a medicament for the treatment of obesity and/or non-alcoholic fatty liver disease according to claim 4 wherein: the drug is one that promotes RGS14 expression.

6. The use of RGS14 for the preparation of a medicament for the treatment of obesity and/or non-alcoholic fatty liver disease according to claim 5, wherein: the RGS14 overexpression inhibits hepatocyte lipid accumulation; when the RGS14 overexpression plasmid is constructed, the RGS14 coding sequence amplification primer comprises:

RGS14-F, the sequence of which is shown in SEQ ID NO. 2;

RGS14-R, the sequence of which is shown in SEQ ID NO. 3.

Images