CN111053914A

CN111053914A - Mitoxantrone-containing medicament, preparation method thereof, pharmaceutical composition and application thereof

Info

Publication number: CN111053914A
Application number: CN201910969428.XA
Authority: CN
Inventors: 王力源; 王萌
Original assignee: Baiyao Zhida Beijing Nano Biotechnology Co Ltd
Current assignee: Baiyao Zhida Beijing Nano Biotechnology Co Ltd
Priority date: 2018-10-16
Filing date: 2019-10-12
Publication date: 2020-04-24
Anticipated expiration: 2039-10-12
Also published as: CN111053914B

Abstract

The application provides a mitoxantrone-containing medicament, a preparation method thereof, a pharmaceutical composition and application thereof. The drug comprises nucleic acid nanoparticles and mitoxantrone, and the mitoxantrone is carried on the nucleic acid nanoparticles; the nucleic acid nanoparticle comprises a nucleic acid domain, wherein the nucleic acid domain comprises a sequence a, a sequence b and a sequence c, the sequence a comprises a sequence a1 or a sequence a1 with at least one base insertion, deletion or substitution, the sequence b comprises a sequence b1 or a sequence b1 with at least one base insertion, deletion or substitution, and the sequence c comprises a sequence c1 or a sequence c1 with at least one base insertion, deletion or substitution. The mitoxantrone-containing drug provided by the application has the advantages that the nucleic acid structure domain is modified by the target head, the mitoxantrone-containing drug has better targeting property, can stably deliver the mitoxantrone, and has high reliability.

Description

Mitoxantrone-containing medicament, preparation method thereof, pharmaceutical composition and application thereof

Technical Field

The application relates to the field of medicines, in particular to a mitoxantrone-containing medicine, a preparation method, a pharmaceutical composition and application thereof.

Background

Mitoxantrone (Mitoxanthone, CSA:65271-80-9, molecular formula: C₂₂H₂₈N₄O₆Molecular weight: 444.481) is an antitumor antibiotic with a mechanism of action similar to that of adriamycin, and is less toxic to the heart because of its absence of amino sugar structure, no generation of free radicals, and its ability to inhibit lipid peroxidation. It is mainly used for treating cancers such as breast cancer, malignant lymphoma, gastric cancer, intestinal cancer, leukemia, bladder cancer, hepatocarcinoma, multiple myeloma, malignant mesothelioma and ovarian cancer.

Currently, antitumor antibiotics, including mitoxantrone, must be administered at high doses of chemotherapeutic drugs in order to achieve effective therapeutic levels at the tumor site, but systemic administration of high doses can damage healthy normal cells and cause adverse effects in a range of tissues and organs. These adverse effects include immune system suppression (myelosuppression), inflammation and cleansing of the gut mucosa (mucositis), hair loss (alopecia) and organ-specific toxicity, such as cardiotoxicity and neurotoxicity. In order to avoid the adverse reactions, a tumor local administration mode is required to replace the traditional systemic administration mode so as to achieve the effects of increasing the tumor local drug concentration and reducing the systemic drug concentration. Therefore, how to achieve such local drug delivery and in vitro controlled release has become a focus of cancer chemotherapy research.

In order to reduce the side effect caused by poor targeting of the active ingredients of the medicine, the medicine delivery carrier is produced, and the function of the carrier is mainly to carry the active ingredients of the medicine and deliver the active ingredients into blood or tissue cells to treat diseases. There are a variety of approaches to achieve targeted delivery of different drugs. And is implemented by an instrument or apparatus, such as a gene gun, an electroporator, etc. The methods do not need to use a gene vector, but the transfection efficiency is generally low, the operation is complex, and the damage to tissues is large. It is also mediated by viral vectors, such as adenovirus and lentivirus, etc., and although the viral vectors have high in vitro transfection activity, the immunogenicity and the susceptibility to mutation of the viral vectors bring huge safety hazards to in vivo delivery. And non-viral vectors, especially biodegradable high molecular materials are used for realizing the targeted transportation of the medicine. The non-viral vector has the advantages that under the condition of ensuring the expected transfection activity, the immunogenicity and a plurality of inflammatory reactions brought by the viral vector can be greatly reduced.

Of the above-mentioned various targeted delivery approaches, more research is currently focused on the field of non-viral vectors, and is generally designed for several vectors: (a) a cationic liposome; (b) a polycationic gene vector. However, more researches are focused on the modification of polycation gene vectors and cationic liposomes, so that the polycation gene vectors and cationic liposomes are suitable for the targeted delivery of gene substances. Cationic liposomes have high transfection activity in vitro and in vivo, however, normal distribution in vivo is affected due to positive charges on the surface, and meanwhile, the cationic lipids cause immunogenicity and inflammatory reactions in animal experiments. The polycation gene vector is developed more mature at present, however, the surface of a structure is difficult to ensure by a targeting group in the structural design, a self-design contradiction between toxicity and transfection activity exists, and meanwhile, the connection of the polycation gene vector is difficult to realize nontoxic degradation in vivo.

Therefore, how to improve the delivery reliability of the existing small-molecule drug mitoxantrone is one of the difficulties in solving the limited clinical application of the existing mitoxantrone drug.

Disclosure of Invention

The main purpose of the application is to provide a mitoxantrone-containing drug, a preparation method, a pharmaceutical composition and application thereof, so as to improve the delivery reliability of the mitoxantrone drug.

In order to achieve the above object, according to one aspect of the present application, there is provided a mitoxantrone-containing drug comprising a nucleic acid nanoparticle and mitoxantrone, and the mitoxantrone is suspended on the nucleic acid nanoparticle; the nucleic acid nanoparticle comprises a nucleic acid domain, wherein the nucleic acid domain comprises a sequence a, a sequence b and a sequence c, the sequence a comprises a sequence a1 or a sequence a1 with at least one base insertion, deletion or substitution, the sequence b comprises a sequence b1 or a sequence b1 with at least one base insertion, deletion or substitution, and the sequence c comprises a sequence c1 or a sequence c1 with at least one base insertion, deletion or substitution; wherein, the sequence of a1 is SEQ ID NO: 1: 5'-CCAGCGUUCC-3' or SEQ ID NO: 2: 5'-CCAGCGTTCC-3', respectively; b1 sequence is SEQ ID NO: 3: 5 '-GGUUCGCCG-3' or SEQ ID NO: 4: 5 '-GGTTCGCCG-3'; the sequence of c1 is SEQ ID NO: 5'-CGGCCAUAGCGG-3' or SEQ ID NO: 6: 5'-CGGCCATAGCGG-3' are provided.

Further, when the sequence a1 is SEQ ID NO. 1, the sequence b1 is SEQ ID NO. 3, and the sequence c1 is SEQ ID NO. 5, at least one of the sequences a, b, and c comprises a sequence in which at least one base is inserted, deleted, or substituted.

Further, base insertions, deletions or substitutions occur at:

(1) 1, 2, 4 or 5 bases from the 5' end of the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2; and/or

(2) Between 8 th to 10 th bases from the 5' end of the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2; and/or

(3) Between the 1 st to 3 rd bases from the 5' end of the sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4; and/or

(4) Between 6 th to 9 th bases from the 5' end of the sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4; and/or

(5) Between the 1 st to 4 th bases from the 5' end of the sequence shown in SEQ ID NO. 5 or SEQ ID NO. 6; and/or

(6) Between the 9 th to 12 th bases from the 5' end of the sequence shown in SEQ ID NO. 5 or SEQ ID NO. 6.

Further, the sequence a, the sequence b and the sequence c self-assemble into a structure shown in the formula (1):

wherein W-C represents a Watson-Crick pair, N and N' represent non-Watson-Crick pairs, and W-C at any position is independently selected from C-G or G-C; in the sequence a, the first N from the 5' end is A, the second N is G, the third N is U or T, and the fourth N is any one of U, T, A, C or G; in the b sequence, the first N 'from the 5' end is any one of U, T, A, C or G; the second N 'is U or T, and the third N' is C; among the c sequences, the NNNN sequence in the 5 'to 3' direction is CAUA or CATA.

Further, the sequence a, the sequence b and the sequence c are any one of the following groups: (1) a sequence: 5'-GGAGCGUUGG-3', sequence b: 5'-CCUUCGCCG-3', c sequence: 5'-CGGCCAUAGCCC-3', respectively; (2) a sequence: 5'-GCAGCGUUCG-3', sequence b: 5'-CGUUCGCCG-3', c sequence: 5'-CGGCCAUAGCGC-3', respectively; (3) a sequence: 5'-CGAGCGUUGC-3', sequence b: 5 '-GCUUCGCCGCCG-3', c sequence: 5'-CGGCCAUAGCCG-3', respectively; (4) a sequence: 5'-GGAGCGUUGG-3', sequence b: 5 '-CCUUCGGG-3', c sequence: 5'-CCCCCAUAGCCC-3', respectively; (5) a sequence: 5'-GCAGCGUUCG-3', sequence b: 5'-CGUUCGGCG-3', c sequence: 5'-CGCCCAUAGCGC-3', respectively; (6) a sequence: 5'-GCAGCGUUCG-3', sequence b: 5'-CGUUCGGCC-3', c sequence: 5'-GGCCCAUAGCGC-3', respectively; (7) a sequence: 5'-CGAGCGUUGC-3', sequence b: 5'-GCUUCGGCG-3', c sequence: 5'-CGCCCAUAGCCG-3', respectively; (8) a sequence: 5'-GGAGCGTTGG-3', sequence b: 5'-CCTTCGCCG-3', c sequence: 5'-CGGCCATAGCCC-3', respectively; (9) a sequence: 5'-GCAGCGTTCG-3', sequence b: 5'-CGTTCGCCG-3', c sequence: 5'-CGGCCATAGCGC-3', respectively; (10) a sequence: 5'-CGAGCGTTGC-3', sequence b: 5'-GCTTCGCCG-3', c sequence: 5'-CGGCCATAGCCG-3', respectively; (11) a sequence: 5'-GGAGCGTTGG-3', sequence b: 5'-CCTTCGGGG-3', c sequence: 5'-CCCCCATAGCCC-3', respectively; (12) a sequence: 5'-GCAGCGTTCG-3', sequence b: 5'-CGTTCGGCG-3', c sequence: 5'-CGCCCATAGCGC-3', respectively; (13) a sequence: 5'-GCAGCGTTCG-3', sequence b: 5'-CGTTCGGCC-3', c sequence: 5'-GGCCCATAGCGC-3', respectively; (14) a sequence: 5'-CGAGCGTTGC-3', sequence b: 5'-GCTTCGGCG-3', c sequence: 5'-CGCCCATAGCCG-3', respectively; (15) a sequence: 5'-CGAGCGTTCC-3', sequence b: 5'-GGTTCGCCG-3', c sequence: 5'-CGGCCATAGCCG-3' are provided.

Further, the nucleic acid domain also comprises a first extension segment, wherein the first extension segment is a Watson-Crick paired extension segment, and the first extension segment is positioned at the 5 'end and/or the 3' end of any sequence in the sequences a, b and c; preferably, the first elongate section is selected from any one of the following: (1): a 5' end of the chain: 5' -CCCA-3', 3' end of c chain: 5 '-UGGG-3'; (2): a 3' end of the chain: 5' -GGG-3', 5' end of b chain: 5 '-CCC-3'; (3): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-UGG-3'; (4): a 5' end of the chain: 5' -CCCG-3', 3' end of c chain: 5 '-CGGG-3'; (5): a 5' end of the chain: 5' -CCCC-3', 3' end of c chain: 5 '-GGGG-3'; (6): b 3' end of strand: 5' -CCC-3', 5' -end of c chain: 5 '-GGG-3'; (7): b 3' end of strand: 5' -CCG-3', the 5' end of the c chain: 5 '-CGG-3'; (8): a 5' end of the chain: 5' -CCCA-3', 3' end of c chain: 5 '-TGGG-3'; (9): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-TGG-3'.

Further, the nucleic acid domain also comprises a second extension segment, the second extension segment is positioned at the 5 'end and/or the 3' end of any sequence in the sequence a, the sequence b and the sequence c, and the second extension segment is a Watson-Crick paired extension segment; preferably, the second extension is an extension of a CG base pair; more preferably, the second extension is an extension sequence of 1-10 CG base pairs.

Further, the nucleic acid domain further comprises at least one set of second stretches: a first group: a 5' end of the chain: 5' -CGCGCG-3 ', 3' -end of c chain: 5 '-CGCGCG-3'; second group: a 3' end of the chain: 5' -CGCCGC-3 ', 5' -end of b chain: 5 '-GCGGCG-3'; third group: b 3' end of strand: 5' -GGCGGC-3 ', 5' -end of c chain: 5 '-GCCGCC-3'.

Further, the second extension is an extension sequence containing both CG base pairs and AT/AU base pairs, and preferably the second extension is an extension sequence of 2-50 base pairs.

Further, the second extension segment is an extension sequence formed by alternately arranging a sequence of continuous 2-8 CG base pairs and a sequence of continuous 2-8 AT/AU base pairs; alternatively, the second extension is an extended sequence of 1 CG base pair alternating with 1 AT/AU base pair sequence.

Further, bases, ribose and phosphate in the sequences a, b and c have at least one modifiable site, and any modifiable site is modified through any one of the following modified linkers: -F, methyl, amino, disulfide, carbonyl, carboxyl, mercapto and aldehyde groups; preferably, the sequence a, sequence b and sequence C have a 2' -F modification at the C or U base.

Further, the mitoxantrone is carried on the nucleic acid nanoparticles in a physical connection and/or covalent connection mode, and the molar ratio of the mitoxantrone to the nucleic acid nanoparticles is 2-300: 1, preferably 10-50: 1, and more preferably 15-25: 1.

Further, the nucleic acid nanoparticle further comprises a bioactive substance, wherein the bioactive substance is connected with the nucleic acid structural domain, and the bioactive substance is one or more of a target, fluorescein, interfering nucleic acid siRNA, miRNA, ribozyme, riboswitch, aptamer, RNA antibody, protein, polypeptide, flavonoid, glucose, natural salicylic acid, monoclonal antibody, vitamin, phenolic lecithin and small molecule drugs except mitoxantrone.

Further, the relative molecular weight of the nucleic acid domains is denoted as N₁The total relative molecular weight of mitoxantrone and biologically active substance is denoted as N₂，N₁/N₂≥1:1。

Further, the bioactive substance is one or more of a target, fluorescein and miRNA, wherein the target is located on any sequence of a, b and c sequences, preferably the 5' end or the 3' end of any sequence of a, b and c, or is inserted between GC bonds of the nucleic acid structure domain, the miRNA is anti-miRNA, the fluorescein is modified on the 5' end or the 3' end of the anti-miRNA, and the miRNA is located at any one or more of the 3' end of the a sequence, the 5' end and the 3' end of the c sequence; preferably, the target head is folic acid or biotin, the fluorescein is any one or more of FAM, CY5 and CY3, and the anti-miRNA is anti-miR-21.

Further, the small molecule drug other than mitoxantrone is a drug containing any one or more of the following groups: amino groups, hydroxyl groups, carboxyl groups, mercapto groups, phenyl ring groups, and acetamido groups.

Further, the protein is one or more of SOD, survivin, hTERT, EGFR and PSMA; the vitamin is levo-C and/or esterified C; the phenols are tea polyphenols and/or grape polyphenols.

Further, the particle size of the nucleic acid nanoparticles is 1-100 nm, preferably 5-50 nm; more preferably 10 to 30 nm; further preferably 10 to 15 nm.

According to another aspect of the present application, there is also provided a method for preparing a mitoxantrone-containing medicament comprising the steps of: providing the nucleic acid nanoparticles described above; the mitoxantrone is carried on the nucleic acid nanoparticles in a physical connection and/or covalent connection mode to obtain the mitoxantrone-containing drug.

Further, the step of mounting mitoxantrone by means of physical attachment comprises: mixing and stirring mitoxantrone, nucleic acid nanoparticles and a first solvent to obtain a premixed system; precipitating the premixed system to obtain the mitoxantrone-containing medicament; preferably, the first solvent is selected from one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid; preferably, the step of precipitating the premixed system to obtain the mitoxantrone-containing medicament comprises: precipitating the premixed system to obtain a precipitate; washing the precipitate to remove impurities to obtain the mitoxantrone-containing medicament; more preferably, the premixed system is mixed with absolute ethyl alcohol and then precipitated at the temperature lower than 10 ℃ to obtain precipitates; a mitoxantrone-containing drug; more preferably, the precipitate is precipitated at a temperature of 0 to 5 ℃ to obtain a precipitate. More preferably, 6-12 times of volume of absolute ethyl alcohol is adopted to wash the precipitate to remove impurities, and the mitoxantrone-containing medicine is obtained.

Further, the step of entrapping mitoxantrone by covalent attachment comprises: preparing a mitoxantrone solution; reacting the mitoxantrone solution with the amino outside the G ring of the nucleic acid nanoparticles under the mediation of formaldehyde to obtain a reaction system; purifying the reaction system to obtain the mitoxantrone-containing medicament; preferably, the step of reacting comprises: mixing the mitoxantrone solution with the paraformaldehyde solution and the nucleic acid nanoparticles, and reacting under the condition of keeping out of the sun to obtain a reaction system; the concentration of the preferable paraformaldehyde solution is preferably 3.7-4 wt%, the preferable paraformaldehyde solution is a solution formed by mixing paraformaldehyde and a second solvent, and the second solvent is one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid.

Further, the preparation method further comprises a step of preparing a nucleic acid nanoparticle, which comprises: obtaining a nucleic acid structural domain by self-assembling the single strand corresponding to the nucleic acid structural domain; preferably, after obtaining the nucleic acid domain, the method of making further comprises: the bioactive substances are carried on the nucleic acid structural domain in a physical connection and/or covalent connection mode, and then the nucleic acid nano-particles are obtained.

Further, in the process of carrying the bioactive substances in a covalent connection mode, carrying is carried out through solvent covalent connection, linker covalent connection or click link; preferably, the solvent is a third solvent used in the covalent attachment as the attachment medium, and the third solvent is selected from one or more of paraformaldehyde, DCM, DCC, DMAP, Py, DMSO, PBS, and glacial acetic acid; preferably, the linker is selected from the group consisting of disulfide bond, p-azido, bromopropyne, or PEG; preferably, click-linking is performed by alkynyl or azide modification of the biologically active substance precursor and the nucleic acid domain at the same time and then by click-linking.

Further, when the biologically active substance is linked to the nucleic acid domain in a click-linkage manner, the site of the biologically active substance precursor for the alkynyl or azide modification is selected from the group consisting of 2 ' hydroxyl, carboxyl or amino, and the site of the nucleic acid domain for the alkynyl or azide modification is selected from the group consisting of G exocyclic amino, 2 ' -hydroxyl, a amino or 2 ' -hydroxyl.

According to a third aspect of the present application, there is also provided a pharmaceutical composition comprising any one of the mitoxantrone-containing drugs described above.

According to a fourth aspect of the present application, there is also provided the use of any one of the mitoxantrone-containing medicaments described above in the preparation of a medicament for the treatment of a tumour.

Further, the tumor is any one or more of breast cancer, malignant lymphoma, gastric cancer, intestinal cancer, leukemia, bladder cancer, liver cancer, multiple myeloma, malignant mesothelioma and ovarian cancer.

According to a fifth aspect of the present application, there is also provided a method for preventing and/or treating a tumor, the method comprising: providing any one of the mitoxantrone-containing medicaments or pharmaceutical compositions described above; administering to a patient having a tumor an effective amount of the mitoxantrone-containing medicament or pharmaceutical composition described above.

The mitoxantrone-containing drug provided by the application comprises nucleic acid nanoparticles and mitoxantrone, and the mitoxantrone is carried on the nucleic acid nanoparticles in a physical connection and/or covalent connection mode. In the nucleic acid nanoparticles, the three sequences or their variant sequences provided in the present application can be contained, so that not only the nucleic acid domains can be formed by self-assembly, but also mitoxantrone can be attached to any 5 'end and/or 3' end of the three strands as a carrier, or mitoxantrone can be stably inserted between strands of the nucleic acid domains. According to the application, the small-molecule drug mitoxantrone is hung on the nucleic acid nanoparticles, the internal hydrophobicity, the external hydrophilicity and the stacking effect of bases of the nucleic acid nanoparticles are utilized, the coating effect on the mitoxantrone is realized, and the mitoxantrone cannot be dissolved in a certain time due to the coating effect or covalent connection, so that the delivery stability is improved. In addition, when the nucleic acid structure domain is modified by a target head, the targeting property is better, mitoxantrone can be stably delivered, and the reliability is high; meanwhile, the contact probability of the mitoxantrone with non-target cells or tissues can be reduced, and the toxic and side effects are reduced.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this application, illustrate embodiments of the application and, together with the description, serve to explain the application and are not intended to limit the application. In the drawings:

FIG. 1 shows the result of electrophoresis detection of RNA nanoparticles formed by self-assembly in example 1 of the present application;

FIG. 2 shows the result of electrophoresis detection of DNA nanoparticles formed by self-assembly in example 1 of the present application;

FIG. 3 shows the results of 2% agarose gel electrophoresis detection of 7 sets of short-sequence RNA nanoparticles formed by self-assembly in example 2 of the present application;

FIG. 4 shows the results of 4% agarose gel electrophoresis detection of 7 sets of short-sequence RNA nanoparticles formed by self-assembly in example 2 of the present application;

FIG. 5 shows the results of 2% agarose gel electrophoresis detection of 7 sets of conventional sequence RNA nanoparticles formed by self-assembly in example 3 of the present application;

FIG. 6 shows the results of 4% agarose gel electrophoresis detection of 7 sets of conventional sequence RNA nanoparticles formed by self-assembly in example 3 of the present application;

FIG. 7 shows the results of 2% agarose gel electrophoresis detection of 7 sets of conventional sequence DNA nanoparticles formed by self-assembly in example 4 of the present application;

FIG. 8 shows the results of 4% agarose gel electrophoresis detection of 7 sets of conventional sequence DNA nanoparticles formed by self-assembly in example 4 of the present application;

FIG. 9 shows the results of 2% agarose gel electrophoresis detection of the DNA nanoparticles of

groups

8 and 9 formed by self-assembly in example 4 of the present application;

FIG. 10 shows a TEM image of self-assembled DNA nanoparticles D-7 of the present application in example 4;

FIG. 11 shows a standard curve of mitoxantrone absorbance during the DNA nanoparticle loading rate measurement in example 5 of the present application;

FIG. 12 shows the results of electrophoresis detection of DNAh-Bio-EGFRApt-Cy5-Mit nanoparticles after incubation in serum for various periods of time in example 7 of the present application;

FIG. 13 shows the inhibition of the proliferation of MCF-7 cells by the small molecule drug mitoxantrone;

FIG. 14 is the inhibition of the proliferation of MCF-7 cells by DNAh-Bio-EGFRApt-Cy5-Mit (targeting agent);

FIG. 15 is the inhibition of the proliferation of MCF-7 cells by DNAh-Bio-EGFRApt-Cy5 (targeting fluorescent vector);

FIG. 16 shows the inhibition of proliferation of MCF-7 cells by a blank of DMSO;

FIG. 17 shows the result of non-denaturing PAGE gel electrophoresis detection of 7 sets of modified-segment + core short-sequence RNA self-assembly products in example 9 of the present invention;

FIG. 18 shows the dissolution curve of the RNA nanoparticle R-15 in example 9 of the present invention;

FIG. 19 shows the dissolution curve of the RNA nanoparticle R-16 in example 9 of the present invention;

FIG. 20 shows the dissolution curve of the RNA nanoparticle R-17 in example 9 of the present invention;

FIG. 21 shows the dissolution curve of the RNA nanoparticle R-18 in example 9 of the present invention;

FIG. 22 shows the dissolution curve of RNA nanoparticle R-19 in example 9 of the present invention;

FIG. 23 shows the dissolution curve of the RNA nanoparticle R-20 in example 9 of the present invention;

FIG. 24 shows the dissolution curve of the RNA nanoparticle R-21 in example 9 of the present invention;

FIG. 25 shows the result of non-denaturing PAGE gel electrophoresis detection of 7 sets of modified-segment + core short-sequence DNA self-assembly products in example 10 of the present invention;

FIG. 26 shows a dissolution curve of DNA nanoparticle D-8 in example 10 of the present invention;

FIG. 27 shows the dissolution curve of the DNA nanoparticle D-9 in example 10 of the present invention;

FIG. 28 shows a dissolution curve of DNA nanoparticle D-10 in example 10 of the present invention;

FIG. 29 is a graph showing the dissolution curve of the DNA nanoparticle D-11 in example 10 of the present invention;

FIG. 30 shows a dissolution curve of the DNA nanoparticle D-12 in example 10 of the present invention;

FIG. 31 shows the dissolution curve of the DNA nanoparticle D-13 in example 10 of the present invention;

FIG. 32 shows a dissolution curve of the DNA nanoparticle D-14 in example 10 of the present invention;

FIG. 33 shows the result of electrophoresis detection of RNA nanoparticle R-15 in example 11 after incubation in serum for various times;

FIG. 34 shows the result of electrophoresis detection of RNA nanoparticle R-16 in example 11 after incubation in serum for various times;

FIG. 35 shows the result of electrophoresis detection of RNA nanoparticle R-17 in example 11 after incubation in serum for various times;

FIG. 36 shows the result of electrophoresis detection of RNA nanoparticle R-18 in example 11 after incubation in serum for various times;

FIG. 37 shows the result of electrophoresis detection of RNA nanoparticle R-19 in example 11 after incubation in serum for various times;

FIG. 38 shows the result of electrophoresis detection of RNA nanoparticle R-20 in example 11 after incubation in serum for various times;

FIG. 39 shows the result of electrophoresis detection of RNA nanoparticle R-21 in example 11 after incubation in serum for various times;

FIG. 40 shows the results of electrophoresis detection of DNA nanoparticle D-8 in example 12 after incubation in serum for various periods of time;

FIG. 41 shows the result of electrophoresis detection of DNA nanoparticle D-9 in example 12 of the present invention after incubation in serum for various times;

FIG. 42 shows the result of electrophoresis detection of DNA nanoparticle D-10 in example 12 of the present invention after incubation in serum for various times;

FIG. 43 shows the result of electrophoresis detection of DNA nanoparticle D-11 in example 12 of the present invention after incubation in serum for various times;

FIG. 44 shows the result of electrophoresis detection of the DNA nanoparticle D-12 in example 12 of the present invention after incubation in serum for various times;

FIG. 45 shows the result of electrophoresis detection of DNA nanoparticle D-13 in example 12 after incubation in serum for various times;

FIG. 46 shows the results of electrophoresis detection of DNA nanoparticle D-14 in example 12 after incubation in serum for various periods of time;

FIGS. 47a, 47b, 47c, 47D, 47e, 47f, 47g and 47h show cell viability curves for DMSO and the prodrug doxorubicin, D-8 and D-8-doxorubicin, D-9 and D-9-doxorubicin, D-10 and D-10-doxorubicin, D-11 and D-11-doxorubicin, D-12 and D-12-doxorubicin, D-13 and D-13-doxorubicin and D-14-doxorubicin, respectively, in example 15 of the present invention;

FIG. 48 shows a standard curve of daunorubicin absorbance used in the mounting ratio measurement process of example 16.

Detailed Description

It should be noted that the embodiments and features of the embodiments in the present application may be combined with each other without conflict. The present application will be described in detail with reference to examples.

Interpretation of terms:

blank vector: refers to a blank nucleic acid nanoparticle vector, such as RNAh or DNAh, that does not contain any biologically active substance.

Targeting vectors: refers to a nucleic acid nanoparticle vector containing a targeting tip but not containing a fluorescent substance, such as Biotin-RNAh or Biotin-DNAh.

A fluorescent carrier: refers to a nucleic acid nanoparticle vector containing a fluorescent substance but not containing a targeting moiety, such as Cy5-RNAh or Cy 5-DNAh.

Targeting fluorescent carrier: refers to a nucleic acid nanoparticle vector containing a target and a fluorescent substance, such as Biotin-Cy5-RNAh or Biotin-Cy 5-DNAh.

Targeting drugs: refers to nucleic acid nanoparticle carrier containing target head, fluorescent substance and chemical, such as RNAh-Biotin-quartz 670-Mit or DNAh-Biotin-quartz 670-Mit, wherein Mit represents mitoxantrone.

It should be noted that there is no specific format in the naming convention of each vector or bioactive substance in the present application, and the fore-and-aft position in the description does not mean that it is at the 5 'end or 3' end of RNAh or DNAh, but means that it contains the bioactive substance.

As mentioned in the background, although there are many drug carriers for improving drug delivery efficiency in the prior art, it is still difficult to solve the problem that the clinical application of drugs is limited. In order to improve the situation, the inventor of the present application has studied all available materials as drug carriers, and has conducted in-depth investigation and analysis on various carriers from the aspects of cell/tissue targeting property of the carriers, stability during transportation, activity and efficiency of entering target cells, drug release capacity after reaching target cells, toxicity to cells and the like, and found that nanostructures formed by self-assembly of emerging DNA and/or RNA molecules, for example, DNA in a self-assembly system of DNA dendrimers, have a significant effect of hindering nuclease degradation, and have very important application values in the fields of gene therapy and biomedicine.

Through analysis of nanoparticles formed by self-assembly of DNA and RNA reported in the prior art, compared with DNA nanoparticles which are relatively rigid, RNA nanoparticles have more flexibility and stronger tension due to a large number of stem-loop structures existing in molecules or between molecules, and thus have more advantages in serving as candidate drug carriers. However, the stability of RNA nanoparticles in their natural state is relatively poor, and the current improvements based on the application of RNA nanocarriers have mostly been developed around improving their stability and reliability. The current research results, although providing the possibility of drug loading to some extent, focus more on the possibility and effectiveness of the loading of nucleic acid drugs, especially siRNA drugs or miRNA drugs. However, there are few reports on whether non-nucleic acids are equally effective. In addition, the existing self-assembly nanoparticles, especially the self-assembly nanoparticles used as carriers, are self-assembled by using RNA strands at present, and rarely self-assembled by using a combination of RNA strands and DNA strands, but the self-assembly is not realized by using pure DNA strands.

In order to provide a novel RNA nanoparticle carrier which is highly reliable and can be self-assembled, the applicant has compared and improved existing RNA nanoparticles, developed a series of novel RNA nanoparticles, and further tried to perform self-assembly using pure DNA strands from the viewpoint of improving applicability and reducing cost. Moreover, the self-assembly of DNA nanoparticles also has the advantages of low price and easy operation. Experiments prove that the improved RNA nanoparticles and DNA nanoparticles can be used for carrying various medicaments and stably exist in serum; further experiments verify that it can carry drugs into cells, and the carrier alone is not toxic to cells. And the carrier carrying the medicine can play a role in relieving and treating corresponding diseases.

On the basis of the above research results, the applicant proposed the technical solution of the present application. The application provides a mitoxantrone-containing drug, which comprises nucleic acid nanoparticles and mitoxantrone, wherein the mitoxantrone is carried on the nucleic acid nanoparticles; the nucleic acid nanoparticle comprises a nucleic acid domain, wherein the nucleic acid domain comprises a sequence a, a sequence b and a sequence c, the sequence a comprises a1 sequence or a sequence a1 sequence with at least one base insertion, deletion or substitution, the sequence b comprises a sequence b1 sequence or a sequence b1 sequence with at least one base insertion, deletion or substitution, and the sequence c comprises a sequence c1 sequence or a sequence c1 sequence with at least one base insertion, deletion or substitution; wherein, the sequence of a1 is SEQ ID NO: 1: 5'-CCAGCGUUCC-3' or SEQ ID NO: 2: 5'-CCAGCGTTCC-3', respectively; b1 sequence is SEQ ID NO: 3: 5 '-GGUUCGCCG-3' or SEQ ID NO: 4: 5 '-GGTTCGCCG-3'; c1 sequence is SEQ ID NO: 5: 5'-CGGCCAUAGCGG-3' or SEQ ID NO: 6: 5'-CGGCCATAGCGG-3' are provided.

The mitoxantrone-containing drug provided by the application comprises nucleic acid nanoparticles and mitoxantrone, and the mitoxantrone is carried on the nucleic acid nanoparticles. The nucleic acid nanoparticles can be used as carriers, in which mitoxantrone is linked to any of the 5 'ends and/or 3' ends of the three strands, or mitoxantrone can be stably inserted between strands of the nucleic acid domains, as well as nucleic acid domains formed by self-assembly by including the three sequences or their variants. The mitoxantrone-containing drug provided by the application is characterized in that a small-molecule drug mitoxantrone is loaded on nucleic acid nanoparticles, and the nucleic acid nanoparticles are hydrophobic inside, hydrophilic outside and stacked in base, so that the mitoxantrone is coated, and the coating or covalent connection ensures that the mitoxantrone cannot be dissolved within a certain time, thereby improving the delivery stability. In addition, when the nucleic acid structure domain is modified by a target head, the targeting property is better, mitoxantrone can be stably delivered, and the reliability is high; meanwhile, the contact probability of the mitoxantrone with non-target cells or tissues can be reduced, and the toxic and side effects are reduced.

The self-assembly refers to a technique in which basic structural units spontaneously form an ordered structure. During the self-assembly process, the basic building blocks spontaneously organize or aggregate into a stable structure with a certain regular geometric appearance under the interaction based on non-covalent bonds. The self-assembly process is not a simple superposition of weak interaction forces (wherein the weak interaction force refers to hydrogen bonds, van der waals force, electrostatic force, hydrophobic force and the like) among a large number of atoms, ions or molecules, but a plurality of individuals are simultaneously and spontaneously connected in parallel and are combined together to form a compact and ordered whole body, and the self-assembly process is a complex synergistic action of the whole body.

The generation of self-assembly requires two conditions: self-contained power and guidance. The kinetics of self-assembly refers to the synergistic effect of weak interaction forces between molecules, which provide energy for molecular self-assembly. The direction of self-assembly refers to the complementarity of the molecules in space, that is, the occurrence of self-assembly requires the rearrangement of the molecules to be satisfied in the size and direction of space.

The DNA nanotechnology is a mode of molecular self-assembly from bottom to top, spontaneously forming a stable structure based on the physical and chemical properties of nucleic acid molecules, with molecular architecture as the starting point, following strict principles of nucleic acid base pairing. A plurality of DNA fragments are connected together in a correct sequence in vitro, and a sub-assembly structure is established through a base complementary pairing principle, so that a complex multilevel structure is finally formed. Unlike DNA, RNA can be structured beyond the limitations of the double helix. RNA can form a series of different base pairs with at least two hydrogen bonds between the base pairs. The different bases can be divided into two types, including standard Watton-Crick base pair type and non-Watton-Crick base pair type, so that the RNA can form a large number of and various types of circulating structure modules, and the modules are basic units forming the tertiary structure of the folded RNA. RNA nanotechnology can take advantage of these naturally occurring 3D modules and their predictable interactions, where many biologically active RNA structures can have atomic-level resolution, such as ribosomes, ribozymes of various types, and natural RNA aptamers present in riboswitches. One advantageous feature of RNA nanotechnology is that structures comparable in size and complexity to natural RNA species can be designed. The unique assembly properties of RNA within the native RNA complex can also be exploited.

In the nucleic acid nanoparticles, the nucleic acid nanoparticles comprise three sequences shown by SEQ ID NO. 1, SEQ ID NO. 3 and SEQ ID NO. 5 or sequences after variation thereof, or three sequences shown by SEQ ID NO. 2, SEQ ID NO. 4 and SEQ ID NO. 6 or sequences after variation thereof, and the nucleic acid nanoparticles can be formed by self-assembly, and the specific sequence after variation can be obtained by reasonably selecting variation sites and variation types thereof on the basis of the sequences of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6, or by extending suitable fragments.

The nanoparticles formed by self-assembly of SEQ ID NO 1, SEQ ID NO 3 and SEQ ID NO 5 are RNA nanoparticles, and the nanoparticles formed by self-assembly of SEQ ID NO 2, SEQ ID NO 4 and SEQ ID NO 6 are DNA nanoparticles. In a preferred embodiment, when the nucleic acid nanoparticle is an RNA nanoparticle, at least one of the sequences a, b, and c comprises a sequence with at least one base insertion, deletion, or substitution. The specific position and the base type of the variant sequence in the RNA nano-particle can be improved into the nano-particle for improving the drug loading capacity or the stability according to the requirement on the premise of realizing self-assembly.

In order to make the nucleic acid nanoparticles have relatively higher stability and further make the medicines obtained by mitoxantrone suspension more stable, when base insertion, deletion or substitution is carried out on the sequences shown in SEQ ID NO:1/2, SEQ ID NO:3/4 and/or SEQ ID NO:5/6, base insertion, deletion or substitution can be carried out on the bases at certain specific positions of the sequences, so that the sequences after variation are the same as the original sequences and can be self-assembled into nanoparticles, and the variations keep at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of homology with the original sequences, so that the nanoparticles formed by self-assembling the sequences have the same medicine loading characteristics and similar stability, and mitoxantrone can be well suspended and delivered.

In a preferred embodiment, the above base insertions, deletions or substitutions occur in: (1) 1 or 2 between the 1 st, 2 nd, 4 th and 5 th bases from the 5' end of the a sequence shown in SEQ ID NO; and/or (2) between 8 th to 10 th bases from the 5' end of the sequence a shown in SEQ ID NO. 1 or 2; and/or (3) between 1 to 3 bases from the 5' end of the b sequence shown in SEQ ID NO. 3 or 4; and/or (4) between 6 th and 9 th bases from the 5' end of the b sequence shown in SEQ ID NO. 3 or 4; and/or (5) between the 1 st to 4 th bases from the 5' end of the c sequence shown in SEQ ID NO. 5 or 6; and/or (6) between 9 th to 12 th bases from the 5' end of the c sequence shown in SEQ ID NO. 5 or 6.

In the preferred embodiment, the base positions where the mutation is limited are the non-classical Watson-Crick paired base positions or the protruding unpaired base positions in the nanostructure formed by the sequences shown in SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6, thereby not affecting the formation of these protruding or loop structures, thereby maintaining the flexibility and tension of the nanostructure formed by the above sequences and helping to maintain the stability as a carrier.

In order to further improve the stability of the nucleic acid nanoparticles and further improve the stability of the drug formed after the mitoxantrone is carried, in a preferred embodiment, the sequence a, the sequence b and the sequence c are self-assembled into a structure shown in formula (1):

wherein W-C represents Watson-Crick pairing, N and N ' represent non-Watson-Crick pairing, each W-C at any position is independently selected from C-G or G-C, and the two bases at the 5' end and 3' end of each of at least two of the a, b, and C sequences are not complementary; in the sequence a, the first N from the 5' end is A, the second N is G, the third N is U or T, and the fourth N is any one of U, T, A, C or G; in the b sequence, the first N 'from the 5' end is any one of U, T, A, C or G; the second N 'is U or T, and the third N' is C; among the c sequences, the NNNN sequence in the 5 'to 3' direction is CAUA or CATA.

In the preferred embodiment, the a, b, C sequences form by self-assembly a nucleic acid domain having the formula (1), wherein the bases at the positions other than the N and N' defined non-Watson-Crick base pairs form a classical Watson-Crick pair, and the bases of the Watson-Crick pair are selected from G-C or C-G base pairs. The nucleic acid nanostructure is more stable because the force of hydrogen bonds between G-C or C-G base pairs is greater than the force of hydrogen bonds between A-U/T or U/T-A base pairs. And a bulge or loop structure formed by non-Watson-Crick pairing base brings higher tension to the nucleic acid nano-carrier, so that the adaptability of the nucleic acid nano-carrier to microenvironment change is stronger, and the stability of the nucleic acid nano-particle is higher.

In the nanoparticles having the structure of formula (1), the specific sequence composition of the a sequence, the b sequence and the c sequence is not particularly limited as long as the structure can be formed. From the viewpoint of self-assembly of nucleic acid sequences, in order to further improve the efficiency of self-assembly of the three sequences into the nanoparticle having the structure of formula (1), when selecting the bases paired in Watson-Crick, the bases at different positions are preferably selected according to the following principle: (1) a sequence a, a sequence b and a sequence c, wherein when a single sequence is not self-complementary, a pair of sequences forms a secondary structure; (2) one end of any two sequences is complementary and matched to form a double chain, and the other end is not complementary and matched to form a Y-shaped or T-shaped structure. The principle of the base selection is to make the two ends of any one strand complementary and paired with the two ends of the other two strands respectively to improve the self-assembly efficiency. Of course, in addition to the Y-type or T-type structure, other variants such as quadrilateral, etc. may be used as long as the principle that one end of any two sequences is complementary and paired to form a double strand and the other end is not complementary and paired is satisfied.

In the nanoparticle with the structure of the formula (1), in the non-Watson-Crick pairing base, the fourth N from the 5 'end in the sequence a and the first N' from the 5 'end in the sequence b can be paired with the fourth N from the 5' end in the sequence a, and can be U-U which is not matched with Watson-Crick pairing, and can also be T, A, C or G which is modified and follows the Watson-Crick pairing principle. The Watson-Crick pairing relatively improves the bonding force between chains and improves the stability, but the non-Watson-Crick pairing endows the nano particles with greater flexibility and is also beneficial to improving the stability of the nano particles in the face of microenvironment change.

In a preferred embodiment, the sequence a, the sequence b and the sequence c are any one of the following groups: (1) a sequence (SEQ ID NO: 7): 5'-GGAGCGUUGG-3', b sequence (SEQ ID NO: 8): 5'-CCUUCGCCG-3', c sequence (SEQ ID NO: 9): 5'-CGGCCAUAGCCC-3', respectively; (2) a sequence (SEQ ID NO: 10): 5'-GCAGCGUUCG-3', b sequence (SEQ ID NO: 11): 5 '-CGUUCGCCGC-3', c sequence (SEQ ID NO: 12): 5'-CGGCCAUAGCGC-3', respectively; (3) a sequence (SEQ ID NO: 13): 5'-CGAGCGUUGC-3', b sequence (SEQ ID NO: 14): 5 '-GCUUCGCCGCCG-3', c sequence (SEQ ID NO: 15): 5'-CGGCCAUAGCCG-3', respectively; (4) a sequence (SEQ ID NO: 16): 5'-GGAGCGUUGG-3', b sequence (SEQ ID NO: 17): 5 '-CCUUCGGG-3', c sequence (SEQ ID NO: 18): 5'-CCCCCAUAGCCC-3', respectively; (5) a sequence (SEQ ID NO: 19): 5'-GCAGCGUUCG-3', b sequence (SEQ ID NO: 20): 5'-CGUUCGGCG-3', c sequence (SEQ ID NO: 21): 5'-CGCCCAUAGCGC-3', respectively; (6) a sequence (SEQ ID NO: 22): 5'-GCAGCGUUCG-3', b sequence (SEQ ID NO: 23): 5'-CGUUCGGCC-3', c sequence (SEQ ID NO: 24): 5'-GGCCCAUAGCGC-3', respectively; (7) a sequence (SEQ ID NO: 25): 5'-CGAGCGUUGC-3', b sequence (SEQ ID NO: 26): 5'-GCUUCGGCG-3', c sequence (SEQ ID NO: 27): 5'-CGCCCAUAGCCG-3', respectively; (8) a sequence (SEQ ID NO: 28): 5'-GGAGCGTTGG-3', b sequence (SEQ ID NO: 29): 5'-CCTTCGCCG-3', c sequence (SEQ ID NO: 30): 5'-CGGCCATAGCCC-3', respectively; (9) a sequence (SEQ ID NO: 31): 5'-GCAGCGTTCG-3', b sequence (SEQ ID NO: 32): 5'-CGTTCGCCG-3', c sequence (SEQ ID NO: 33): 5'-CGGCCATAGCGC-3', respectively; (10) a sequence (SEQ ID NO: 34): 5'-CGAGCGTTGC-3', b sequence (SEQ ID NO: 35): 5'-GCTTCGCCG-3', c sequence (SEQ ID NO: 36): 5'-CGGCCATAGCCG-3', respectively; (11) a sequence (SEQ ID NO: 37): 5'-GGAGCGTTGG-3', b sequence (SEQ ID NO: 38): 5'-CCTTCGGGG-3', c sequence (SEQ ID NO: 39): 5'-CCCCCATAGCCC-3', respectively; (12) a sequence (SEQ ID NO: 40): 5'-GCAGCGTTCG-3', b sequence (SEQ ID NO: 41): 5'-CGTTCGGCG-3', c sequence (SEQ ID NO: 42): 5'-CGCCCATAGCGC-3', respectively; (13) a sequence (SEQ ID NO: 43): 5'-GCAGCGTTCG-3', b sequence (SEQ ID NO: 44): 5'-CGTTCGGCC-3', c sequence (SEQ ID NO: 45): 5'-GGCCCATAGCGC-3', respectively; (14) a sequence (SEQ ID NO: 46): 5'-CGAGCGTTGC-3', b sequence (SEQ ID NO: 47): 5'-GCTTCGGCG-3', c sequence (SEQ ID NO: 48): 5'-CGCCCATAGCCG-3', respectively; (15) a sequence (SEQ ID NO: 175): 5'-CGAGCGTTCC-3', b sequence (SEQ ID NO: 176): 5'-GGTTCGCCG-3', c sequence (SEQ ID NO: 177): 5'-CGGCCATAGCCG-3' are provided.

The nucleic acid nanoparticles formed by self-assembly of the fifteen groups of sequences not only have higher stability, but also have higher self-assembly efficiency.

The nucleic acid nanoparticles mentioned above can be not only self-assembled into shapes, but also have the ability to carry or carry mitoxantrone drugs. Depending on the position of G-C or C-G base pairs in the above-mentioned nucleic acid nanoparticles, the amount of mitoxantrone to be carried differs.

In order to allow the nucleic acid domain to carry more mitoxantrone and bioactive substances (see below for the description of bioactive substances), in a preferred embodiment, the nucleic acid domain further comprises a first extension, wherein the first extension is a Watson-Crick paired extension, and the first extension is located at the 5 'end and/or 3' end of any one of the a sequence, the b sequence and the c sequence. A certain matching relationship is required between the carrier and the carried substance, and when the molecular weight of the carrier is too small and the molecular weight of the carried substance is too large, the carrying or transporting capacity of the carrier to the carried substance is relatively reduced from the mechanical point of view. Therefore, a vector matching the size of the carried substance can be obtained by adding a first extension segment to the 5 'end and/or 3' end of any one of the a sequence, the b sequence and the c sequence based on the nucleic acid nanostructure.

The specific length of the first extension segment can be determined according to the size of the substance to be carried. In a preferred embodiment, the first extension is selected from any one of the group consisting of: (1): a 5' end of the chain: 5' -CCCA-3', 3' end of c chain: 5 '-UGGG-3'; (2): a 3' end of the chain: 5' -GGG-3', 5' end of b chain: 5 '-CCC-3'; (3): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-UGG-3'; (4): a 5' end of the chain: 5' -CCCG-3', 3' end of c chain: 5 '-CGGG-3'; (5): a 5' end of the chain: 5' -CCCC-3', 3' end of c chain: 5 '-GGGG-3'; (6): b 3' end of strand: 5' -CCC-3', 5' -end of c chain: 5 '-GGG-3'. (7): b 3' end of strand: 5' -CCG-3', the 5' end of the c chain: 5 '-CGG-3'; (8): a 5' end of the chain: 5' -CCCA-3', 3' end of c chain: 5 '-TGGG-3'; (9): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-TGG-3'; (10): a 5' end of the chain: 5'-GCGGCGAGCGGCGA-3' (SEQ ID NO:162), the 3' end of the c-chain: 5'-UCGCCGCUCGCCGC-3' (SEQ ID NO: 163); (11): a 3' end of the chain: 5'-GGCCGGAGGCCGG-3' (SEQ ID NO:164), 5' end of b chain: 5'-CCGGCCUCCGGCC-3' (SEQ ID NO: 165); (12) b 3' end of strand: 5' -CCAGCCGCC-3' (SEQ ID NO:166), 5' end of c chain: 5'-GGCGGCAGG-3' (SEQ ID NO: 167); (13): a 5' end of the chain: 5'-GCGGCGAGCGGCGA-3' (SEQ ID NO:168), the 3' end of the c-chain: 5'-TCGCCGCTCGCCGC-3' (SEQ ID NO: 169); (14): a 3' end of the chain: 5'-GGCCGGAGGCCGG-3' (SEQ ID NO:170), 5' end of b chain: 5'-CCGGCCTCCGGCC-3' (SEQ ID NO: 171).

The first extension not only increases the length of any one or more of the three sequences forming the nucleic acid nanostructure, but also the first extension composed of GC bases further improves the stability of the formed nanoparticles. Moreover, the first extension segment composed of the sequence also keeps higher self-assembly activity and efficiency of the sequence a, the sequence b and the sequence c.

From the viewpoint of the size of the formed nucleic acid nanoparticles and the stability thereof when transported in vivo as a drug delivery vehicle, it is desirable to be able to transport the drug while trying not to be filtered out by the kidney until reaching the target cells. In a preferred embodiment, the nucleic acid domain further comprises a second extension located 5 'and/or 3' to any of the a sequence, the b sequence and the c sequence, the second extension being a Watson-Crick paired extension; more preferably, the second extension is an extended sequence of CG base pairs; further preferably, the second extension is an extension sequence of 1-10 CG base pairs. The second extension is an extension further added on the basis of the first extension.

In a preferred embodiment, the nucleic acid domain further comprises at least one second extension selected from the group consisting of: a first group: a 5' end of the chain: 5' -CGCGCG-3 ', 3' -end of c chain: 5 '-CGCGCG-3'; second group: a 3' end of the chain: 5' -CGCCGC-3 ', 5' -end of b chain: 5 '-GCGGCG-3'; third group: b 3' end of strand: 5' -GGCGGC-3 ', 5' -end of c chain: 5 '-GCCGCC-3'. This second extension renders the nanoparticle non-immunogenic and non-existent in the case of secondary structures to which each chain folds itself.

The first extension and/or the second extension may be separated by unpaired base pairs.

In order to make the nucleic acid nanoparticles capable of carrying bioactive substances with larger molecular weight (see the introduction of bioactive substances below), increasing drug loading and maintaining necessary stability, in a preferred embodiment, the second extension is an extension containing both CG base pairs and AT/AU base pairs, and preferably the second extension is an extension of 2-50 base pairs. Here, the "/" in "AT/AU base" is in the relationship of or, specifically, the second extension is an extended sequence containing both CG base pairs and AT base pairs, or the second extension is an extended sequence containing both CG base pairs and AU base pairs.

More specifically, the sequences a, b and c after adding the above second extension may be the following sequences, respectively:

sequence a is (SEQ ID NO: 49):

b is (SEQ ID NO: 50):

sequence c is (SEQ ID NO: 51):

m in the sequence a, the sequence b and the sequence c is U or T, and when M is T, the synthesis cost of the sequences is greatly reduced.

In practical application, the specific arrangement positions of the CG base pairs and the extended sequences of the AT/AU base pairs can be reasonably adjusted according to actual needs. In a more preferred embodiment, the second extension is an extension sequence formed by alternating sequences of 2-8 CG base pairs and 2-8 AT/AU base pairs; or the second extension is an extension sequence with 1 CG base pair sequence and 1 AT/AU base pair sequence arranged alternately.

Specifically, the positions of the CGCGCG extension and the CGCCGC extension in the sequence a shown by the SEQ ID NO. 49 and the AAAAAA extension are interchanged, the positions of the GCGGCG extension and the GGCGGC extension in the sequence b shown by the SEQ ID NO. 50 and the TTTTTT extension are interchanged, the positions of the GCCGCC extension and the AAAAAA extension in the sequence c shown by the SEQ ID NO. 51 and the CGCCGC extension and the TTTTTT extension are interchanged. The nucleic acid nanoparticles formed by self-assembly of the sequences are suitable for carrying bioactive substances with indole molecular structures (indole molecules are preferably combined with A).

Three major challenges that have existed as building materials for widespread use in RNA over the past years include: 1) susceptibility to rnase degradation; 2) susceptibility to dissociation after systemic injection; 3) toxicity and adverse immune response. Currently, these three challenges have been largely overcome: 1) 2 '-fluoro (2' -F) or 2 '-O-methyl (2' -OMe) modifications of the ribose-OH group can chemically stabilize RNA in serum; 2) certain naturally occurring linking motifs are thermodynamically stable and can keep the entire RNA nanoparticle intact at ultra-low concentrations; 3) the immunogenicity of the RNA nanoparticles is sequence and shape dependent and can be adjusted to allow the RNA nanoparticles to stimulate the production of inflammatory cytokines or to render the RNA nanoparticles non-immunogenic and non-toxic for repeated intravenous administration of 30 mg/kg.

Therefore, in order to further reduce the susceptibility of the nucleic acid nanoparticles to rnase degradation while increasing stability during transport, in a preferred embodiment, the bases, ribose and phosphate in the a sequence, the b sequence and the c sequence have at least one modifiable site, and any modifiable site is modified by any one of the following modifying linkers: -F, methyl, amino, disulfide, carbonyl, carboxyl, mercapto and aldehyde groups; preferably, the sequence a, sequence b and sequence C have a 2' -F modification at the C or U base. When the modified joint is sulfydryl, the modified joint belongs to sulfo modification, the modification strength is weak, and the cost is low.

The mitoxantrone can be attached by physical and/or covalent attachment. When the mitoxantrone is simultaneously connected with the nucleic acid domain by adopting two modes of physical intercalation and covalent connection, the physical intercalation is usually intercalated between GC base pairs, and the preferable number of intercalation sites is 1-100: the ratio of 1 was inserted. When covalent attachment is used, mitoxantrone typically reacts with the amino group outside the G ring to form a covalent attachment. More preferably, the molar ratio between the mitoxantrone and the nucleic acid nanoparticles is 2 to 300:1, preferably 2 to 290:1, more preferably 2 to 29:1, even more preferably 10 to 50:1, and most preferably 15 to 25: 1.

In addition to the nucleic acid nanoparticles serving as delivery vehicles for mitoxantrone in the mitoxantrone-containing drugs provided herein, in a preferred embodiment, the nucleic acid nanoparticles further comprise a biologically active substance, depending on the purpose of the drug, the biologically active substance being linked to the nucleic acid domain. The bioactive substance is one or more of a target, fluorescein, interfering nucleic acid siRNA, miRNA, ribozyme, riboswitch, aptamer, RNA antibody, protein, polypeptide, flavonoid, glucose, natural salicylic acid, monoclonal antibody, vitamin, phenol, lecithin and small molecule drugs except mitoxantrone.

In order to improve the efficiency of loading and carrying nucleic acid nanoparticles with respect to the loaded bioactive substance, it is preferable that the relative molecular weights of the nucleic acid domains and the relative molecular weights of mitoxantrone and the bioactive substance have a certain matching relationship. In a preferred embodiment, the relative molecular weight of the nucleic acid domains is denoted as N₁The total relative molecular weight of mitoxantrone and biologically active substance is denoted as N₂，N₁/N₂≥1:1。

The mitoxantrone-containing drugs of the present application have different performance optimizations depending on the particular type of bioactive material being loaded. For example, when the bioactive substance is biotin or folic acid, it serves to target the mitoxantrone-containing drug, e.g., specifically to cancer cells. When the bioactive substance is fluorescein, it acts to provide a luminescent tracer effect to the nucleic acid nanoparticles, such as may be one or more of FAM, CY3, CY5, or Quasar670, and the like. When the bioactive substances are certain siRNA, miRNA, protein, polypeptide, RNA antibody and micromolecule drugs except mitoxantrone, the mitoxantrone-containing drugs can become new products with specific treatment effects, such as drugs with more excellent performance according to different biological functions. In addition, according to the different kinds of the biological active substances carried, DNA nanoparticles and RNA nanoparticles are preferably used, and can be reasonably selected according to actual needs. For example, when the bioactive substance is a drug, it is preferable that the DNA nanoparticle or the RNA nanoparticle is carried, and there is no particular requirement on the length of the single strand assembled to form the nanoparticle.

In a preferred embodiment, the bioactive substances are target heads, fluorescein and miRNA, wherein the target heads are located on any sequence of a, b and c sequences, preferably on the 5' end or the 3' end of any sequence of a, b and c, or are inserted between GC bonds of the nucleic acid structure domain, the miRNA is anti-miRNA, the fluorescein is modified on the 5' end or the 3' end of the anti-miRNA, and the miRNA is located at any one or more positions of the 3' end of the a sequence, the 5' end and the 3' end of the c sequence; preferably, the target head is folic acid or biotin, the fluorescein is any one or more of FAM, CY5 and CY3, and the anti-miRNA is anti-miR-21.

The target head can be connected to any sequence of a sequence, b sequence and c sequence through a linker covalent connection mode, and the available linker is selected from disulfide bond, p-azido group, bromopropyne or PEG. As used herein, "on any sequence" refers to any base position of any sequence of a, b, c sequences, and it is more convenient to attach to the 5 'end or 3' end, and the application is more extensive. Folate modification can be either physical intercalation mode ligation or physical intercalation + covalent ligation.

The fluorescein may be any one or more of conventional fluorescein, preferably FAM, CY5 and CY 3.

The miRNA can be miRNA with cancer inhibiting effect, or anti-miRNA capable of inhibiting corresponding diseases, and is reasonably selected according to medical needs in practical application. The anti-miRNA may be synthesized at any one or more of the 3' end of the a sequence, the 5' end and the 3' end of the c sequence. When anti-miRNA is synthesized at all of the above three positions, the inhibitory effect of the anti-miRNA on the corresponding miRNA is relatively stronger.

Preferably, the miR-21 is resistant to miR-21, and miR-21 is involved in the initiation and progression of various cancers and is a main oncogene for invasion and metastasis. The anti-miR-21 can effectively and simultaneously regulate a wide range of target genes, and is beneficial to solving the problem of heterogeneity of cancers. Thus, in the preferred nucleic acid nanoparticles, the target head, such as folate or biotin, can specifically target cancer cells, and after internalization in combination with cancer cells, the anti-miR-21 is complementary to miR-21 base with very high affinity and specificity, thereby effectively reducing expression of oncogenic miR-21. Therefore, the anti-miR-21 can be synthesized at any one or more positions of the 3' end of the a sequence, the 5' end and the 3' end of the c sequence according to actual needs. When the anti-miR-21 is synthesized at all three positions, the inhibition effect of the anti-miR-21 on the miR-21 is relatively stronger.

When the bioactive substances capable of being carried are other small-molecule drugs except mitoxantrone, the drugs include, but are not limited to, drugs for treating liver cancer, gastric cancer, lung cancer, breast cancer, head and neck cancer, uterine cancer, ovarian cancer, melanoma, leukemia, senile dementia, ankylosing spondylitis, malignant lymphoma, bronchial cancer, rheumatoid arthritis, HBV hepatitis B, multiple myeloma, pancreatic cancer, non-small cell lung cancer, prostate cancer, nasopharyngeal carcinoma, esophageal cancer, oral cancer and lupus erythematosus according to the types of diseases which can be treated by different drugs; preferably, the head and neck cancer is brain cancer, neuroblastoma or glioblastoma.

When the biologically active substance capable of being carried is a small molecule drug other than mitoxantrone, the biologically active substance includes, but is not limited to, drugs containing any one or more of the following groups, depending on the molecular structure of the drug or the characteristic groups of the drug: amino groups, hydroxyl groups, carboxyl groups, mercapto groups, phenyl ring groups, and acetamido groups.

In a preferred embodiment, the protein is one or more of an antibody or aptamer to SOD (superoxide dismutase), Survivin (Survivin), hTERT (human telomerase reverse transcriptase), EGFR (epidermal growth factor receptor), PSMA (prostate specific membrane antigen); the vitamin is levo-C and/or esterified C; the phenols are tea polyphenols and/or grape polyphenols.

In a preferred embodiment, the particle size of the nucleic acid nanoparticles is 1 to 100nm, preferably 5 to 50nm, more preferably 10 to 30nm, and even more preferably 10 to 15 nm. Within this range the size is suitable both to enter the cell membrane by cell surface receptor mediated phagocytosis and to avoid non-specific cell penetration and removal by renal filtration, so that the favourable particle size contributes to improved pharmacokinetic, pharmacodynamic, biological and toxicological profiles.

According to a second aspect of the present application, there is also provided a method for preparing the mitoxantrone-containing medicament described above, comprising the steps of: providing any one of the nucleic acid nanoparticles described above; the mitoxantrone is carried on the nucleic acid nanoparticles in a physical connection and/or covalent connection mode to obtain the mitoxantrone-containing drug.

When physical attachment is used, mitoxantrone will typically form an insertion between the GC base pairs by physical intercalation. When covalent attachment is used, mitoxantrone typically reacts with the amino group outside the G ring to form a covalent attachment. The mitoxantrone-containing drug prepared by the method has better targeting property after being modified by the target head, can stably deliver the mitoxantrone, and has high reliability.

In a preferred embodiment, the step of mounting mitoxantrone by physical attachment comprises: mixing and stirring mitoxantrone, nucleic acid nanoparticles and a first solvent to obtain a premixed system; and precipitating the premixed system to obtain the mitoxantrone-containing medicament. The dosage of the mitoxantrone and the nucleic acid nanoparticles can be adjusted according to the change of the loading amount, which can be understood by those skilled in the art and is not described in detail herein.

In order to improve the efficiency and stability of physical connection, the amount of mitoxantrone added per liter of the first solvent is preferably 0.1 to 1 g. Preferably, the first solvent is selected from one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid. Preferably, the step of precipitating the premixed system to obtain the mitoxantrone-containing medicament comprises: precipitating the premixed system to obtain a precipitate; washing the precipitate to remove impurities to obtain the mitoxantrone-containing medicament. More preferably, the premix system is mixed with absolute ethyl alcohol and then precipitated at a temperature of less than 10 ℃ to obtain a precipitate, and still more preferably, the precipitate is precipitated at a temperature of 0 to 5 ℃ to obtain a precipitate. More preferably, 6-12 times of volume of absolute ethyl alcohol is adopted to wash the precipitate to remove impurities, and the mitoxantrone-containing medicine is obtained.

In a preferred embodiment, the step of entrapping mitoxantrone by covalent attachment comprises: preparing a mitoxantrone solution; reacting the mitoxantrone solution with the amino outside the G ring of the nucleic acid nanoparticles under the mediation of formaldehyde to obtain a reaction system; purifying the reaction system to obtain the mitoxantrone-containing medicament.

In a formaldehyde-mediated form, the following reactions can occur:

preferably, the step of reacting comprises: and (3) mixing the mitoxantrone solution with the paraformaldehyde solution and the nucleic acid nanoparticles, and reacting under a dark condition to obtain a reaction system. The paraformaldehyde solution can release formaldehyde small molecules so as to participate in the chemical reaction. In order to improve the reaction efficiency, the concentration of the paraformaldehyde solution is preferably 3.7-4 wt%, the paraformaldehyde solution is preferably a solution formed by mixing paraformaldehyde and a second solvent, and the second solvent is one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid.

In the above preparation method, the nucleic acid nanoparticles may be prepared by a self-assembly form such as: (1) mixing RNA or DNA single strands a, b and c at the same time, and dissolving in DEPC water or TMS buffer solution; (2) heating the mixed solution to 80 ℃/95 ℃ (wherein the RNA assembly temperature is 80 ℃, and the DNA assembly temperature is 95 ℃), keeping for 5min, and then slowly cooling to room temperature at the speed of 2 ℃/min; (3) loading the product on 8% (m/V) native PAGE gel and electrophoretically purifying the complex at 100V in TBM buffer at 4 ℃; (4) cutting off a target band, eluting in RNA/DNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and volatilizing at low temperature under reduced pressure to obtain a self-assembly product, namely a nucleic acid structural domain, thereby obtaining the nucleic acid nanoparticles.

In order to provide the mitoxantrone-containing drug with other functions as required by the practical application, in a preferred embodiment, after obtaining the nucleic acid domain, the preparation method further comprises: the aforementioned bioactive substances are carried on the nucleic acid domain by means of physical linkage and/or covalent linkage, thereby obtaining the nucleic acid nanoparticles. The biologically active substance may also be attached by physical and/or covalent attachment. Forms of covalent attachment include, but are not limited to, mounting by solvent covalent attachment, linker covalent attachment, or click linkage; preferably, the solvent is a third solvent used in the covalent attachment as the attachment medium, and the third solvent is selected from one or more of paraformaldehyde, DCM, DCC, DMAP, Py, DMSO, PBS, and glacial acetic acid; preferably, the linker is selected from the group consisting of disulfide bond, p-azido, bromopropyne, or PEG; preferably, click-linking is performed by alkynyl or azide modification of the biologically active substance precursor and the nucleic acid domain at the same time and then by click-linking.

The above classification does not mean that a certain bioactive substance is linked to a nucleic acid domain in only one manner. Instead, some bioactive substances may be linked to the nucleic acid domain by physical intercalation, by covalent linkage, or by click linkage. However, for a particular bioactive substance, there may be only one type of attachment, or there may be multiple types of attachment, but there may be some type of attachment that has an advantageous utility.

In the above connection method, when different drugs are physically inserted into the nucleic acid domains, the number and binding sites of the insertion are slightly different. For example, when the anthracycline and acridine drugs are inserted, the drugs are usually inserted between GC base pairs, and the number of the preferred insertion sites is 1 to 100: the ratio of 1 was inserted. When the naphthamide drug is inserted, the naphthamide drug is usually inserted between AA base pairs, the preferable number of insertion sites is different according to the number of the AA base pairs on the nucleic acid structural domain, and the pyridocarbazoles are inserted according to the difference of the number of the AA base pairs in the range of 1-200: the ratio of 1 was inserted.

Specifically, the molar ratio of biologically active substance to nucleic acid domain can be reasonably selected for physical intercalation depending on the species of biologically active substance, the length of the a, b and c sequences forming the nucleic acid domain in the nucleic acid nanoparticle, and how many complementary base pairs of GC are present therein.

In a preferred embodiment, when the bioactive substance and the nucleic acid domain are physically intercalated and covalently linked, the molar ratio of the bioactive substance physically intercalated and linked to the drug covalently linked is 1-200: 1. the connection mode is suitable for anthracycline and acridine medicines. The proportion of the drugs connected in different connection modes is not limited to the range, and the drugs can be effectively suspended, have no toxic effect on cells and can be effectively released after reaching a target.

When the bioactive substance precursor and the nucleic acid domain are simultaneously subjected to alkynyl or azide modification and connected in a click-to-link mode, different click-to-links are selected according to different structure changes of the medicament. And the attachment position may be changed correspondingly according to the structure of the active material, which can be understood by those skilled in the art.

In a preferred embodiment, when the biologically active substance is linked to the nucleic acid domain in a click-link fashion, the site of the biologically active substance precursor for the alkynyl or azide modification is selected from the group consisting of hydroxyl, carboxyl, sulfhydryl or amino, and the site of the nucleic acid domain for the alkynyl or azide modification is selected from the group consisting of amino, imino or hydroxyl.

According to a third aspect of the present application, there is also provided a pharmaceutical composition comprising any one of the mitoxantrone-containing drugs described above. Specifically, according to actual needs, a suitable combination drug or adjuvant can be selected to form a drug combination having a combined drug effect or capable of improving certain properties (such as stability) of the drug.

According to a fourth aspect of the present application, there is also provided the use of any one of the mitoxantrone-containing medicaments described above in the preparation of a medicament for the treatment of a tumour. Further, the tumor is any one or more of breast cancer, malignant lymphoma, gastric cancer, intestinal cancer, leukemia, bladder cancer, liver cancer, multiple myeloma, malignant mesothelioma and ovarian cancer. The specific application can be to improve the medicament per se on the basis of the medicament of the application to obtain a new medicament, or to prepare the medicament of the application serving as a main active ingredient into a preparation with a proper dosage form and the like.

According to a fifth aspect of the present application, there is also provided a method for preventing and/or treating a tumor, the method comprising: providing any one of the mitoxantrone-containing medicaments or pharmaceutical compositions described above; administering to a patient having a tumor an effective amount of the mitoxantrone-containing medicament or pharmaceutical composition described above. Further, the tumor is any one or more of breast cancer, malignant lymphoma, gastric cancer, intestinal cancer, leukemia, bladder cancer, liver cancer, multiple myeloma, malignant mesothelioma and ovarian cancer.

An effective amount herein includes a prophylactically effective amount and/or a therapeutically effective amount, by which is meant an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, e.g., reduction in breast cancer, malignant lymphoma, gastric cancer, intestinal cancer, leukemia, bladder cancer, liver cancer, multiple myeloma, malignant mesothelioma, or ovarian cancer. In a particular embodiment, the dosage may be adjusted to provide an optimal therapeutically responsive dose, and the therapeutically effective amount may vary depending on the following factors: the disease state, age, sex, weight of the individual and the ability of the formulation to elicit a desired response in the individual. A therapeutically effective amount is also meant to include an amount by which the beneficial effect of the treatment exceeds its toxic or detrimental effects. A prophylactically effective amount is an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result, such as prevention or inhibition of breast cancer, malignant lymphoma, gastric cancer, intestinal cancer, leukemia, bladder cancer, liver cancer, multiple myeloma, malignant mesothelioma, or ovarian carcinogenesis. A prophylactically effective amount can be determined according to the description of therapeutically effective amounts above. For any particular subject, specific dosages may be adjusted over time according to the individual need and the professional judgment of the person to whom they are administered.

When the nucleic acid domain is bound to a drug, the nucleic acid domain is water-soluble, and many drugs have poor water-solubility, and when the nucleic acid domain is bound to the drug, the water-solubility is improved. When the drugs are anthracyclines, the drugs are covalently bound to the nucleic acid domain via an-NH bond on the nucleotide guanosine (the-NH group is hundreds of times more active than other groups that may covalently bind to the drug under appropriate pH conditions), thereby forming a drug-loaded nucleic acid domain. Therefore, according to the size of a specific drug molecule and the number of GC base pairs on the sequence a, the sequence b and the sequence c of a specifically designed nucleic acid structural domain, when in combination, the combination reaction is carried out according to the supersaturation combination amount which is 1.1-1.3 times of the theoretical amount, and 35-45 drugs can be combined on one nucleic acid structural domain at most. When the drug has other structure, the loading amount is related to the occupancy of the specific drug (including but not limited to molecular structure, form, shape and molecular weight), so that the binding condition of the active site of the drug and the-NH bond on the nucleotide guanosine of the nucleic acid domain is relatively severe, and the drug can be loaded but is relatively difficult to be excessively bound.

It should be noted that the nucleic acid nanoparticles formed by self-assembly of the sequences or sequence variants provided herein can also be used as basic building blocks, and can be further polymerized to form multimers, such as dimers, trimers, tetramers, pentamers, hexamers, heptamers, etc., according to the practical application.

The advantageous effects of the present application will be further described with reference to specific examples.

Assembly of nucleic acid nanoparticles

Example 1

One, RNA and DNA nanoparticle vector:

(1) the three polynucleotide base sequences that make up the RNA nanoparticles are shown in table 1:

table 1:

(2) three polynucleotide base sequences of the DNA nanoparticle.

The DNA has the same sequence as that of the RNA described above except that T is substituted for U. Wherein the molecular weight of the a chain is 8802.66, the molecular weight of the b chain is 8280.33, and the molecular weight of the c chain is 9605.2.

The a, b and c strands of the above-mentioned RNA nanoparticles and DNA nanoparticles were synthesized by Competition Biotechnology (Shanghai) Co., Ltd.

II, self-assembly experiment steps:

(1) mixing RNA or DNA single strands a, b and c at the same time according to the molar ratio of 1:1:1, and dissolving in DEPC water or TMS buffer solution;

(2) heating the mixed solution to 80 ℃/95 ℃ (wherein the RNA assembly temperature is 80 ℃, and the DNA assembly temperature is 95 ℃), keeping for 5min, and then slowly cooling to room temperature at the speed of 2 ℃/min;

(3) loading the product on 8% (m/V) native PAGE gel and electrophoretically purifying the complex at 100V in TBM buffer at 4 ℃;

(4) cutting off a target band, eluting in an RNA/DNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and volatilizing at low temperature under reduced pressure to obtain a self-assembly product;

(5) electrophoresis analysis detection and laser scanning observation.

Third, self-assembly experimental results

(1) Results of electrophoresis

The results of the electrophoretic detection of the RNA self-assembly products are shown in FIG. 1. In fig. 1, lanes 1 to 3 are, from left to right: a strand, b strand, RNA self-assembly product. As can be seen, the RNA self-assembly products are slightly dispersed, but clearly seen as a single band. And the molecular weight is the molecular weight after the assembly, and is larger than that of the single chain, so that the position of the band lags behind the a chain and the b chain, the actual situation is consistent with the theory, and the stable composite structure is formed by the self-assembly of the RNA single chains, and the RNA nano-particles are formed.

The results of the electrophoretic detection of the DNA self-assembly products are shown in FIG. 2. In fig. 2, lanes 1 to 3 are, from left to right: a chain, b chain, DNA self-assembly product. As can be seen from the figure, the bands of the DNA self-assembly products are bright and clear, and are single bands, which proves that the DNA single strands form a stable composite structure through self-assembly, and form DNA nanoparticles.

In this example, it was verified by gel electrophoresis that: sequences a, b and c including RNA core sequence SEQ ID NO 1, SEQ ID NO 3 and SEQ ID NO 5 can be successfully self-assembled into RNA nanoparticles. Sequences a, b and c including DNA core sequence SEQ ID NO 2, SEQ ID NO 4 and SEQ ID NO 6 can also be successfully self-assembled into DNA nanoparticles.

The sequences a, b and c of the RNA nanoparticles and the DNA nanoparticles include various extension sequences (including drug-loading binding sequences) that facilitate the function of loading the nucleic acid domains, and a targeting head or fluorescein linked to the nucleic acid domains, in addition to the core sequence forming the nucleic acid domains. It can be seen that the presence of substances other than these core sequences does not affect the formation of nucleic acid domains and the successful self-assembly of nucleic acid nanoparticles. The self-assembled nucleic acid nanoparticles can have a targeting type under the guidance of a target head, and the fluorescein can enable the nucleic acid nanoparticles to have visibility and traceability.

Example 2

One, 7 groups of short sequence RNA nano-particle carriers:

(1)7 sets of three polynucleotide base sequences constituting the RNA nanoparticle:

table 2: r-1:

table 3: r-2:

table 4: r-3:

table 5: r-4:

table 6: r-5:

table 7: r-6:

table 8: r-7:

the single strands of the 7 groups of short-sequence RNA nanoparticle carriers are synthesized by the corporation of Venezetian Biotechnology (Shanghai).

II, self-assembly experiment steps:

(1) mixing RNA single strands a, b and c at the same time according to a molar ratio of 1:1:1, and dissolving in DEPC water or TMS buffer solution;

(2) heating the mixed solution to 80 ℃, keeping the temperature for 5min, and then slowly cooling to room temperature at the speed of 2 ℃/min;

(4) cutting a target band, eluting in an RNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and volatilizing at low temperature under reduced pressure to obtain a short-sequence RNA self-assembly product;

(5) electrophoretic analysis detection and laser scanning observation;

(6) and (6) detecting the potential.

Third, self-assembly experimental results

(1) Results of electrophoresis

The 2% agarose gel electrophoresis of the 7 sets of short sequence RNA self-assembly products is shown in FIG. 3. Lanes 1 to 7 in FIG. 3 are, from left to right: short sequences R-1, R-2, R-3, R-4, R-5, R-6 and R-7.

The 4% agarose gel electrophoresis of the 7 sets of short sequence RNA self-assembly products is shown in FIG. 4. Lanes 1 to 7 in FIG. 4 are, from left to right: short sequences R-1, R-2, R-3, R-4, R-5, R-6 and R-7.

As can be seen from the results of FIG. 3 and FIG. 4, it can be clearly seen that the bands of R-2, R-3, R-5 and R-7 in the 7 groups of short sequence self-assembly products are bright and clear, and the bands of R-1, R-4 and R-6 are still single bands, although they are relatively dispersed, indicating that the 7 groups of short sequences can be well self-assembled into RNA nanoparticle structures.

(2) Determination of potential

The determination method comprises the following steps: preparing a potential sample (self-assembly product dissolved in ultrapure water) and putting the potential sample into a sample cell, opening a sample cell cover of the instrument and putting the instrument into the sample cell;

opening software, clicking a menu MeasUre € ManUal, and presenting a ManUal measurement parameter setting dialog box;

setting software detection parameters;

then clicking the setting of finishing the determination, generating a measurement dialog box, and clicking Start to Start;

and (3) measuring results: the potential detection results of 7 groups of short sequence RNA nanoparticles are as follows:

table 9:

table 10:

table 11:

table 12:

table 13:

table 14:

table 15:

from the potential detection data described above, it can be seen that: the 7 groups of short sequence RNA self-assembly products have good stability, and further show that the nanoparticles formed by self-assembly of the short sequence RNAs have a stable self-assembly structure.

This example shows that: the different combinations of the core sequences a, b and c can form the RNA nano-particle with the nucleic acid structural domain through self-assembly, and the structure is stable. Based on example 1, it can be seen that various functional extension fragments or connecting targeting heads, fluorescein and the like are added on the basis of different core sequence combinations, and the RNA nanoparticles can be successfully assembled, and have the performances of drug loading, cell targeting, visual tracking and the like.

To further verify these properties, an extension fragment was added to example 2, see example 3. And adding an extension fragment on the basis of the DNA core sequence corresponding to the RNA core sequence of example 2, and simultaneously connecting the target or not connecting the target, as shown in example 4.

Example 3

One, 7 groups of conventional sequence RNA nanoparticle carriers:

table 16: r-8:

table 17: r-9:

table 18: r-10:

table 19: r-11:

table 20: r-12:

table 21: r-13:

table 22: r-14: (in the following a chainuGAcAGAuAAGGAAccuGcudTdTAs survivin siRNA)

The single strands of the 7 groups of conventional sequence RNA nanoparticle carriers are synthesized by consignment of Jima of Suzhou, wherein the sequences a, b and C in R-8 to R-14 are respectively extended RNA oligonucleotide sequences formed by adding extension segments on the basis of the sequences a, b and C of R-1 to R-7, targeting module fragments are not extended, and C/U base 2' F modification (the enzyme cleavage resistance and stability are enhanced) is carried out. In addition, a Survivin (Survivin) siRNA nucleic acid interference therapeutic fragment is modified in the RNA nanoparticle R-14, specifically, a sense strand of Survivin siRNA is extended at the 3 'end of the a strand (see the underline part of the a strand), and an antisense strand is extended and connected at the 5' end of the b strand (see the underline part of the b strand), so that base pair complementation is formed.

II, self-assembly experiment steps:

(4) cutting off target bands, eluting in RNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and evaporating at low temperature under reduced pressure;

(5) electrophoretic analysis detection and laser scanning observation;

(6) and (4) measuring the potential.

Third, self-assembly experimental results

(1) Results of electrophoresis

FIG. 5 shows the electrophoresis of the 2% agarose gel of the 7 sets of conventional sequence RNA self-assembly products. Lanes 1 to 7 in FIG. 5 are, from left to right: the self-assembly products of the conventional sequence RNA are R-8, R-9, R-10, R-11, R-12, R13 and R-14.

FIG. 6 shows the electrophoresis of 4% agarose gel of 7 sets of conventional sequence RNA self-assembly products. Lanes 1 to 7 in FIG. 6 are, from left to right: the self-assembly products of the conventional sequence RNA are R-8, R-9, R-10, R-11, R-12, R13 and R-14.

As can be seen from the results of FIG. 5 and FIG. 6, it can be clearly seen that the bands of the 7 sets of conventional sequence RNA self-assembly products are all bright and clear single bands, indicating that the 7 sets of conventional sequences can self-assemble into the nano-structure. Wherein, after a section of Survivin siRNA nucleic acid interference treatment fragment is modified in the conventional sequence RNA self-assembly product R-14, the self-assembly structure still has a stable self-assembly structure, which also indicates that the nucleic acid nano-particle can carry a nucleic acid drug and has the function of a delivery carrier of the nucleic acid drug.

(2) Determination of potential

setting software detection parameters;

and (3) measuring results: the potential detection results of 7 groups of conventional sequence RNA nanoparticles are as follows:

table 23:

table 24:

table 25:

table 26:

table 27:

table 28:

table 29:

from the potential detection data described above, it can be seen that: the 7 groups of conventional sequence RNA self-assembly products have good stability, and further show that the nanoparticles formed by self-assembly of the conventional sequence RNA have a stable self-assembly structure.

This example shows that: on the basis of RNA core sequences of different combinations, the addition of the extension segment can also successfully self-assemble into RNA nanoparticles with stable structure. Meanwhile, the added extension fragment enables the RNA nanoparticles to have excellent drug-carrying performance (see example 5 and example 7 in particular).

Example 4

1, 7 groups of conventional sequence DNA nanoparticle carriers:

(1)7 sets of three polynucleotide base sequences constituting the DNA nanoparticle:

the EGFRatt or PSMAaptt (A9L) target is extended in part a strand:

EGFRapt(SEQ ID NO：97)：GCCTTAGTAACGTGCTTTGATGTCGATTCGACAGGAGGC；

PSMAapt(A9L，SEQ ID NO：98)：

GGGCCGAAAAAGACCTGACTTCTATACTAAGTCTACGTCCC。

table 30: d-1:

table 31: d-2:

table 32: d-3:

table 33: d-4:

table 34: d-5:

table 35: d-6:

table 36: d-7:

the single chains of the 7 groups of conventional sequence DNA nanoparticles were synthesized by Suzhou Hongxin entrustment, in which:

d-1 is a regular sequence DNA nanoparticle formed after adding an extended sequence comprising the EGFRatt target head (see underlined part below) to the core sequence (8) (a sequence: 5'-GGAGCGTTGG-3', b sequence: 5'-CCTTCGCCG-3', c sequence: 5'-CGGCCATAGCCC-3') described above;

d-2 is a regular sequence DNA nanoparticle formed after adding an extended sequence comprising the EGFRatt target head (see underlined part below) to the core sequence (9) (a sequence: 5'-GCAGCGTTCG-3', b sequence: 5'-CGTTCGCCG-3', c sequence: 5'-CGGCCATAGCGC-3') described above;

d-3 is a regular sequence DNA nanoparticle formed after adding an extended sequence comprising the EGFRatt target head (see underlined section below) to the core sequence (10) (a sequence: 5'-CGAGCGTTGC-3', b sequence: 5'-GCTTCGCCG-3', c sequence: 5'-CGGCCATAGCCG-3') described above;

d-4 is a regular-sequence DNA nanoparticle formed after adding an extension sequence comprising a PSMAapt target head (see underlined part below) to the core sequence (11) (a sequence: 5'-GGAGCGTTGG-3', b sequence: 5'-CCTTCGGGG-3', c sequence: 5'-CCCCCATAGCCC-3') described above;

d-5 is a regular-sequence DNA nanoparticle formed after adding an extension sequence comprising a PSMAApt target head (see underlined part below) to the core sequence (12) (a sequence: 5'-GCAGCGTTCG-3', b sequence: 5'-CGTTCGGCG-3', c sequence: 5'-CGCCCATAGCGC-3') described above;

d-6 is the core sequence (13) (a sequence: 5'-GCAGCGTTCG-3', b sequence: 5'-CGTTCGGCC-3', c sequence: 5'-GGCCCATAGCGC-3') added with an extension sequence not containing the targeting structure; the formed conventional sequence DNA nanoparticles;

d-7 is an extension sequence which does not contain a targeting structure and is added to the core sequence (14) (a sequence: 5'-CGAGCGTTGC-3', b sequence: 5'-GCTTCGGCG-3', c sequence: 5'-CGCCCATAGCCG-3') described above; and forming the conventional sequence DNA nano-particles.

In addition, single-stranded sequences for forming the 8 th set of DNA nanoparticles and single-stranded sequences of the 9 th set of DNA nanoparticles were synthesized.

Group 8 are conventional sequence DNA nanoparticles formed by adding an extended sequence comprising the EGFRApt target head (see bold type) to the core sequence (15) described above. The specific sequence is as follows:

a chain: (SEQ ID NO:172:)

The first three bases at the 5 'end and the last three bases at the 3' endThe bases are respectively subjected to sulfo modification, the 5' end is connected with Biotin, and the bold-faced bold part is an EGFRApt sequence;

b chain (SEQ ID NO: 173): 5'-GCGCCCGGTTCGCCGCCAGCCGCCGC-3', respectively carrying out sulfo-modification on the first three bases at the 5 'end and the last three bases at the 3' end;

c chain (SEQ ID NO: 174:): 5'-GCGGCGGCAGGCGGCCATAGCCGTGGGCGCGCG-3', respectively; the first three bases of the 5' end and the last three bases of the 3' end are respectively subjected to sulfo modification, and the 3' end is connected with Cy5 fluorescent label.

Wherein, group 9 is the DNA nanoparticles formed after adding the extension sequence on the basis of the core sequence (15) described above. The specific sequence is as follows:

chain a (SEQ ID NO: 178:):

the front three bases of the 5' end and the rear three bases of the 3' end are respectively subjected to thio modification, and the 5' end is connected with Biotin;

b chain (SEQ ID NO: 179:):

the first three bases of the 5 'end and the last three bases of the 3' end are respectively subjected to sulfo-modification;

c chain (SEQ ID NO: 180:):

the first three bases of the 5' end and the last three bases of the 3' end are respectively subjected to sulfo modification, and the 5' end is connected with Cy5 fluorescent label.

II, self-assembly experiment steps:

(1) mixing and dissolving the DNA single strands a, b and c in DEPC water or TMS buffer solution at the same time according to the molar ratio of 1:1: 1;

(2) heating the mixed solution to 95 ℃, keeping the temperature for 5min, and then slowly cooling to room temperature at the speed of 2 ℃/min;

(4) cutting off a target band, eluting in a DNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and volatilizing at low temperature under reduced pressure to obtain a conventional sequence DNA self-assembly product;

(5) electrophoretic analysis detection and laser scanning observation;

(6) measuring the potential;

(7) measuring the particle size;

(8) and (5) observing by using a transmission electron microscope.

Third, self-assembly experimental results

(1) Results of electrophoresis

The 2% agarose gel electrophoresis of the 7 sets of conventional sequence DNA self-assembly products is shown in FIG. 7. Lanes 1 to 7 in FIG. 7 are, from left to right: the self-assembly products of the conventional sequence DNA are D-1, D-2, D-3, D-4, D-5, D-6 and D-7.

The electrophoresis pattern of 4% agarose gel of the 7 sets of conventional sequence DNA self-assembly products is shown in FIG. 8. Lanes 1 to 7 in FIG. 8 are, from left to right: the self-assembly products of the conventional sequence DNA are D-1, D-2, D-3, D-4, D-5, D-6 and D-7.

The 2% agarose gel electrophoresis of the self-assembly products of the sequence DNAs from

groups

8 and 9 is shown in FIG. 9. The lanes in FIG. 9 are from right to left: the single strand of group 8 a, the DNA self-assembly products D-8 and D-9.

As can be seen from the results of FIG. 7, FIG. 8 and FIG. 9, it can be clearly seen that the bands of the 7 groups of conventional sequence DNA self-assembly products are bright and clear, indicating that the 7 groups of conventional sequence DNA strands complete the self-assembly and form a stable nanoparticle structure. Wherein, the two groups of self-assembly structures D-6 and D-7 carry EGFRatt or PSMAaptt target heads, the molecular weight is slightly lower, the position of the strip is obviously more ahead than that of other strips, the actual condition and the theoretical condition completely conform to each other, and the stability of the self-assembly structures is further proved.

This example shows that: when various functional extension fragments are added on the basis of different DNA core sequence combinations or are simultaneously connected with a target, the DNA nano-particles can be successfully assembled, and the DNA nano-particles also have the performances of drug loading, cell targeting, visual tracking and the like (see example 6 and example 8).

(2) Determination of potential

setting software detection parameters;

and (3) measuring results: the potential detection results of 3 groups of conventional sequence DNA nanoparticles are as follows:

table 37:

table 38:

table 39:

from the potential detection data described above, it can be seen that: the 3 groups of conventional sequence RNA self-assembly products have good stability, and further show that the nanoparticles formed by self-assembly of the conventional sequence RNA have a stable self-assembly structure.

(3) Particle size measurement

1. Preparing a potential sample (a conventional sequence DNA self-assembly product D-7) and putting the potential sample into a sample cell, opening a sample cell cover of the instrument and putting the instrument into the sample cell;

2. opening software, clicking a menu, and displaying a manual measurement parameter setting dialog box;

3. setting software detection parameters;

4. then click on the ok setting, the measurement dialog appears, click Start starts, and the DLS measurements of the hydrodynamic size of self-assembled product D-7 result as follows:

table 40:

(4) observation results of transmission electron microscope

And (3) carrying out transmission electron microscope irradiation on the conventional sequence DNA self-assembly product D-7, and comprising the following steps:

1. taking a drop of sample to suspend on a 400-mesh carbon film-coated copper net, and keeping the temperature at room temperature for 1 minute;

2. sucking off liquid by using filter paper;

3. dyeing for 1 minute by using 2% uranium acetate;

4. sucking dry by filter paper, and drying at room temperature;

5. JEM-1400 was observed by 120kv using a transmission electron microscope and photographed.

The result is shown in FIG. 10, from which it is apparent that the product D-7 of the conventional sequence DNA self-assembly is an integral structure and can be clearly seen to have a T-shaped structure.

Example 5

Mitoxantrone mounting experiments

Carrying by a chemical method:

first, experimental material and experimental method

1. Experimental materials and reagents:

(1) the DNA nucleic acid nanoparticles D-8 (hereinafter referred to as DNAh nanoparticles) formed by self-assembly of the group 8 DNA sequences in example 4 were used for mounting, and the specific information is shown in example 4.

The preparation method of the DNAh nanoparticles was similar to example 1.

(2) DEPC water: biyun Tian.

(3) PBS buffer: cellgro.

(4) 4% Paraformaldehyde

(5) Mitoxantrone.

(6) Chloroform: and (4) carrying out north transformation.

(7) Anhydrous ethanol: and (4) carrying out north transformation.

2. The experimental method comprises the following steps:

(1) mitoxantrone (1.354 μmoL) was precisely weighed, dissolved in DEPC water (1.0mL) and PBS buffer (1.25mL), mixed with 4% paraformaldehyde aqueous solution (0.25mL) with cooling in an ice-water bath, and the mixture was mixed with DNAh nanoparticles (1mg, 33.84nmoL) and reacted at 4 ℃ for 72 hours in the dark.

(2) 10 mu L of the reaction solution is diluted by 10 times, and HPLC analysis is carried out by taking 50 mu M mitoxantrone aqueous solution and 310 ng/mu L DNAh nano-particles as controls and injecting samples with equal volume. The reaction conversion can be judged to be basically complete according to the peak area ratio of each component.

(3) The reaction mixture was extracted with chloroform (10mL x3), followed by addition of 25mL of absolute ethanol, mixing, and then sufficiently precipitating the product by keeping the mixture at 4 ℃ in the dark (4 hours). Centrifugation (4000/min) was carried out, the supernatant was transferred, and the solid product was washed again with ethanol (50mL), and the solvent was evaporated under reduced pressure at a low temperature to give mitoxantrone-DNAh particles as a blue solid product.

(4) And (3) calculating the mounting rate:

1. preparing a mitoxantrone-PBS standard solution with a known concentration: 2. mu.M, 4. mu.M, 6. mu.M, 8. mu.M, 10. mu.M, each 100 ul;

2. dissolving the mitoxantrone-DNAh particles in 100ul PBS;

3. placing the standard solution and mitoxantrone-DNAh particles in a PCR plate, heating at 85 deg.C for 5min, and cooling to room temperature;

4. measuring the absorbance of the mitoxantrone at 272nm by using a microplate reader, drawing a standard curve (see figure 11), and calculating the molar concentration of the mitoxantrone in the carried product;

5. measuring the absorbance of the DNA at the position of 260nm by using a spectrophotometer to obtain the mass concentration of DNAh particles in each sample;

6. and calculating the mounting rate according to the measured molar concentration of the mitoxantrone and the mass concentration of the DNAh particles.

The specific calculation process is as follows:

C_DNAh-1＝32.4ug/ml，M_DNAh≈39500，100ul；C_mitoxantrone-1＝9.8uM，100ul；

C_DNAh-2＝43.8ug/ml，M_DNAh≈39500，100ul；C_Mitoxantrone-2＝12.32uM，100ul；

The average value is taken to obtain the mitoxantrone-DNAh with the carrying rate of about 11.5, and each DNAh nano-particle carrier can carry about 75 mitoxantrone molecules.

In addition, on the basis of carrying mitoxantrone on the DNAh nanoparticles, carrying out secondary carrying of other small molecule drugs can be further performed according to the same method as carrying of mitoxantrone, for example, folic acid is further carried by the application to obtain DNA nanoparticles carrying two small molecule drugs of mitoxantrone and folic acid together, and carrying rates of the two drugs can be detected by referring to the method (numerical values are not shown).

Example 5 shows that the DNA nanoparticles with the extension segment, the targeting segment and the fluorescein all have the function of drug loading, and the small molecule drug mitoxantrone can be loaded in a covalent connection (paraformaldehyde-solvent covalent) mode and can also be loaded together with other small molecule drugs.

Example 6

Flow cytometry for detecting cell binding capacity of drug-loaded DNA nanoparticles

First, cell information (see Table 41 below)

Table 41:

secondly, the sample to be measured

Mitoxantrone targeted drug: DNAh-Biotin-EGFRatt-Cy 5-Mit; (the DNA nanoparticles were mounted in the same manner as in example 5).

Targeting fluorescent carrier: DNAh-Bio-EGFRApt-Cy5 (DNA nanoparticles provided in example 5).

Third, instrument, equipment and related reagent information (see tables 42 and 43)

Table 42:

name (R)	Brand	Goods number/model
			24-hole plate	Corning	3526
Centrifugal machine	Jingli	LD5-2B
			CO2 incubator	Thermo	3111
Microplate oscillator	QILINBEIER	QB-9001
			Microscope	Olympus	IX53
Multifunctional enzyme mark instrument	Bio Tek	Synergy H1
			Flow cytometer	ACEA	Novo Cyte

Table 43:

fourthly, an experimental method:

1) adjusting the cell state to logarithmic phase, changing the culture medium to a biotin-free and folic acid-free culture medium, and placing the culture medium in an incubator at 37 ℃ for overnight incubation;

2) dissolving a to-be-detected object, and preparing a to-be-detected object stock solution;

3) single cell suspensions were collected by digestion and counted, adjusting cell density to 2X10⁵ Planting 1 mL/hole into a 24-hole plate;

4) respectively adding the substances to be detected into corresponding cell holes, shaking and uniformly mixing the substances with the final concentration of 2 mu M;

5) the cell plate was incubated in an incubator at 37 ℃ for 16 hours;

6) after incubation, collecting cell suspension by trypsinization;

7) centrifuging to collect cell precipitate, and washing twice with PBS;

8) finally, 300 mu L PBS is used for resuspending the cell sediment, and the detection is carried out on a flow type machine; wherein, the detection channels of the fluorescent carrier and the mitoxantrone targeting drug are as follows: wavelength of excitation light: 488nm, emission light channel: 560 nm;

9) and (6) analyzing the data. The results of the analysis are shown in Table 44.

Table 44:

as can be seen from Table 44, the DNAh nanoparticles carrying the targeting peptide and the small molecule drug mitoxantrone had a high binding efficiency to cells, and it was clearly seen that they were efficiently bound to and internalized in human breast cancer cells MCF-7. Therefore, the mitoxantrone targeted drug DNAh-Biotin-EGFRatt-Cy 5-Mit has an application prospect in treating breast cancer.

Example 7

Detection of serum stability of DNAh-Bio-EGFRApt-Cy5-Mit nanoparticle

First, experimental material, reagent and equipment

1. Experimental materials:

a sample to be tested: DNAh-Biotin-EGFRApt-Cy5-Mit, concentration 1.8 mg/ml.

2. Experimental reagent:

6 XDNA sample buffer (TSJ010, engine biology), 100bp DNA molecular marker (TSJ010, engine biology); 10000 × SolarGelRed nucleic acid dye (E1020, solarbio); 8% non-denaturing polyacrylamide gel (self-formulated); 1 × TBE Buffer (No RNase) (self-mix); serum (FBS) (Excel); RPMI 1640 (GBICO).

Electrophoresis apparatus (PowerPac Basic, Bio-rad), vertical electrophoresis tank (Mini PROTEAN Tetra Cell, Bio-rad), decolorizing shaker (TS-3D, orbital shaker), gel imager (Tanon 3500, Tanon).

Second, Experimental methods

(1) And taking 6 mu L of DNAh-Biotin-EGFRatt-Cy 5-Mit nanoparticles, diluting the 6 mu L of the nanoparticles with 6 mu L of RPMI 1640 culture medium containing 10% serum, wherein the concentration of the diluted nanoparticles reaches 900 mu g/ml, respectively diluting 5 tubes, and diluting the diluted samples in a water bath at 37 ℃ for different times (0, 10min, 1h, 12h and 36 h).

(2) The treated sample is taken and mixed with 6 XDNA Loading Buffer, and the mixture is operated on ice and marked.

(3) 8% Native PAGE is taken, nanoparticle samples with different incubation times are coated with a gel, the loading amount is 20 mu L/hole/sample, and the program electrophoresis is set at 90-100V for 50 min.

(4) And after the electrophoresis is finished, dyeing, placing the mixture in a horizontal shaking table for 30min, and photographing for imaging.

Third, experimental results

The results of native PAGE gel electrophoresis are shown in FIG. 12. Wherein, 1 represents 0min, 2 represents 10min, 3 represents 1h, 4 represents 12h, and 5 represents 36 h. The target band of the DNAh-Bio-EGFRApt-Cy5-Mit nanoparticle is about 200bp, and as can be seen from FIG. 12, the DNAh-Bio-EGFRApt-Cy5-Mit nanoparticle is basically stable after being incubated at 37 ℃ for 36 h.

Example 8

Cytotoxicity of DNAh-Biotin-EGFRApt-Cy5-Mit nanoparticles in MCF-7 cells

Experimental materials and methods

1. Cell information (see Table 45)

Table 45:

2. sample to be tested (see Table 46)

Table 46:

3. consumables and equipment (see table 47):

table 47:

name (R)	Brand	Goods number/model
			96-well plate	Corning	3599
Centrifugal machine	Jingli	LD5-2B
			CO₂Culture box	Thermo	3111
Microplate oscillator	QILINBEIER	QB-9001
			Microscope	Olympus	IX53
Multifunctional enzyme mark instrument	Bio Tek	Synergy H1

4. Reagents (see table 48):

table 48:

II, an experimental method:

1) harvesting cells in logarithmic growth phase, taking a small amount of cells, and staining and counting the cells by trypan blue to ensure that the cell activity reaches more than 98%;

2) cell density was adjusted to 2.22X 10 with growth medium⁴/mL；

3) Planting 90 mu L/well cell suspension into a 96-well plate, wherein the number of cells in each well in the plate is 2000;

4) placing the planted cell plate in an incubator at 37 ℃ for overnight incubation;

5) compound was diluted 3.16-fold in gradient from 9 concentration points;

6) taking out the cell culture plate, adding 10 μ L/hole 10X concentration drug working solution into corresponding hole of the cell culture plate, making three multiple holes for each concentration, and obtaining the final action concentration of the drug shown in Table 49;

table 49:

7) placing the cell culture plate in an incubator for further incubation for 96 hours;

8) mixing CellTiter

Melting the AQueous One Solution reagent at room temperature for 90 minutes or melting the AQueous One Solution reagent in water bath at 37 ℃, and then balancing the AQueous One Solution reagent at room temperature for 30 minutes;

9) add 20. mu.L/well CellTiter to cell culture plates

An AQueous One Solution reagent;

10) placing the cell culture plate in an incubator at 37 ℃ and continuously incubating for 3 hours;

11) OD of each well in the cell plate was read with microplate reader₄₉₀A value;

12) and (4) processing and analyzing data.

And performing graphical processing on data by adopting GraphPad Prism 5.0 software. To calculate IC50, the data were subjected to an "S" shaped non-linear regression analysis to match the adapted dose-response curves. The viability was calculated as follows, and IC50 was automatically calculated in GraphPad Prism 5.0.

Cell viability (%) ═ (OD)_{Hole to be tested}–OD_{Blank control})/(OD_{Negative control}–OD_{Blank control})×100％。

Third, the experimental results (see Table 50, FIGS. 13 to 16)

Table 50:

as can be seen from Table 50 and FIGS. 13, 14, 15, and 16, for the MCF-7 cell line, compared with the pure DNAh targeting fluorescent carrier, both the small molecule drug mitoxantrone (Mit) and the DNAh drug-loaded particle DNAh-Bio-EGFRApt-Cy5-Mit are toxic to the MCF-7 cell.

Assembly of nucleic acid nanoparticles

Example 9

1, 7 groups of extended segment deformation + core short sequence RNA nano particle carriers:

(1)7 groups of three polynucleotide base sequences which form the RNA nano-particle with the extension segment deformation and the core short sequence:

table 51: r-15:

table 52: r-16:

table 53: r-17:

table 54: r-18:

table 55: r-19:

table 56: r-20:

table 57: r-21:

II, self-assembly testing:

(5) electrophoresis analysis detection and laser scanning observation.

Third, self-assembly test results

(1) Electrophoretic detection

The main reagents and instruments were as follows:

table 58:

name of reagent	Goods number	Manufacturer of the product
			6×DNA Loading buffer	TSJ010	Organisms of Onychidae
20bp DNA Ladder	3420A	TAKARA
			10000 SolarGelRed nucleic acid dye	E1020	solarbio
8% non-denaturing PAGE gel	/	Self-matching
			1 × TBE Buffer (No RNAse)	/	Self-matching

Table 59:

the method comprises the following steps:

① the RNA nanoparticles were diluted with ultrapure water according to the method of Table 60 below.

Table 60:

	measured concentration (μ g/mL)
		R-15	165.937
R-16	131.706
		R-17	144.649
R-18	164.743
		R-19	126.377
R-20	172.686
		R-21	169.455

② mu.L (500ng) of the treated sample was mixed with 2. mu.L of 6 XDNA Loading Buffer, and the mixture was marked by ice-washing.

③ samples were run on 8% native PAGE gels at different incubation times and 12. mu.L of the treated samples were loaded in their entirety and programmed for 40min at 100V.

④ after the glue running, dyeing, placing on a horizontal shaking table for 30min, and taking pictures.

And (3) detection results:

the results of the native PAGE running gel of 7 sets of extended stretch-deformed + core short sequence RNA self-assembled products are shown in FIG. 17. Lanes 1 to 7 in FIG. 17 are, from left to right: 7 groups of extension segment deformation + core short sequence RNA self-assembly products R-15, R-16, R-17, R-18, R-19, R-20 and R-21.

The results in fig. 17 clearly show that the bands of the 7 sets of RNA self-assembly products with the modified long segment and the short core sequence are bright and clear, which indicates that the 7 sets of RNA strands with the modified long segment and the short core sequence complete the self-assembly and form a stable nanoparticle structure.

(2) Determination of potential

setting software detection parameters;

and (3) measuring results: the potential detection results at 25 ℃ of 7 groups of extension segment deformation and core short sequence RNA nanoparticles are as follows:

table 61:

table 62:

table 63:

table 64:

table 65:

table 66:

table 67:

from the potential detection data described above, it can be seen that: the 7 groups of the extended segment deformation and core short sequence RNA nanoparticles have good stability, and further show that the nanoparticles formed by self-assembly of the extended segment deformation and the core short sequence RNA have a stable self-assembly structure.

(3) Particle size measurement

1. Preparing a potential sample (7 groups of extension sections and core short sequence RNA) and putting the potential sample into a sample cell, opening a sample cell cover of the instrument and putting the instrument into the sample cell;

3. setting software detection parameters;

4. then click on the confirmed setting, a measurement dialog box appears, and Start is clicked, and the results of DLS measurement values of hydrodynamic sizes of 7 groups of extended stretch variants + core short sequence RNAs are as follows:

table 68:

	average particle diameter (nm)
		R-15	6.808
R-16	6.978
		R-17	7.592
R-18	7.520
		R-19	6.936
R-20	7.110
		R-21	6.720

(4) TM value detection

And (3) detecting the TM values of the 7 groups of the extended section deformation and core short sequence RNA nanoparticles by adopting a dissolution curve method, wherein the sample is consistent with the potential sample.

Reagents and instrumentation were as follows:

table 69:

name of reagent	Goods number	Manufacturer of the product
			AE buffer	/	Takara
SYBR Green I dyes	/	Self-matching

Table 70:

name (R)	Model number	Manufacturer of the product
			Real-Time System	CFX Connect	Bio-rad
Super clean bench	HDL	Beijing Dong gang haar Instrument manufacturing Co., Ltd

The method comprises the following steps:

① samples were diluted with ultrapure water, and 5. mu.g of the diluted sample was mixed with 2. mu.L of SYBR Green I dye (1: 200 dilution) to give a final volume of 20. mu.L, at the following dilution concentrations:

table 71:

② incubating at room temperature in dark for 30 min;

③ the detection is carried out on a computer, and the program is set to 20 ℃ for starting, the temperature is increased to 0.1-95 ℃ per second, and the reading is carried out once every 5 s.

And (3) detection results:

the TM values of 7 sets of extended stretch modified + core short sequence RNA nanoparticles are shown in the following, wherein the dissolution curve of R-15 is shown in FIG. 18, the dissolution curve of R-16 is shown in FIG. 19, the dissolution curve of R-17 is shown in FIG. 20, the dissolution curve of R-18 is shown in FIG. 21, the dissolution curve of R-19 is shown in FIG. 22, the dissolution curve of R-20 is shown in FIG. 23, and the dissolution curve of R-21 is shown in FIG. 24. Because of the specificity of the RNA sample, the temperature corresponding to 1/2RFUmax within the range of 20-90 ℃ is taken as the Tm value of the sample in the detection.

Table 72:

	TM value (. degree. C.)
		R-15	57.5℃
R-16	53.8℃
		R-17	55.2℃
R-18	54.5℃
		R-19	54.0℃
R-20	59.5℃
		R-21	65.0℃

The TM values of 7 groups of extension segment deformation and core short sequence RNA nanoparticles are higher, which indicates that the self-assembly product has good structural stability.

Example 10

1, 7 groups of extension segment deformation + core short sequence DNA nano particle carriers:

(1)7 groups of three polynucleotide base sequences which form the extension segment deformation + core short sequence DNA nano-particles:

table 73: d-8:

table 74: d-9:

table 75: d-10:

table 76: d-11:

table 77: d-12:

table 78: d-13:

table 79: d-14:

II, self-assembly testing:

(4) cutting off a target band, eluting in a DNA elution buffer solution at 37 ℃, precipitating with ethanol overnight, and volatilizing at low temperature under reduced pressure to obtain a DNA self-assembly product;

(5) electrophoretic analysis detection and laser scanning observation;

(6) detecting the potential;

(7) detecting the particle size;

(8) and (5) detecting a TM value.

Third, self-assembly test results

(1) Electrophoretic detection

The main reagents and instruments were as follows:

table 80:

Table 81:

the method comprises the following steps:

① the DNA nanoparticles were diluted with ultrapure water according to the method of the following Table 82.

Table 82:

And (3) detection results:

the results of the native PAGE running gel of 7 sets of extended stretch-deformed + core short sequence DNA self-assembled products are shown in FIG. 25. Lanes 1 to 7 in FIG. 25 are, from left to right: 7 groups of extension segment deformation + core short sequence DNA self-assembly products D-8, D-9, D-10, D-11, D-12, D-13 and D-14.

The results in fig. 25 clearly show that the bands of the 7 sets of the products of the self-assembly of the DNA with the extended segment and the core short sequence are bright and clear, which indicates that the 7 sets of the DNA chains with the extended segment and the core short sequence complete the self-assembly and form a stable nanoparticle structure.

(2) Determination of potential

setting software detection parameters;

and (3) measuring results: the potential detection results at 25 ℃ of 7 groups of extension segment deformation and core short sequence DNA nanoparticles are as follows:

table 83:

table 84:

table 85:

table 86:

table 87:

table 88:

table 89:

from the potential detection data described above, it can be seen that: the 7 groups of the extended section deformation and core short sequence DNA nano-particles have good stability, and further show that the nano-particles formed by self-assembly of the extended section deformation and the core short sequence DNA have a stable self-assembly structure.

(3) Particle size measurement

① preparing potential samples (7 groups of extension segment deformation + core short sequence DNA) to be placed in the sample cell, opening the sample cell cover of the instrument, and placing the instrument;

② opens the software, clicks the menu, and a manual measurement parameter setting dialog box appears;

③ setting software detection parameters;

④ click ok setting, appear measurement dialog, click Start, DLS measurements of hydrodynamic size of 7 sets of extended stretch variants + core short sequence RNA result as follows:

table 90:

	average particle diameter (nm)
		D-8	7.460
D-9	7.920
		D-10	7.220
D-11	7.472
		D-12	6.968
D-13	7.012
		D-14	6.896

(4) TM value detection

And (3) detecting the TM values of the 7 groups of extension segment deformation and core short sequence DNA nano-particles by adopting a dissolution curve method, wherein the sample is consistent with the potential sample.

Reagents and instrumentation were as follows:

table 91:

Table 92:

The method comprises the following steps:

② samples were diluted with ultrapure water, and 5. mu.g of the diluted sample was mixed with 2. mu.L of SYBR Green I dye (1: 200 dilution) to give a final volume of 20. mu.L, at the following dilution concentrations:

table 93:

② incubating at room temperature in dark for 30 min;

And (3) detection results:

the TM values of 7 sets of extended stretch modified + core short sequence DNA nanoparticles are shown in the following, the dissolution profile of D-8 is shown in FIG. 26, the dissolution profile of D-9 is shown in FIG. 27, the dissolution profile of D-10 is shown in FIG. 28, the dissolution profile of D-11 is shown in FIG. 29, the dissolution profile of D-12 is shown in FIG. 30, the dissolution profile of D-13 is shown in FIG. 31, and the dissolution profile of D-14 is shown in FIG. 32.

Table 94:

	TM value (. degree. C.)
		D-8	48.5
D-9	52.5
		D-10	54.5～55.0
D-11	48.7
		D-12	51.5
D-13	51.0
		D-14	49.2

As can be seen from the dissolution curves of the 7 sets of extended length modified + core short sequence DNA nanoparticles shown in FIGS. 26 to 32, the TM values are all high, indicating that the sample purity is high and the self-assembly structure is stable.

Detecting stability of nucleic acid nanoparticles in serum

Example 11

The stability of 7 groups of extended segment deformation + core short sequence RNA nanoparticles in serum is characterized by adopting a non-denaturing PAGE method.

The main reagents and instruments were as follows:

table 95:

name of reagent	Goods number	Manufacturer of the product
			6×DNA Loading buffer	TSJ010	Organisms of Onychidae
20bp DNA Ladder	3420A	TAKARA
			10000 SolarGelRed nucleic acid dye	E1020	solarbio
8% non-denaturing PAGE gel	/	Self-matching
			1 × TBE Buffer (No RNAse)	/	Self-matching
Serum (FBS)	/	Excel
			RPMI 1640	/	GBICO

Table 96:

the method comprises the following steps:

① preparing RNA nano particles to the concentration shown in the table below, diluting the prepared sample by the method shown in the table below, diluting the sample by 5 tubes, and carrying out water bath on the diluted sample at 37 ℃ for different time (0, 10min, 1h, 12h and 36 h);

table 97:

② mixing 10 μ L of the treated sample with 2 μ L of 6 × DNA Loading Buffer, and labeling on ice;

③ taking 8% non-denaturing PAGE gel, applying a piece of gel to samples with different incubation times, completely applying 12 μ L of the treated samples, and setting the program to 100V for gel running for 40 min;

④ after the gum running, dyeing, placing on a horizontal shaking table, slowly shaking for 30min, and taking pictures.

The electrophoresis detection result of R-15 is shown in FIG. 33, the electrophoresis detection result of R-16 is shown in FIG. 34, the electrophoresis detection result of R-17 is shown in FIG. 35, the electrophoresis detection result of R-18 is shown in FIG. 36, the electrophoresis detection result of R-19 is shown in FIG. 37, the electrophoresis detection result of R-20 is shown in FIG. 38, and the electrophoresis detection result of R-21 is shown in FIG. 39. In fig. 33 to 39, lanes from left to right are M: marker; 1: 36 h; 2: 12 h; 3: 1 h; 4: 10 min; 5: and 0 min. From the results of the serum stability test, it can be seen that: the non-denatured gel fruits of 10min, 1h, 12h and 36h show that there is no obvious difference in the RNA nanoparticle sample bands at different times, which indicates that the RNA nanoparticles R-15 to R-21 are relatively stable in 1640 medium of 50% FBS without obvious degradation.

Example 12

The stability of 7 groups of extended length modified + core short sequence DNA nanoparticles in serum was characterized by non-denaturing PAGE.

The main reagents and instruments were as follows:

table 98:

Table 99:

the method comprises the following steps:

② preparing DNA nanoparticles to the concentrations shown in the following table, diluting the prepared samples according to the method shown in the following table, diluting the samples by 5 tubes, and carrying out water bath on the diluted samples at 37 ℃ for different times (0, 10min, 1h, 12h and 36 h);

table 100:

② mixing 5 μ L of the treated sample with 1 μ L of 6 × DNA Loading Buffer, and labeling on ice;

③ taking 8% non-denaturing PAGE gel, applying a piece of gel to samples with different incubation times, applying 6 μ L of the treated samples, and setting the program to 100V for gel running for 40 min;

The electrophoresis detection result of D-8 is shown in FIG. 40, the electrophoresis detection result of D-9 is shown in FIG. 41, the electrophoresis detection result of D-10 is shown in FIG. 42, the electrophoresis detection result of D-11 is shown in FIG. 43, the electrophoresis detection result of D-12 is shown in FIG. 44, the electrophoresis detection result of D-13 is shown in FIG. 45, and the electrophoresis detection result of D-14 is shown in FIG. 46. In fig. 40 to 46, lanes from left to right are M: marker; 1: 36 h; 2: 12 h; 3: 1 h; 4: 10 min; 5: and 0 min. From the results of the serum stability test, it can be seen that: the 10min, 1h, 12h and 36h non-denatured gel fruits showed no significant difference in the bands of the DNA nanoparticle samples at different times, indicating that the DNA nanoparticles D-8 to D-14 were relatively stable in 1640 medium with 50% FBS and had no significant degradation.

Nucleic acid nanoparticle-carried drug assay

Example 13

Doxorubicin mounting experiment:

according to the chemical method of example 5 (except for special limitation, the method is the same as example 5), RNA nanoparticles formed by self-assembly of R-15, R-16, R-17, R-18, R-19, R-20 and R-21 in the previous example 9, and DNA nanoparticles formed by self-assembly of D-8, D-9, D-10, D-11, D-12, D-13 and D-14 in example 10 were used as doxorubicin-carrying carriers, and the doxorubicin-carrying rates were respectively measured as follows:

the adriamycin loading rate of the RNA nano-particle R-15 is 20.5;

the adriamycin loading rate of the RNA nano-particle R-16 is 29.4;

the adriamycin loading rate of the RNA nano-particle R-17 is 30.9;

the adriamycin loading rate of the RNA nano-particle R-18 is 34.1;

the adriamycin loading rate of the RNA nano-particle R-19 is 27.1;

the adriamycin loading rate of the RNA nano-particle R-20 is 30.2;

the adriamycin loading rate of the RNA nano-particle R-21 is 20.1;

the adriamycin loading rate of the DNA nano-particle D-8 is 28.0;

the adriamycin loading rate of the DNA nano-particle D-9 is 27.9;

the adriamycin loading rate of the DNA nano-particle D-10 is 18.9;

the adriamycin loading rate of the DNA nano-particle D-11 is 26.8;

the adriamycin loading rate of the DNA nano-particle D-12 is 27.6;

the adriamycin loading rate of the DNA nano-particle D-13 is 31.8;

the adriamycin loading rate of the DNA nanoparticle D-14 was 32.

Flow cytometry (FACS) experiment for detecting cell binding capacity of DNA nanoparticles and carrier drug

Example 14

First, cell information

HepG2 (Source synergy cell bank), DMEM + 10% FBS + 1% double antibody (gibco, 15140-122), culture conditions at 37 ℃ and 5% CO₂And saturation humidity.

Second, the object to be measured

Blank vector: d-8, D-9, D-10, D-11, D-12, D-13 and D-14 in the aforementioned example 10 were self-assembled to form DNA nanoparticle carriers.

Carrier drug: according to the chemical method of example 5 (except for special limitation, the method is the same as example 5), the DNA nanoparticles formed by self-assembly of D-8, D-9, D-10, D-11, D-12, D-13 and D-14 in the previous example 10 are used to carry doxorubicin, which is respectively marked as D-8-doxorubicin, D-9-doxorubicin, D-10-doxorubicin, D-11-doxorubicin, D-12-doxorubicin, D-13-doxorubicin and D-14-doxorubicin.

Third, main equipment, consumable

Table 101:

four, main reagent

Table 102:

name of reagent	Manufacturer of the product	Goods number	Remarks for note
				DMEM (Biotin free)	Providing all the drugs Zhida	YS3160
1％BSA-PBS	Self-matching	－

And fifthly, an experimental method:

1. adjusting the cell state to logarithmic phase, changing the culture medium to a biotin-free and folic acid-free culture medium, and placing the culture medium in an incubator at 37 ℃ for overnight incubation;

2. after incubation, cell suspension was collected by trypsinization, centrifuged at 1000rmp for 5min, adjusted in concentration, and 2X10 cells were collected⁵-5×10⁵cells/EP tube, wash 2 times with 1 mL/tube of 1% BSA-PBS, and observe the tube bottom cells to prevent aspiration.

3. Dissolving the object to be tested, and diluting the object to be tested to the use concentration;

4. completely sucking cell supernatant, sequentially adding 100 mu L of corresponding samples into each tube, keeping out of the sun, and incubating for 2h at 37 ℃;

5. washed 2 times with 1% BSA-PBS; centrifuging at 1000rmp for 5 min;

6. finally, resuspending the cell pellet with 300. mu.L PBS and detecting it on flow machine (the blank vector used in this example was labeled by Quasar670, whereas doxorubicin in the vector drug was self-fluorescent and thus could be detected by FL4-APC and FL2-PE, respectively);

7. and (6) analyzing the data.

Sixth, experimental results

1. The results of the experiment are shown in the following table:

table 103:

2. conclusion

After incubation of HepG2 cells with D-8-adriamycin (vector medicine) and D-8 (blank vector), the binding rate is very high (93.1% -98.4%).

After incubation of HepG2 cells with D-9-adriamycin (vector drug) and D-9 (blank vector), the binding rate is very high (88.6% -98.1%).

After incubation of HepG2 cells with D-10-adriamycin (vector drug) and D-10 (blank vector), the binding rate is high (89.4% -98.3%).

After incubation of HepG2 cells with D-11-adriamycin (vector medicine) and D-11 (blank vector), the binding rate is high (89.3% -97.8%).

After incubation of HepG2 cells with D-12-adriamycin (vector drug) and D-12 (blank vector), the binding rate is very high (94.6% -97.1%).

After incubation of HepG2 cells with D-13-adriamycin (vector drug) and D-13 (blank vector), the binding rate is high (89.6% -98.2%).

After incubation of HepG2 cells with D-14-adriamycin (vector drug) and D-14 (blank vector), the binding rate is very high (90.3% -98.3%).

Study of cytotoxicity of DNA nanoparticles and vector drugs in HepG2 cells

Example 15

The toxicity of the DNA nanoparticles and the carrier drug to HepG2 is detected by a CCK8 method.

First, main reagent

Table 104:

name of reagent	Manufacturer of the product	Goods number
			PBS	－	－
DMSO	SIGMA	D2650
			DMEM (Biotin free)	Providing all the drugs Zhida	YS3160
FBS	Excell Bio	FSP500
			Double antibody	gibco	15140-122
Pancreatin	gibco	25200-056
			CCK8 kit	Biyuntian (a Chinese character)	C0038

Second, main consumables and instrument

Table 105:

information on cells

Fourth, experimental materials

1. Sample to be tested

Blank vector: the DNA nanoparticle carriers formed by self-assembly of D-8, D-9, D-10, D-11, D-12, D-13 and D-14 in the foregoing example 10 are respectively denoted as: d-8, D-9, D-10, D-11, D-12, D-13 and D-14.

The original drug substance doxorubicin.

DMSO。

Fifth, the experimental procedure

1.HepG2 cells were harvested in the logarithmic growth phase, the Cell viability was 98.3% by trypan blue staining, and the cells were plated at 5000 cells/well in a volume of 100. mu.L/well in 8 96-well plates, 57 wells per plate, and incubated overnight at 37 ℃.

2. The samples to be tested were diluted and added as follows: removing original culture medium, adding 100 μ L culture medium of samples to be tested with different concentrations, and repeating each group for 3 multiple wells.

Table 106:

number of holes

C9

C8

C7

C6

C5

C4

C3

C2

C1

Final concentration of drug loaded

10μM

3.16μM

1μM

316nM

100nM

31.6nM

10nM

3.16nM

1nM

Final concentration of empty vector

1μM

316nM

100nM

31.6nM

10nM

3.16nM

1nM

0.316nM

0.1nM

Final concentration of parent doxorubicin

10μM

3.16μM

1μM

316nM

100nM

31.6nM

10nM

3.16nM

1nM

DMSO(％)

0.1

0.0316

0.01

0.00316

0.001

0.00036

0.0001

0.000036

0.00001

In this example, the drug-loaded and blank vehicles were each prepared as 100 μ M stock solutions in PBS and then diluted in complete medium (no biotin DMEM). The original doxorubicin was first prepared with DMSO as 100 μ M stock solution and then diluted with complete medium (no biotin DMEM). DMSO was directly diluted with complete medium (biotin-free DMEM).

3. Adding a sample to be detected, and putting a 96-well plate into 5% CO at 37 DEG C₂Incubate in incubator for 72 h.

4. The kit was removed and thawed at room temperature, and 10. mu.L of CCK-8 solution was added to each well, or CCK8 solution was mixed with the medium at a ratio of 1:9 and then added to the wells at a rate of 100. mu.L/well.

5. The incubation is continued for 4h in the cell culture box, and the time is determined according to the experimental conditions such as the type of the cells, the density of the cells and the like.

6. Absorbance was measured at 450nm with a microplate reader.

7. And (3) calculating: cell viability (%) (OD experimental-OD blank) × 100%/(OD control-OD blank), IC calculated from GraphPad Prism 5.0₅₀。

Sixth, experimental results

Table 107:

and (4) conclusion:

as can be seen from the above table and FIGS. 47a, 47b, 47c, 47D, 47e, 47f, 47g, and 47h, the IC of the drug doxorubicin and the drug-loaded D-8-doxorubicin, D-9-doxorubicin, D-10-doxorubicin, D-11-doxorubicin, D-12-doxorubicin, D-13-doxorubicin, and D-14-doxorubicin acting on HepG2 cells₅₀0.2725. mu.M, 0.05087. mu.M, 0.0386, 0.03955, 0.04271, 0.02294, 0.03017 and 0.03458, respectively; IC of DMSO on HepG2 cells₅₀Is composed of>0.1 percent; IC of HepG2 cells acted on by D-8 (blank vector), D-9 (blank vector), D-10 (blank vector), D-11 (blank vector), D-12 (blank vector), D-13 (blank vector) and D-14 (blank vector)₅₀Are all made of>1 μ M. It shows that compared with the pure blank vectors of D-8, D-9, D-10, D-11, D-12, D-13 and D-14, the original drug adriamycin of the small molecular drug and the drug-carrying D-8-adriamycin, D-9-adriamycin, D-10-adriamycin, D-11-adriamycin, D-12-adriamycin, D-13-adriamycin and D-14-adriamycin are toxic to HepG2 cells of HepG2 cell line, and the carried medicines of D-8-adriamycin, D-9-adriamycin, D-10-adriamycin, D-11-adriamycin, D-12-adriamycin, D-13-adriamycin and D-14-adriamycin have obvious synergistic effect compared with the original medicine of adriamycin.

Example 16

According to the chemical method of the mounting method of example 5 (except for special limitation, the method is the same as example 5), the DNA nanoparticles formed by self-assembly of D-10 and D-14 in the previous example 10 were used as the daunorubicin mounting carrier. The absorbance of daunorubicin at 492nm was measured using a microplate reader, and a standard curve was plotted (as shown in FIG. 48).

The daunorubicin carrying rates are respectively measured as follows:

the daunorubicin loading rate of the DNA nano-particles D-10 is 24.0;

the daunorubicin loading rate of the DNA nanoparticle D-14 was 25.1.

From the above description, it can be seen that the above-described embodiments of the present application achieve the following technical effects: the present application provides a series of nucleic acid nanoparticle carriers with thermodynamic stability, chemical stability, high loading rate, and that can be combined with multiple modules. The carrier is subjected to unique modular design, so that a core module structure which not only maintains natural compatible affinity, but also has high stable property and various combination characteristics is obtained. The structure can flexibly and efficiently integrate various functional modules, including a targeting module, an imaging and probe module, a treatment module and other composite intelligent modules, so that the structure can be used for targeting delivery in vivo and realizing accurate diagnosis and treatment.

The mitoxantrone-containing drug is formed by hanging a small-molecule drug mitoxantrone on the nucleic acid nanoparticle carrier provided by the application, so that the delivery stability of the mitoxantrone can be improved, and under the condition that the nucleic acid nanoparticle carries a target head, the mitoxantrone can be delivered to target cells in a targeted manner to improve the bioavailability of the drug, and the toxic and side effects on non-target cells or tissues are reduced, the local drug concentration is reduced, and the toxic and side effects caused by high drug concentration are further reduced.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Baiyazhida (Beijing) NanoBiotechnology Ltd

<120> mitoxantrone-containing medicine, preparation method, pharmaceutical composition and application thereof

<130>PN114941BYZD

<141>2019-09-30

<150>201811204164.0

<151>2018-10-17

<160>180

<170>SIPOSequenceListing 1.0

<210>1

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a1 sequence

<400>1

ccagcguucc 10

<210>2

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>mRNA

<222>(1)..(10)

<223> a1 sequence

<400>2

ccagcgttcc 10

<210>3

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b1 sequence

<400>3

gguucgccg 9

<210>4

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b1 sequence

<400>4

ggttcgccg 9

<210>5

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c1 sequence

<400>5

cggccauagc gg 12

<210>6

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c1 sequence

<400>6

cggccatagc gg 12

<210>7

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>7

ggagcguugg 10

<210>8

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>8

ccuucgccg 9

<210>9

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>9

cggccauagc cc 12

<210>10

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>10

gcagcguucg 10

<210>11

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>11

cguucgccg 9

<210>12

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>12

cggccauagc gc 12

<210>13

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>13

cgagcguugc 10

<210>14

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>14

gcuucgccg 9

<210>15

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>15

cggccauagc cg 12

<210>16

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>16

ggagcguugg 10

<210>17

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>17

ccuucgggg 9

<210>18

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>18

cccccauagc cc 12

<210>19

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>19

gcagcguucg 10

<210>20

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>20

cguucggcg 9

<210>21

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>21

cgcccauagc gc 12

<210>22

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>22

gcagcguucg 10

<210>23

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>23

cguucggcc 9

<210>24

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>24

ggcccauagc gc 12

<210>25

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>25

cgagcguugc 10

<210>26

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>26

gcuucggcg 9

<210>27

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>27

cgcccauagc cg 12

<210>28

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>28

ggagcgttgg 10

<210>29

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>29

ccttcgccg 9

<210>30

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>30

cggccatagc cc 12

<210>31

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>31

gcagcgttcg 10

<210>32

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>32

cgttcgccg 9

<210>33

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>33

cggccatagc gc 12

<210>34

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>34

cgagcgttgc 10

<210>35

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>35

gcttcgccg 9

<210>36

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>36

cggccatagc cg 12

<210>37

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>37

ggagcgttgg 10

<210>38

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>38

ccttcgggg 9

<210>39

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>39

cccccatagc cc 12

<210>40

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>40

gcagcgttcg 10

<210>41

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>41

cgttcggcg 9

<210>42

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>42

cgcccatagc gc 12

<210>43

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>43

gcagcgttcg 10

<210>44

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>44

cgttcggcc 9

<210>45

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>45

ggcccatagc gc 12

<210>46

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>46

cgagcgttgc 10

<210>47

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>47

gcttcggcg 9

<210>48

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>48

cgcccatagc cg 12

<210>49

<211>77

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(77)

<223> a sequence

<220>

<221>misc_feature

<222>(1)..(77)

<223> wherein M is U or T

<400>49

cgcgcgaaaa aacgcgcgaa aaaacgcgcg cccaccagcg mmccgggcgc gcgaaaaaac 60

gcgcgaaaaa acgcgcg 77

<210>50

<211>75

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(75)

<223> b sequence

<220>

<221>misc_feature

<222>(1)..(75)

<223> wherein M is U or T

<400>50

cgcgcgmmmm mmcgcgcgmm mmmmcgcgcg cccggmmcgc cgccagccgc cmmmmmmgcc 60

gccmmmmmmg ccgcc 75

<210>51

<211>78

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(78)

<223> c sequence

<220>

<221>misc_feature

<222>(1)..(78)

<223> wherein M is U or T

<400>51

ggcggcaaaa aaggcggcaa aaaaggcggc aggcggcama gcggmgggcg cgcgmmmmmm 60

cgcgcgmmmm mmcgcgcg 78

<210>52

<211>29

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(29)

<223> a chain

<220>

<221>modified_base

<222>(1)..(1)

<223>5'Biotin

<400>52

cgcgcgccca ccagcguucc gggcgccgc 29

<210>53

<211>27

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<220>

<221>modified_base

<222>(1)..(1)

<223>5'Biotin

<400>53

gcggcgcccg guucgccgcc aggcggc 27

<210>54

<211>31

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<220>

<221>modified_base

<222>(1)..(1)

<223>5'CY3

<400>54

gccgccaggc ggccauagcg gugggcgcgc g 31

<210>55

<211>10

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a chain

<400>55

ggagcguugg 10

<210>56

<211>9

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b chain

<400>56

ccuucgccg 9

<210>57

<211>12

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c chain

<400>57

cggccauagc cc 12

<210>58

<211>10

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a chain

<400>58

gcagcguucg 10

<210>59

<211>9

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b chain

<400>59

cguucgccg 9

<210>60

<211>12

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c chain

<400>60

cggccauagc gc 12

<210>61

<211>10

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a chain

<400>61

cgagcguugc 10

<210>62

<211>9

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b chain

<400>62

gcuucgccg 9

<210>63

<211>12

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c chain

<400>63

cggccauagc cg 12

<210>64

<211>10

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a chain

<400>64

ggagcguugg 10

<210>65

<211>9

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b chain

<400>65

ccuucgggg 9

<210>66

<211>12

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c chain

<400>66

cccccauagc cc 12

<210>67

<211>10

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a chain

<400>67

gcagcguucg 10

<210>68

<211>9

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b chain

<400>68

cguucggcg 9

<210>69

<211>12

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c chain

<400>69

cgcccauagc gc 12

<210>70

<211>10

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a chain

<400>70

gcagcguucg 10

<210>71

<211>9

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b chain

<400>71

cguucggcc 9

<210>72

<211>12

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c chain

<400>72

ggcccauagc gc 12

<210>73

<211>10

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a chain

<400>73

cgagcguugc 10

<210>74

<211>9

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b chain

<400>74

gcuucggcg 9

<210>75

<211>12

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c chain

<400>75

cgcccauagc cg 12

<210>76

<211>29

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(29)

<223> a chain

<400>76

cgcgcgccca ggagcguugg cgggcggcg 29

<210>77

<211>27

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<400>77

cgccgcccgc cuucgccgcc agccgcc 27

<210>78

<211>31

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<400>78

ggcggcaggc ggccauagcc cugggcgcgc g 31

<210>79

<211>29

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(29)

<223> a chain

<400>79

cgcgcgccca gcagcguucg cgggcggcg 29

<210>80

<211>27

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<400>80

cgccgcccgc guucgccgcc agccgcc 27

<210>81

<211>31

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<400>81

ggcggcaggc ggccauagcg cugggcgcgc g 31

<210>82

<211>29

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(29)

<223> a chain

<400>82

cgcgcgccca cgagcguugc ggggcggcg 29

<210>83

<211>27

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<400>83

cgccgccccg cuucgccgcc agccgcc 27

<210>84

<211>31

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<400>84

ggcggcaggc ggccauagcc gugggcgcgc g 31

<210>85

<211>29

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(29)

<223> a chain

<400>85

cgcgcgccca ggagcguugg cccgcggcg 29

<210>86

<211>27

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<400>86

cgccgcgggc cuucggggcc agccgcc 27

<210>87

<211>31

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<400>87

ggcggcaggc ccccauagcc cugggcgcgc g 31

<210>88

<211>29

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(29)

<223> a chain

<400>88

cgcgcgccca gcagcguucg ccccgccgc 29

<210>89

<211>27

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<400>89

gcggcggggc guucggcggc aggcggc 27

<210>90

<211>31

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<400>90

gccgccagcc gcccauagcg cugggcgcgc g 31

<210>91

<211>29

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(29)

<223> a chain

<400>91

cgcgcgccca gcagcguucg gggcgccgc 29

<210>92

<211>28

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(28)

<223> b chain

<400>92

gcggcgcccc guucggccgg caggcggc 28

<210>93

<211>32

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(32)

<223> c chain

<400>93

gccgccagcc ggcccauagc gcugggcgcg cg 32

<210>94

<211>40

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(40)

<223> a chain

<400>94

cgcgcgcgag cguugcaaug acagauaagg aaccugcutt 40

<210>95

<211>36

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(36)

<223> b chain

<400>95

ggcagguucc uuaucuguca aagcuucggc ggcagc 36

<210>96

<211>23

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(23)

<223> c chain

<400>96

gcagccgccc auagccgcgc gcg 23

<210>97

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(39)

<223>EGFRapt

<400>97

gccttagtaa cgtgctttga tgtcgattcg acaggaggc 39

<210>98

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(41)

<223>PSMAapt

<400>98

gggccgaaaa agacctgact tctatactaa gtctacgtcc c 41

<210>99

<211>68

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(68)

<223> a chain

<400>99

cgcgcgccca ggagcgttgg cgggcggcgg ccttagtaac gtgctttgat gtcgattcga 60

caggaggc 68

<210>100

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<400>100

cgccgcccgc cttcgccgcc agccgcc 27

<210>101

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<400>101

ggcggcaggc ggccatagcc ctgggcgcgc g 31

<210>102

<211>68

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(68)

<223> a chain

<400>102

cgcgcgccca gcagcgttcg cgggcggcgg ccttagtaac gtgctttgat gtcgattcga 60

caggaggc 68

<210>103

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<400>103

cgccgcccgc gttcgccgcc agccgcc 27

<210>104

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<400>104

ggcggcaggc ggccatagcg ctgggcgcgc g 31

<210>105

<211>68

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(68)

<223> a chain

<400>105

cgcgcgccca cgagcgttgc ggggcggcgg ccttagtaac gtgctttgat gtcgattcga 60

caggaggc 68

<210>106

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<400>106

cgccgccccg cttcgccgcc agccgcc 27

<210>107

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<400>107

ggcggcaggc ggccatagcc gtgggcgcgc g 31

<210>108

<211>71

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(71)

<223> a chain

<400>108

cgcgcgccca ggagcgttgg cccgcggcgt gggccgaaaa agacctgact tctatactaa 60

gtctacgtcc c 71

<210>109

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<400>109

cgccgcgggc cttcggggcc agccgcc 27

<210>110

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<400>110

ggcggcaggc ccccatagcc ctgggcgcgc g 31

<210>111

<211>71

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(71)

<223> a chain

<400>111

cgcgcgccca gcagcgttcg ccccgccgct gggccgaaaa agacctgact tctatactaa 60

gtctacgtcc c 71

<210>112

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<400>112

gcggcggggc gttcggcggc aggcggc 27

<210>113

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<400>113

gccgccagcc gcccatagcg ctgggcgcgc g 31

<210>114

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(29)

<223> a chain

<400>114

cgcgcgccca gcagcgttcg gggcgccgc 29

<210>115

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(20)

<223> b chain

<400>115

gcggcgcccc gttcggccgg caggcggc 28

<210>116

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(32)

<223> c chain

<400>116

gccgccagcc ggcccatagc gctgggcgcg cg 32

<210>117

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(29)

<223> a chain

<400>117

cgcgcgccca cgagcgttgc gggcgccgc 29

<210>118

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(27)

<223> b chain

<400>118

gcggcgcccg cttcggcggc aggcggc 27

<210>119

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(31)

<223> c chain

<400>119

gccgccagcc gcccatagcc gtgggcgcgc g 31

<210>120

<211>37

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>120

gcggcgagcg gcgaggagcg uuggggccgg aggccgg 37

<210>121

<211>31

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> b chain

<400>121

ccggccuccg gccccuucgg ggccagccgc c 31

<210>122

<211>35

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>122

ggcggcaggc ccccauagcc cucgccgcuc gccgc 35

<210>123

<211>37

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>123

gcggcgagcg gcgagcagcg uucgggccgg aggccgg 37

<210>124

<211>31

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>124

ccggccuccg gcccguucgc cgccagccgc c 31

<210>125

<211>35

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>125

ggcggcaggc ggccauagcg cucgccgcuc gccgc 35

<210>126

<211>37

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>126

gcggcgagcg gcgaggagcg uuggggccgg aggccgg 37

<210>127

<211>31

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>127

ccggccuccg gccccuucgc cgccagccgc c 31

<210>128

<211>35

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>128

ggcggcaggc ggccauagcc cucgccgcuc gccgc 35

<210>129

<211>37

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>129

gcggcgagcg gcgagcagcg uucgggccgg aggccgg 37

<210>130

<211>31

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>130

ccggccuccg gcccguucgg cgccagccgc c 31

<210>131

<211>35

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>131

ggcggcaggc gcccauagcg cucgccgcuc gccgc 35

<210>132

<211>37

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>132

gcggcgagcg gcgagcagcg uucgggccgg aggccgg 37

<210>133

<211>31

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>133

ccggccuccg gcccguucgg ccccagccgc c 31

<210>134

<211>35

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>134

ggcggcaggg gcccauagcg cucgccgcuc gccgc 35

<210>135

<211>37

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>135

gcggcgagcg gcgacgagcg uugcggccgg aggccgg 37

<210>136

<211>31

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>136

ccggccuccg gccgcuucgc cgccagccgc c 31

<210>137

<211>35

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>137

ggcggcaggc ggccauagcc gucgccgcuc gccgc 35

<210>138

<211>37

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>138

gcggcgagcg gcgacgagcg uugcggccgg aggccgg 37

<210>139

<211>31

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>139

ccggccuccg gccgcuucgg cgccagccgc c 31

<210>140

<211>35

<212>RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>140

ggcggcaggc gcccauagcc gucgccgcuc gccgc 35

<210>141

<211>37

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>141

gcggcgagcg gcgaggagcg ttggggccgg aggccgg 37

<210>142

<211>31

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>142

ccggcctccg gccccttcgg ggccagccgcc 31

<210>143

<211>35

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>143

ggcggcaggc ccccatagcc ctcgccgctc gccgc 35

<210>144

<211>37

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>144

gcggcgagcg gcgagcagcg ttcgggccgg aggccgg 37

<210>145

<211>31

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>145

ccggcctccg gcccgttcgc cgccagccgc c 31

<210>146

<211>35

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>146

ggcggcaggc ggccatagcg ctcgccgctc gccgc 35

<210>147

<211>37

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>147

gcggcgagcg gcgaggagcg ttggggccgg aggccgg 37

<210>148

<211>31

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>148

ccggcctccg gccccttcgc cgccagccgc c 31

<210>149

<211>35

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>149

ggcggcaggc ggccatagcc ctcgccgctc gccgc 35

<210>150

<211>37

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>150

gcggcgagcg gcgagcagcg ttcgggccgg aggccgg 37

<210>151

<211>31

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>151

ccggcctccg gcccgttcgg cgccagccgc c 31

<210>152

<211>35

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>152

ggcggcaggc gcccatagcg ctcgccgctc gccgc 35

<210>153

<211>37

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>153

gcggcgagcg gcgagcagcg ttcgggccgg aggccgg 37

<210>154

<211>31

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>154

ccggcctccg gcccgttcgg ccccagccgc c 31

<210>155

<211>35

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>155

ggcggcaggg gcccatagcg ctcgccgctc gccgc 35

<210>156

<211>37

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>156

gcggcgagcg gcgacgagcg ttgcggccgg aggccgg 37

<210>157

<211>31

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>157

ccggcctccg gccgcttcgc cgccagccgc c 31

<210>158

<211>35

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>158

ggcggcaggc ggccatagcc gtcgccgctc gccgc 35

<210>159

<211>37

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(37)

<223> a chain

<400>159

gcggcgagcg gcgacgagcg ttgcggccgg aggccgg 37

<210>160

<211>31

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(31)

<223> b chain

<400>160

ccggcctccg gccgcttcgg cgccagccgc c 31

<210>161

<211>35

<212>DNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(35)

<223> c chain

<400>161

ggcggcaggc gcccatagcc gtcgccgctc gccgc 35

<210>162

<211>14

<212>DNA/RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(14)

<223> first extension segment

<400>162

gcggcgagcg gcga 14

<210>163

<211>14

<212>DNA/RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(14)

<223> first extension segment

<400>163

ucgccgcucg ccgc 14

<210>164

<211>13

<212>DNA/RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(13)

<223> first extension segment

<400>164

ggccggaggc cgg 13

<210>165

<211>13

<212>DNA/RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(13)

<223> first extension segment

<400>165

ccggccuccg gcc 13

<210>166

<211>9

<212>DNA/RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(9)

<223> first extension segment

<400>166

ccagccgcc 9

<210>167

<211>9

<212>DNA/RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(9)

<223> first extension segment

<400>167

ggcggcagg 9

<210>168

<211>14

<212>DNA/RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(14)

<223> first extension segment

<400>168

gcggcgagcg gcga 14

<210>169

<211>14

<212>DNA/RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(14)

<223> first extension segment

<400>169

tcgccgctcg ccgc 14

<210>170

<211>13

<212>DNA/RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(13)

<223> first extension segment

<400>170

ggccggaggc cgg 13

<210>171

<211>13

<212>DNA/RNA

<213>Artificial Sequence

<220>

<221>misc_feature

<222>(1)..(13)

<223> first extension segment

<400>171

ccggcctccg gcc 13

<210>172

<211>65

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(65)

<223> a chain

<400>172

cgcgcgccca cgagcgttcc gggcgcgcct tagtaacgtg ctttgatgtc gattcgacag 60

gaggc 65

<210>173

<211>26

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(26)

<223> b chain

<400>173

gcgcccggtt cgccgccagc cgccgc 26

<210>174

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(33)

<223> c chain

<400>174

gcggcggcag gcggccatag ccgtgggcgc gcg 33

<210>175

<211>10

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(10)

<223> a sequence

<400>175

cgagcgttcc 10

<210>176

<211>9

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(9)

<223> b sequence

<400>176

ggttcgccg 9

<210>177

<211>12

<212>DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(12)

<223> c sequence

<400>177

cggccatagc cg 12

<210>178

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(34)

<223> a chain

<400>178

cgcgcgcgcc cacgagcgtt ccgggcgccg ccgc 34

<210>179

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(33)

<223> b chain

<400>179

gcggcggcgc ccggttcgcc gccagccgcc gcc 33

<210>180

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(36)

<223> c chain

<400>180

ggcggcggca ggcggccata gccgtgggcg cgcgcg 36

Claims

1. A mitoxantrone-containing drug, wherein the drug comprises a nucleic acid nanoparticle and mitoxantrone, and mitoxantrone is suspended on the nucleic acid nanoparticle;

the nucleic acid nanoparticle comprises a nucleic acid domain, wherein the nucleic acid domain comprises a sequence a, a sequence b and a sequence c, the sequence a comprises a1 sequence or a sequence a1 sequence with at least one base insertion, deletion or substitution, the sequence b comprises a sequence b1 or a sequence b1 sequence with at least one base insertion, deletion or substitution, and the sequence c comprises a sequence c1 or a sequence c1 sequence with at least one base insertion, deletion or substitution;

wherein the sequence a1 is SEQ ID NO: 1: 5'-CCAGCGUUCC-3' or SEQ ID NO: 2: 5'-CCAGCGTTCC-3', respectively;

the b1 sequence is SEQ ID NO: 3: 5 '-GGUUCGCCG-3' or SEQ ID NO: 4: 5 '-GGTTCGCCG-3';

the c1 sequence is SEQ ID NO: 5'-CGGCCAUAGCGG-3' or SEQ ID NO: 6: 5'-CGGCCATAGCGG-3' are provided.

2. The drug of claim 1, wherein when the sequence a1 is SEQ ID NO. 1, the sequence b1 is SEQ ID NO. 3, and the sequence c1 is SEQ ID NO. 5, at least one of the sequence a, the sequence b, and the sequence c comprises a sequence having at least one base insertion, deletion, or substitution.

3. The medicament of claim 1 or 2, wherein the base insertion, deletion or substitution occurs at:

4. The drug of claim 1 or 2, wherein the a sequence, the b sequence and the c sequence self-assemble into a structure represented by formula (1):

wherein W-C represents a Watson-Crick pair, N and N' represent non-Watson-Crick pairs, and W-C at any position is independently selected from C-G or G-C;

in the a sequence, the first N from the 5' end is A, the second N is G, the third N is U or T, and the fourth N is any one of U, T, A, C or G;

in the b sequence, the first N 'from the 5' end is any one of U, T, A, C or G; the second N 'is U or T, and the third N' is C;

in the c sequence, the NNNN sequence from the 5 'end to the 3' end is CAUA or CATA;

preferably, the a sequence, the b sequence and the c sequence are any one of the following groups:

(1) a sequence: 5'-GGAGCGUUGG-3' the flow of the air in the air conditioner,

b sequence: 5'-CCUUCGCCG-3',

c sequence: 5'-CGGCCAUAGCCC-3', respectively;

(2) a sequence: 5'-GCAGCGUUCG-3' the flow of the air in the air conditioner,

b sequence: 5'-CGUUCGCCG-3',

c sequence: 5'-CGGCCAUAGCGC-3', respectively;

(3) a sequence: 5'-CGAGCGUUGC-3' the flow of the air in the air conditioner,

b sequence: 5'-GCUUCGCCG-3',

c sequence: 5'-CGGCCAUAGCCG-3', respectively;

(4) a sequence: 5'-GGAGCGUUGG-3' the flow of the air in the air conditioner,

b sequence: 5 '-CCUUCGGG-3',

c sequence: 5'-CCCCCAUAGCCC-3', respectively;

(5) a sequence: 5'-GCAGCGUUCG-3' the flow of the air in the air conditioner,

b sequence: 5'-CGUUCGGCG-3',

c sequence: 5'-CGCCCAUAGCGC-3', respectively;

(6) a sequence: 5'-GCAGCGUUCG-3' the flow of the air in the air conditioner,

b sequence: 5'-CGUUCGGCC-3',

c sequence: 5'-GGCCCAUAGCGC-3', respectively;

(7) a sequence: 5'-CGAGCGUUGC-3' the flow of the air in the air conditioner,

b sequence: 5'-GCUUCGGCG-3',

c sequence: 5'-CGCCCAUAGCCG-3', respectively;

(8) a sequence: 5'-GGAGCGTTGG-3' the flow of the air in the air conditioner,

b sequence: 5'-CCTTCGCCG-3',

c sequence: 5'-CGGCCATAGCCC-3', respectively;

(9) a sequence: 5'-GCAGCGTTCG-3' the flow of the air in the air conditioner,

b sequence: 5'-CGTTCGCCG-3',

c sequence: 5'-CGGCCATAGCGC-3', respectively;

(10) a sequence: 5'-CGAGCGTTGC-3' the flow of the air in the air conditioner,

b sequence: 5'-GCTTCGCCG-3',

c sequence: 5'-CGGCCATAGCCG-3', respectively;

(11) a sequence: 5'-GGAGCGTTGG-3' the flow of the air in the air conditioner,

b sequence: 5'-CCTTCGGGG-3',

c sequence: 5'-CCCCCATAGCCC-3', respectively;

(12) a sequence: 5'-GCAGCGTTCG-3' the flow of the air in the air conditioner,

b sequence: 5'-CGTTCGGCG-3',

c sequence: 5'-CGCCCATAGCGC-3', respectively;

(13) a sequence: 5'-GCAGCGTTCG-3' the flow of the air in the air conditioner,

b sequence: 5'-CGTTCGGCC-3',

c sequence: 5'-GGCCCATAGCGC-3', respectively;

(14) a sequence: 5'-CGAGCGTTGC-3' the flow of the air in the air conditioner,

b sequence: 5'-GCTTCGGCG-3',

c sequence: 5'-CGCCCATAGCCG-3', respectively;

(15) a sequence: 5'-CGAGCGTTCC-3' the flow of the air in the air conditioner,

b sequence: 5'-GGTTCGCCG-3',

c sequence: 5'-CGGCCATAGCCG-3' are provided.

5. The agent of claim 3, further comprising a first extension in the nucleic acid domain, wherein the first extension is a Watson-Crick paired extension located 5 'and/or 3' to any of the a, b, and c sequences;

preferably, the first elongate section is selected from any one of the following:

(1): a 5' end of the chain: 5' -CCCA-3', 3' end of c chain: 5 '-UGGG-3';

(2): a 3' end of the chain: 5' -GGG-3', 5' end of b chain: 5 '-CCC-3';

(3): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-UGG-3';

(4): a 5' end of the chain: 5' -CCCG-3', 3' end of c chain: 5 '-CGGG-3';

(5): a 5' end of the chain: 5' -CCCC-3', 3' end of c chain: 5 '-GGGG-3';

(6): b 3' end of strand: 5' -CCC-3', 5' -end of c chain: 5 '-GGG-3';

(7): b 3' end of strand: 5' -CCG-3', the 5' end of the c chain: 5 '-CGG-3';

(8): a 5' end of the chain: 5' -CCCA-3', 3' end of c chain: 5 '-TGGG-3';

(9): b 3' end of strand: 5' -CCA-3', 5' end of c chain: 5 '-TGG-3'.

6. The agent of any one of claims 1 to 5, wherein the nucleic acid domain further comprises a second extension located 5 'and/or 3' to any of the a, b, and c sequences, wherein the second extension is a Watson-Crick paired extension;

preferably, the second extension is an extended sequence of CG base pairs;

more preferably, the second extension is an extension sequence of 1-10 CG base pairs;

further preferably, the nucleic acid domain further comprises at least one set of second stretches:

a first group: a 5' end of the chain: 5' -CGCGCG-3 ', 3' -end of c chain: 5 '-CGCGCG-3';

second group: a 3' end of the chain: 5' -CGCCGC-3 ', 5' -end of b chain: 5 '-GCGGCG-3';

third group: b 3' end of strand: 5' -GGCGGC-3 ', 5' -end of c chain: 5 '-GCCGCC-3'.

7. The drug of claim 6, wherein the second extension is an extension comprising both CG base pairs and AT/AU base pairs, preferably the second extension is an extension of 2-50 base pairs;

preferably, the second extension segment is an extension sequence formed by alternately arranging a sequence of continuous 2-8 CG base pairs and a sequence of continuous 2-8 AT/AU base pairs; or

Preferably, the second extension is an extension of 1 CG base pair alternating with 1 AT/AU base pair sequence.

8. The medicament of any one of claims 1 to 7, wherein the bases, ribose and phosphate in the a sequence, the b sequence and the c sequence have at least one modifiable site, and any of the modifiable sites is modified by any one of the following modifying linkers: -F, methyl, amino, disulfide, carbonyl, carboxyl, mercapto and aldehyde groups;

preferably, the a sequence, the b sequence and the C sequence have 2' -F modifications on the C or U bases.

9. The drug according to any one of claims 1 to 8, wherein the mitoxantrone is physically and/or covalently attached to the nucleic acid nanoparticles and the molar ratio between mitoxantrone and nucleic acid nanoparticles is 2 to 300:1, preferably 10 to 50:1, more preferably 15 to 25: 1.

10. The drug of any one of claims 1 to 9, wherein the nucleic acid nanoparticle further comprises a biologically active substance attached to the nucleic acid domain, the biologically active substance being one or more of a target, a fluorescein, an interfering nucleic acid siRNA, a miRNA, a ribozyme, a riboswitch, an aptamer, an RNA antibody, a protein, a polypeptide, a flavonoid, glucose, natural salicylic acid, a mab, a vitamin, a phenolic lecithin, and a small molecule drug other than mitoxantrone.

11. The agent of claim 10, wherein the relative molecular weight of the nucleic acid domains is recorded as N₁The total relative molecular weight of mitoxantrone and the biologically active substance is denoted as N₂，N₁/N₂1:1 or more; preferably, the biologically active substance is one or more of the target, the fluorescein and the miRNA,

wherein the target head is located on any sequence of the a sequence, the b sequence and the c sequence, preferably on the 5 'end or the 3' end of any sequence of the a sequence, the b sequence and the c sequence, or is inserted between GC bonds of the nucleic acid structure domain,

the miRNA is an anti-miRNA, the fluorescein is modified at the 5' end or the 3' end of the anti-miRNA, and the miRNA is positioned at any one or more of the 3' end of the a sequence, the 5' end and the 3' end of the c sequence;

preferably, the target head is folic acid or biotin, the fluorescein is any one or more of FAM, CY5 and CY3, and the anti-miRNA is anti-miR-21.

12. The drug of claim 10, wherein the small molecule drug other than mitoxantrone is a drug comprising any one or more of the following groups: amino groups, hydroxyl groups, carboxyl groups, mercapto groups, benzene ring groups, and acetamido groups;

preferably, the protein is one or more of SOD, survivin, hTERT, EGFR and PSMA; the vitamin is levo-C and/or esterified C; the phenols are tea polyphenols and/or grape polyphenols.

13. The drug according to claim 1, wherein the nucleic acid nanoparticles have a particle size of 1 to 100nm, preferably 5 to 50 nm; more preferably 10 to 30 nm; further preferably 10 to 15 nm.

14. A method for preparing a mitoxantrone-containing medicament, comprising the steps of:

providing a nucleic acid nanoparticle in a medicament according to any one of claims 1 to 13;

the mitoxantrone is carried on the nucleic acid nanoparticles in a physical connection and/or covalent connection mode to obtain the mitoxantrone-containing drug.

15. The method of claim 14, wherein the step of immobilizing mitoxantrone by physical attachment comprises:

mixing and stirring the mitoxantrone, the nucleic acid nanoparticles and the first solvent to obtain a premixed system;

precipitating the premixed system to obtain the mitoxantrone-containing medicament;

preferably, the first solvent is selected from one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid;

preferably, the step of precipitating the premixed system to obtain the mitoxantrone-containing medicament comprises;

precipitating the premixed system to obtain a precipitate;

washing the precipitate to remove impurities to obtain the mitoxantrone-containing medicament;

more preferably, the precipitation is carried out under the temperature condition of less than 10 ℃ after the premixing system is mixed with absolute ethyl alcohol, so as to obtain the precipitate; further preferably, the precipitation is carried out at the temperature of 0-5 ℃ to obtain the precipitate;

more preferably, 6-12 times of volume of absolute ethyl alcohol is adopted to wash the precipitate to remove impurities, and the mitoxantrone-containing medicine is obtained.

16. The method of claim 14, wherein the step of entrapping mitoxantrone by covalent attachment comprises:

preparing a mitoxantrone solution;

reacting the mitoxantrone solution with the amino outside the G ring of the nucleic acid nano-particles under the mediated action of formaldehyde to obtain a reaction system;

purifying the reaction system to obtain the mitoxantrone-containing drug;

preferably, the step of reacting comprises:

mixing the mitoxantrone solution with a paraformaldehyde solution and the nucleic acid nanoparticles, and reacting under a dark condition to obtain the reaction system; the concentration of the paraformaldehyde solution is preferably 3.7-4 wt%, the paraformaldehyde solution is preferably a solution formed by mixing paraformaldehyde and a second solvent, and the second solvent is one or more of DCM, DCC, DMAP, Py, DMSO, PBS and glacial acetic acid.

17. The production method according to any one of claims 14 to 16, further comprising a step of producing the nucleic acid nanoparticle, which comprises: obtaining the nucleic acid domain by self-assembling single strands corresponding to the nucleic acid domain in the medicament of any one of claims 1 to 13;

preferably, after obtaining the nucleic acid domain, the method of making further comprises: the nucleic acid nanoparticle is obtained by mounting the bioactive substance in the drug according to any one of claims 10 to 12 on the nucleic acid domain by means of physical linkage and/or covalent linkage.

18. The method according to claim 17, wherein in the process of loading the bioactive substance by covalent bonding, the loading is performed by solvent covalent bonding, linker covalent bonding or click bonding;

preferably, the solvent is covalently linked using a third solvent as a linking medium, and the third solvent is selected from one or more of paraformaldehyde, DCM, DCC, DMAP, Py, DMSO, PBS, and glacial acetic acid;

preferably, the linker is selected from the group consisting of disulfide bond, p-azido, bromopropyne, or PEG;

preferably, the click-to-link is performed by performing an alkynyl or azide modification on the bioactive substance precursor and the nucleic acid domain at the same time, and then by click-to-link;

preferably, the biologically active substance is linked in a click-link to the nucleic acid domain, the site of the biologically active substance precursor for the alkynyl or azide modification is selected from the group consisting of 2 ' hydroxyl, carboxyl or amino, and the site of the nucleic acid domain for the alkynyl or azide modification is selected from the group consisting of G exocyclic amino, 2 ' -hydroxyl, a amino or 2 ' -hydroxyl.

19. A pharmaceutical composition comprising the mitoxantrone-containing medicament of any one of claims 1 to 13.

20. Use of a mitoxantrone-containing medicament according to any one of claims 1 to 13 for the preparation of a medicament for the treatment of tumors.

21. The use of claim 20, wherein the tumor is any one or more of breast cancer, malignant lymphoma, gastric cancer, intestinal cancer, leukemia, bladder cancer, liver cancer, multiple myeloma, malignant mesothelioma, and ovarian cancer.