CN111041106B - Method for distinguishing human DNA based on fluorescent quantitative PCR technology - Google Patents
Method for distinguishing human DNA based on fluorescent quantitative PCR technology Download PDFInfo
- Publication number
- CN111041106B CN111041106B CN201911394885.7A CN201911394885A CN111041106B CN 111041106 B CN111041106 B CN 111041106B CN 201911394885 A CN201911394885 A CN 201911394885A CN 111041106 B CN111041106 B CN 111041106B
- Authority
- CN
- China
- Prior art keywords
- human
- dna
- seq
- sequence
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application provides a method for distinguishing human DNA based on a fluorescent quantitative PCR technology, and a composition or a kit for distinguishing human DNA based on the fluorescent quantitative PCR technology, wherein the composition or the kit comprises a primer and/or a probe of a nucleotide sequence.
Description
Technical Field
The application relates to a method for distinguishing human DNA based on fluorescent quantitative PCR technology, and a detection primer and a probe.
Background
In recent years, with the rapid development of cell medicines, more and more cells are being developed into cell therapeutic medicines, and the cell therapy is a trend of new medicine development from scientific research to clinic gradually. Cell therapy medicines, research on pharmacokinetics in vivo is an indispensable link for judging curative effect and toxic and side effects. Unlike traditional chemical medicines, no definite research method of in vivo pharmacokinetics of the cell medicines can be established internationally at present for the dynamic change rule of the cell medicines after entering the body, including the processes and characteristics of absorption, distribution, metabolism and excretion.
Non-clinical pharmacokinetic studies, particularly animal experiments, play an important role in the evaluation process of new drug research and development. By researching the dynamic state in vivo, the method predicts the proper metering in the treatment, and is helpful for reducing the uncertainty of cell treatment, increasing the curative effect and reducing the toxic and side effects. To relate the results of animal experiments to clinical effects as a method for assessing the therapeutic effects of cellular products, it is imperative to find a highly sensitive and well-validated method to quantify the distribution of cellular products in animal models. Compared with experimental mice and rabbits, experimental monkeys are very important experimental animals in the field of new drug research, and are considered as important tools for drug evaluation due to the high similarity between the experimental animals and human beings. It is necessary to conduct an evaluation of the comparison system in animals that are closely related to human relatives prior to application of the cyto-pharmaceuticals to the human body.
The current methods for researching the distribution of cells in experimental monkeys mainly comprise animal living body imaging, fluorescent protein labeling, immunohistochemistry, qPCR and the like. The various methods have their advantages and disadvantages. For example, nuclear Magnetic Resonance (MRI), which can reflect the distribution of cells in vivo, requires labeling cells in vitro, and detecting cells injected into the body by imaging to determine the survival and cleared fate of the cells, and has high sensitivity and long labeling time. However, some labeling means may have an effect on cell activity, and it has been reported that the ability of cell differentiation is impaired after MRI labeling of bone marrow mesenchymal stem cells. Furthermore, MRI sensitivity is relatively inadequate because iron oxide particles (MRI markers) released after cell death can cause non-specific visualisation and false positives. For example, green fluorescent protein markers (GFP), which use genetic modifications that allow cells to express fluorescent proteins, the green fluorescent signal can be directly observed by a fluorescent microscope, which has the advantage of being easy to detect. However, the genetic material of the cells is altered, and this percentage of the change is not guaranteed to be stable. Any method of labelling cells may have a change in the cells, affecting differentiation of sub-cells, etc. The immunohistochemical method does not require labeled cells, but the method requires analysis of a large number of sections and microscopic observation, and meanwhile, many antigens cross between human and monkey due to the similarity of human and monkey, and the method is difficult to standardize and only semi-quantitative results can be obtained.
The qPCR method is a method with high sensitivity and relatively simple operation, and is expected to realize quantitative analysis. To establish qPCR, quantitative analysis of human cells in experimental monkeys is accomplished by detecting DNA in blood and tissue samples, first of all, sequences and primers that distinguish human from animal model DNA are found. Although the literature indicates some differences in the expression of certain specific genes in humans and monkeys, there is currently a false negative in the genes that distinguish between human and monkey cells, since after experimental cells are injected into a monkey, the cells may differentiate into cells that no longer express the specific genes. I.e. human cells are present in monkey tissue but they cannot be detected. For example, primers designed based on a humanized specific gene fragment-Alu gene as a molecular marker are expected to realize the differentiation of human and monkey DNA by qPCR, and finally achieve the aim of detecting human cells in monkey cells or tissues. Unfortunately, these primers can only distinguish humans from rodents.
For example, pengyue Song et al in 2012 reported that a highly efficient reproducible PCR method based on DNA specific primers was able to detect xenografted human cells in mouse tissue. 2015Julie et al report methods for determining the number of transplanted human cells in rats and mice using qPCR. However, there are few reports on the ability to distinguish human and monkey DNA by qPCR.
Disclosure of Invention
In one aspect, the application discloses a DNA sequence selected from the group consisting of the sequence set forth in SEQ ID NO. 1 or a fragment thereof, a reverse complement to SEQ ID NO. 1 or a fragment thereof, for use in distinguishing human and non-human animal DNA in a tissue sample mixed with human and non-human animals.
The sequence of SEQ ID NO. 1 is:
tttaaaaacctccctatcacctccgatcactgttgaaaaagcattaaactgtaagaaggggttagtattgggggaagcatgtcgtttctaaggatgggaaaggaaaatgaagtgcttctcctccctgatccaagagaggcagcttcatgaaacttctgtatgaaaatgggagcgtctgtaggaagagggactctatttacataac
in another aspect, the application provides the use of a DNA sequence selected from the group consisting of the sequence set forth in SEQ ID NO. 1 or a fragment thereof, a reverse complement of SEQ ID NO. 1 or a fragment thereof in the preparation of a reagent or kit for distinguishing human and non-human animal DNA in a tissue sample mixed with human and non-human animals.
The application also provides the use of a reagent for detecting a DNA sequence selected from the group consisting of the sequence shown as SEQ ID NO. 1 or a fragment thereof, a reverse complement to SEQ ID NO. 1 or a fragment thereof in the preparation of a reagent or kit for distinguishing human and non-human animal DNA in a tissue sample mixed with human and non-human animals.
In a specific embodiment, the DNA sequence is the sequence shown as SEQ ID NO. 1 or the reverse complement thereof, or a fragment of a part of these full-length sequences, the fragment being the sequence of SEQ ID NO. 1 or the 5 'and/or 3' ends of its back-present complement deleted 1-70 nucleotides, which fragment sequence can still be used to distinguish human and non-human animal DNA in tissue samples mixed with human and non-human animals.
In a specific embodiment, the reagents for detecting a DNA sequence are selected from primers and probes required for amplification of the DNA sequence by PCR techniques.
In one embodiment, the probe has the sequence shown in SEQ ID NO. 10.
In a specific embodiment, the probe carries a detection label thereon, preferably selected from the group consisting of FAM, TET, alexa 488, alexa 532, CF, HEX, VIC, ROX, texas Red, quasarFITC, cy3, cy5, 6-joe, EDANS, rhodamine 6G, TMR, TMRITC, x-rhodomine, texas Red, biotin, and avidin.
In a specific embodiment, the sequence of the primer is selected from the group consisting of the sequences shown as SEQ ID NO. 2 and SEQ ID NO. 3; sequences shown as SEQ ID NO. 2 and SEQ ID NO. 5; sequences shown as SEQ ID NO. 4 and SEQ ID NO. 3; sequences shown in SEQ ID NO. 6 and SEQ ID NO. 7; and the sequences shown as SEQ ID No. 4 and SEQ ID No. 7.
In a specific embodiment, the non-human animal is selected from the group consisting of rhesus, green monkey, cynomolgus monkey, rat, mouse, rabbit.
In one embodiment, the mixed human and non-human animal tissue is tissue and blood samples of non-human animals such as rhesus monkeys, mixed with human DNA derived from human cells. In a specific embodiment, the human DNA is derived from DNA in human retinal pigment epithelial cells.
In yet another aspect, the application discloses a composition comprising a primer and a probe, wherein the probe has a sequence as shown in SEQ ID NO. 10, and the primer has a sequence selected from the group consisting of the sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3; sequences shown as SEQ ID NO. 2 and SEQ ID NO. 5; sequences shown as SEQ ID NO. 4 and SEQ ID NO. 3; sequences shown in SEQ ID NO. 6 and SEQ ID NO. 7; and the sequences shown as SEQ ID No. 4 and SEQ ID No. 7.
Wherein the probe has a detection label thereon, the detection label is preferably selected from the group consisting of FAM, TET, alexa 488, alexa 532, CF, HEX, VIC, ROX, texas Red, quasarFITC, cy3, cy5, 6-joe, EDANS, rhodamine 6G, TMR, TMRITC, x-rhodomine, texas Red, biotin, and avidin.
In yet another aspect, the application also provides a kit comprising a composition as described above.
Further, the present application provides a method for differentiating human and non-human animal DNA sequences in mixed human and non-human animal tissues for non-diagnostic therapeutic purposes, wherein a PCR amplification of DNA is performed on a sample mixed human and non-human animal tissues using a composition as described above or a kit as described above.
In one embodiment, the steps include:
1) Extracting DNA from a sample of mixed human and non-human animal tissue using a combination and cellular DNA extraction kit;
2) Taqman qPCR amplification is performed using the primers and probes described in the compositions as described above or the kits as described above;
3) Fluorescence signals are collected, a cycle threshold CT value is calculated, and the concentration of human DNA in the sample is calculated.
Wherein the non-human animal is selected from the group consisting of rhesus, green monkey, cynomolgus monkey, rat, mouse, rabbit.
Wherein the mixed human and non-human animal tissue is a tissue and blood sample of a non-human animal such as rhesus monkey, and the human DNA is derived from human cells, preferably from retinal pigment epithelial cells.
Advantageous effects
The application finds a DNA sequence on a human genome chromosome, the DNA sequence is of human specificity, and a plurality of primers and probes are designed on the basis of the DNA sequence, so that the DNA of human and a plurality of species can be distinguished. In practical application, the detection of the human-source specific DNA from the DNA of the experimental animal can be realized.
Drawings
FIG. 1 shows the amplification curves ((1) human retinal pigment epithelial cell DNA), (2) rhesus DNA, (3) green monkey DNA, (4) cynomolgus monkey DNA, (5) rat DNA, (6) mouse DNA, and (7) rabbit DNA) for the detection of different species of DNA using R1, F1, and Probe1 when targeting the DNA sequence of the present application shown in SEQ ID NO: 1.
FIG. 2 shows the amplification curves ((1) human retinal pigment epithelial cell DNA), (2) rhesus DNA, (3) green monkey DNA, (4) cynomolgus monkey DNA, (5) rat DNA, (6) mouse DNA, and (7) rabbit DNA) for the detection of different species of DNA using R2, F2, and Probe1 when targeting the DNA sequence of the present application shown in SEQ ID NO: 1.
FIG. 3 shows the amplification curves ((1) human retinal pigment epithelial cell DNA), (2) rhesus DNA, (3) green monkey DNA, (4) cynomolgus monkey DNA, (5) rat DNA, (6) mouse DNA, and (7) rabbit DNA) for the detection of different species of DNA using R2, F1, and Probe1 when targeting the DNA sequence of the present application shown in SEQ ID NO: 1.
FIG. 4 shows the amplification curves ((1) human retinal pigment epithelial cell DNA), (2) rhesus DNA, (3) green monkey DNA, (4) cynomolgus monkey DNA, (5) rat DNA, (6) mouse DNA, and (7) rabbit DNA) for the detection of different species of DNA using R3, F3, and Probe1 when targeting the DNA sequence of the present application shown in SEQ ID NO: 1.
FIG. 5 shows the amplification curves ((1) human retinal pigment epithelial cell DNA), (2) rhesus DNA, (3) green monkey DNA, (4) cynomolgus monkey DNA, (5) rat DNA, (6) mouse DNA, and (7) rabbit DNA) for the detection of different species of DNA using R2, F3, and Probe1 when targeting the DNA sequence of the present application shown in SEQ ID NO: 1.
FIG. 6 shows the amplification curves ((1) human retinal pigment epithelial cell DNA, (2) rhesus DNA, (3) green monkey DNA, (4) cynomolgus monkey DNA, (5) rat DNA, (6) mouse DNA, and (7) rabbit DNA) for the detection of DNA of different species when targeting gene SRGAP 2;
FIG. 7 shows the amplification curves ((1) human retinal pigment epithelial cell DNA, (2) rhesus DNA, (3) green monkey DNA, (4) cynomolgus monkey DNA, (5) rat DNA, (6) mouse DNA, and (7) rabbit DNA) for detecting the DNA of different species when targeting gene Qhomo2;
FIG. 8 shows graphs of amplification for detecting DNA of different species ((1) human retinal pigment epithelial cell DNA, (2) rhesus DNA, (3) green monkey DNA, (4) cynomolgus monkey DNA, (5) rat DNA, (6) mouse DNA, and (7) rabbit DNA) when the gene Alu is targeted;
FIG. 9 shows a typical standard curve for real-time fluorescent quantitative PCR detection of DNA sequences of interest in human retinal pigment epithelial cells.
Detailed Description
The present application will be further described by the following detailed description.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
In the present application, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.
As used herein, the term "non-human animal" includes all vertebrates, such as mammals and non-mammals, such as non-human primates, sheep, dogs, cats, horses, cattle, chickens, rats, mice, amphibians, reptiles, and the like. In specific embodiments, the non-human animal is selected from the group consisting of rhesus, green monkey, cynomolgus monkey, rat, mouse, rabbit.
As used herein, the term "DNA sequence" refers herein to a DNA sequence encoding a protein, such as, but not limited to, a DNA sequence encoding a protein that is present in the genome of a cell.
As used herein, the term "probe" refers to an oligonucleotide molecule with a detectable label in the present application. "detection label" in the context of the present application refers to a molecule or group detection label capable of generating a detection signal including, but not limited to, fluorescent molecules (see, for example, european patent EP 144914), radioisotopes (see, for example, U.S. Pat. Nos. 4358535 and 4446237), antibodies, enzymes, and oligonucleotides (e.g., oligonucleotide barcodes).
Examples of fluorescent molecules include, but are not limited to, 6-carboxyfluorescein (FAM), tetrachlorofluorescein (TET), alexa (e.g., alexa 488, alexa 532), CF, HEX, VIC, ROX, texas Red, quasarFITC, cy3, cy5, 6-joe, EDANS, rhodamine G (P6G) and derivatives thereof (tetramethyirhodamine (TMR), tetramethylrhodamine isothiocyanate (TMRITC), x-rhodomine, texas Red, probes and derivatives thereof under the trade names "BODJPY FL", "BODIPY FL/C3", "BODIPY EL/C6", "BODIPY 5-FAM", "BODIPY TMR", "BODIPY TR", "BODIPY R6G", "BODIPY 581", produced by Molecular Probes, inc. located in Eugenia, oreg.
Examples of detection markers can also be found in U.S. patent nos. 5,723,591 and 5,928,907; WO2011066476 and WO2012149042; www.idahotech.com; gudnason et al, nucleic acids res, 35 (19): e127 (2007), incorporated by reference in its entirety.
The detection label may be attached to the oligonucleotide molecule by covalent or non-covalent bonds. Non-covalent bonds include, but are not limited to, hydrogen bonds, ionic bonds, van der Waals forces, and hydrophobic bonds. For example, in some embodiments, the detection label may be attached to the nucleotide molecule via a covalent bond. For example, an aminoallyl (amid-aliyl) UTP may be incorporated in the synthesis of oligonucleotide molecules, and the resulting aminoallyl-labeled nucleic acid molecules may be coupled to fluorescent molecules containing NHS-esters (NHS-escers), such as Alexa 488,Alexa 594,Alexa 647 (Invitrogen) or Cy3 (GE Healthcare), to form covalent linkages.
In certain embodiments, the detection label is selected from the group consisting of: FAM, tetrachlorofluorescein (TET), alexa 488, alexa 532, CF, HEX, VIC, ROX, texas Red, quasarFITC, cy3, cy5, 6-joe, EDANS, rhodamine 6G (P6G), tetramethyirhodamine (TMR), tetramethylrhodamine isothiocyanate (TMRITC), x-rhodomine, texas Red, biotin, avidin.
In certain embodiments, the probe further carries a quenchable signal. "quencher" in the context of the present application refers to a molecule that, when in sufficient spatial proximity to a detection label, prevents the detection label from generating a detection signal. When the quencher is far from the detection label, the quencher cannot prevent the generation of the detection signal.
Examples of quenching molecules include, but are not limited to, DDQ-I, DDQ-II, dabcyl, eclipse, iowa Black FQ, iowa Black RQ, BHQ-1, BHQ-2, BHQ-3, "QSY7", "QSY-21" and "QSY33" (molecular probes Co.), ferrocene and its derivatives, methyl virogen, tetramethylrhodamine (TAMRA), minor groove binding non-fluorescent quencher (MGBNFQ) and N, N' -dimethyl-2,9-diazopyrenium.
In certain embodiments, the fluorescent molecule is FAM and the quencher molecule is MGBNFQ or DDQ-I. In certain embodiments, the fluorescent molecule is TAMRA, cy3, ROX, cy5 and the quencher molecule is DDQ-II. In certain embodiments, the fluorescent molecule is FAM, HEX, ROX, JOE and the quencher molecule is Dabcyl. In some embodiments, the probe has a fluorescent molecule FAM or VIC at the 5 'end and a quencher molecule MGBNFQ at the 3' end.
The quencher molecule may be attached to the probe by methods well known in the art. For example, an amino-allyl (UTP) may be incorporated during synthesis of the oligonucleotide molecule, and the resulting amino-allyl labeled nucleic acid molecule may be coupled to a quenching molecule comprising an NHS-ester (NHS-ester) to form a covalent linkage. For another example, the quencher molecule (e.g., dabcyl) can be attached to the oligonucleotide during synthesis of the oligonucleotide by reaction with a phosphoramidite derivative of the quencher molecule at the 3' end.
In certain embodiments, the signal is quenched when the probe is intact. In certain embodiments, the detection label and the quencher are attached to the 5 'and 3' ends of the probe, respectively. For example, the non-mutant region probe may be linked at the 5 'end to a detection label, at the 3' end to a quencher, or at the 3 'end to a detection label, and at the 5' end to a quencher.
In certain embodiments, a polymerase having 5'-3' exonuclease activity is used to amplify a nucleic acid sequence comprising SEG ID NO. 1 or its complement, or a fragment of the sequence with SEQ ID NO. 1 or its complement, as the template sequence, and the probe is added to the reaction mixture. During amplification, if the probe hybridizes to the template sequence, the probe will be degraded by the polymerase during the polymerization reaction, thereby separating the fluorescent molecules on the probe from the quencher molecules and generating a fluorescent signal (see U.S. Pat. nos. 5210015 and 5487972).
As used herein, the term "fragment" refers to a sequence in which a portion of the nucleotide is deleted at the 5 'and/or 3' end as compared to a fragment of the DNA sequence of the present application as shown in SEQ ID NO:1 or its inverse 100% complementary sequence, for example, a sequence in which 1 to 70, 2 to 70, 5 to 70, 10 to 70, 20 to 70, 30 to 70, 40 to 70, 50 to 70, 60 to 70 nucleotides are deleted at the 5 'end, or a sequence in which 1 to 70, 2 to 70, 5 to 70, 10 to 70, 20 to 70, 30 to 70, 40 to 70, 50 to 70, 60 to 70 nucleotides are deleted at the 5' end as compared to a sequence shown in SEQ ID NO:1, or a sequence in which 1 to 70, 2 to 70, 5 to 70, 20 to 70, 30 to 70, 40 to 70, 50 to 70, 60 to 70 nucleotides are deleted at the 5 'end, or a sequence in which 1 to 70, 2 to 70, 5 to 70, 50 to 70, 60 to 70 nucleotides are deleted at the 3' end, or a sequence in which 1 to 70, 2 to 70, 50 to 70, 60 to 70 nucleotides are deleted at the 3 'end, or a sequence in which 1 to 70, 50 to 70 nucleotides is deleted at the 3' end, or a sequence which is deleted at the 3 'end is deleted at the 5' end, or 100 to 70 nucleotide end, or a sequence which fragment of the same nucleotide sequence can be used for human tissue or other than the human tissue or to be amplified. It will be appreciated by those skilled in the art that for PCR of SEQ ID NO. 1, the length of the PCR product fragment finally obtained by the primer probe may be the full length of SEQ ID NO. 1 or a portion thereof.
Examples
The application is further illustrated by the following examples. The examples are provided for illustrative purposes only and should not be construed as limiting the scope or content of the application in any way.
Example 1: detection method specificity verification
1. Designing and synthesizing a primer:
the application designs a plurality of pairs of primers and probes based on a human specificity DNA sequence Seq1 (SEQ ID NO: 1), and simultaneously finds 3 groups of human specificity genes and primers (SRGAP 2, qhomo2 and Alu) thereof from documents and patents as a comparison. The primer of Qhomo2 is applied from literature (safety research of umbilical cord mesenchymal stem cells before clinic, wangjingjingkou college of medical science, 2013), and can specifically detect the human DNA according to reports. The primer of SRGAP2 is cited as a primer for specifically detecting humanized genomic DNA and application thereof in special CN201910477468.2, and can detect humanized specific DNA sequences from a plurality of species of DNA (including cynomolgus monkey, rat, mouse and New Zealand rabbit) according to reports. The gene Alu sequence amplified by the primer Alu is a short repeated sequence with universality, diversity and specificity in human genome, and Alu family elements can be used for individual identification in forensic DNA analysis. There are also reports that Alu sequences can be used for distinguishing human from other species of DNA, and the Alu primers and probes of the present application are used in the literature. Table 1.1 shows the sequences of all primers and probes used in the present application, wherein the Probe (Probe) has a reporter group at the 5 'end and a quencher group at the 3' end.
TABLE 1.1 human specific DNA detection primer sequence listing
DNA extraction
Genomic DNA of cells and tissues derived from different species (human, rhesus, green monkey, cynomolgus monkey, rat, mouse and rabbit) was extracted using the tissue and cell DNA extraction kit according to the instructions of the kit.
Taqman qPCR procedure
(1) The reaction system of Taqman qPCR amplification, the single sample is 20. Mu.L:10 μL 2×Superreal Premix (Probe); 1 μL 50× ROX Reference Dye; 0.6. Mu.L of primer R (10. Mu.M); 0.6. Mu.L of primer F (10. Mu.M); 0.4. Mu.L Probe (10. Mu.M); adding 20ng of DNA; with RNase-Free ddH 2 O made up the reaction system to 20. Mu.L. The primers and probes used in this step and their combinations are shown in the table below, together 13 sets of primer and probe combinations.
TABLE 1.2 human specific DNA detection primer combinations Table
(2) The reaction conditions for Taqman qPCR amplification are: pre-denaturation at 95 ℃ for 15 min; denaturation at 95℃for 1 sec; annealing at 62 ℃ for 30 seconds, and carrying out 40 cycles in total; fluorescence signals were collected at 62 ℃. CT values were obtained from the instrument after the experiment was completed.
(3) The effect of detecting the human DNA by the primer and the probe is determined based on the CT value obtained by the experiment of (2), wherein the CT value indicates that the amplification is present and the CT value indicates that the amplification is absent. If a set of primer and probe combinations is not amplified in other species, only in human DNA samples, indicating that the combination can amplify a human specific DNA sequence.
4. Experimental results
TABLE 1.3 statistical table of detection results of human-specific DNA
The experimental results are shown in table 1.3: wherein "+" indicates amplified and "-" indicates no amplified; "/" indicates that no experiment was performed. SRGAP2, qhomoo 2 and Alu are human-derived specific genes reported in literature or patents, and probes and primers are all reported, and the experiments in practice prove that only Qhomoo 2 can distinguish human and green monkey DNA in experiments for distinguishing human from experimental monkey DNA, and SRGAP2 and Alu cannot distinguish human from three experimental monkey (green monkey, cynomolgus monkey and rhesus monkey) DNA. The DNA sequence Seq1 found in the present application, the combination of partial primers and probes designed for the DNA sequence (e.g. R2, F2 plus Probe 2) cannot distinguish human from monkey DNA, and some (e.g. R1, F1 plus Probe 1) can distinguish DNA between human and a plurality of species (including three species of monkey, rat, mouse and rabbit), and FIG. 1, FIG. 6, FIG. 7 and FIG. 8 are amplification graphs of primer combinations R1, F1 plus Probe1, SRGAP2, qhomo2 and Alu, respectively. FIGS. 2 to 5 show amplification plots of the other primer combinations for amplifying the DNA sequence Seq 1. The experimental results also show that the primers and probes synthesized in the application can realize detection of human DNA in a plurality of species.
TABLE 1.4 positions of primers
TABLE 1.5 amplified fragment Length
Example 2 development of quantitative methods and methodological verification
5 groups of primer and Probe combinations R1 (SEQ ID NO: 2), F1 (SEQ ID NO: 3) plus Probe1 (SEQ ID NO: 10) capable of realizing the distinction between human and three monkey DNAs; r1 (SEQ ID NO: 2), F2 (SEQ ID NO: 5) plus Probe1 (SEQ ID NO: 10); r2 (SEQ ID NO: 4), F1 (SEQ ID NO: 3) plus Probe1 (SEQ ID NO: 10); r3 (SEQ ID NO: 6), F3 (SEQ ID NO: 7) plus Probe1 (SEQ ID NO: 10); r2 (SEQ ID NO: 4), F3 (SEQ ID NO: 7) plus Probe1 (SEQ ID NO: 10). In the following, only the combination of a pair of primers and probes (R1, F1 plus Probe 1) is taken as an example to develop a quantitative method and verify methodology. It will be appreciated by those skilled in the art that other primers should also have similar methodological validation effects, as they can distinguish between humans and other species, with better specificity.
1. Preparation of standard curve and quality control sample
1.1 preparation of standard Curve samples
A standard curve sample was prepared according to the following table, wherein the standard was a human retinal pigment epithelial cell injection (a cell solution containing human retinal pigment epithelial cells, which can be used for subretinal injection treatment of rhesus monkeys) and total genomic DNA (concentration: about 140 ng/. Mu.L), diluted according to the following table, added with a predetermined volume of pure water, and then added with corresponding volumes of human retinal pigment epithelial cell injection total genomic DNA, STD 1-STD 6 into a centrifuge tube, and vortexed for further use.
TABLE 2.1 preparation of standard curve samples
Note that: the preparation can be scaled up or down according to actual needs.
1.2 preparation of quality control samples
Quality control samples were prepared according to the following table, wherein the standard was human retinal pigment epithelial cell whole genome DNA (concentration: about 140 ng/. Mu.L), diluted according to the following table, and then added with a certain volume of pure water, and then added with a corresponding volume of human retinal pigment epithelial cell injection whole genome DNA, upper limit ULOQ, high quality control HQC, medium quality control MQC, quality control C, low quality control LQC, lower limit LLOQ, and further formulated into ULOQ (100 ng/. Mu.L), HQC (80 ng/. Mu.L), MQC (3.2 ng/. Mu.L), C (0.8 ng/. Mu.L), LQC (0.08 ng/. Mu.L) and LLOQ (0.032 ng/. Mu.L).
TABLE 2.2 preparation of quality control samples
Note that: the preparation can be scaled up or down according to actual needs.
2. Detection step
2.1DNA extraction
Using the tissue and cell DNA extraction kit, genomic DNA of the cells and tissues was extracted according to the instructions of the kit.
2.2Taqman qPCR procedure
(1) The single sample of the reaction system for Taqman qPCR amplification is 20. Mu.L: 10 mu L2X Superreal Premix (Probe); 1 μL 50× ROX Reference Dye; 0.6. Mu.L of primer R (10. Mu.M); 0.6. Mu.L of primer F (10. Mu.M); 0.4. Mu.L Probe (10. Mu.M); adding 2 mu L of DNA (DNA templates are respectively human retina pigment epithelial cell whole genome DNA, a standard curve sample, a quality control sample, a sample to be tested, a blank matrix negative control sample (Neg) and pure water template-free negative control (NTC)); with RNase-Free ddH 2 O made up the reaction system to 20. Mu.L.
(2) The reaction conditions for Taqman qPCR amplification are: pre-denaturation at 95 ℃ for 15 min; denaturation at 95℃for 1 sec; annealing at 62 ℃ for 30 seconds, and carrying out 40 cycles in total; fluorescence signals were collected at 62 ℃. Obtaining CT value, amplification Efficiency (Efficiency) and R of standard curve from instrument after experiment 2 And Slope and intercept of the standard curve equation.
3. Data processing
From the CT value of the obtained standard, the amplification Efficiency (Efficiency), R 2 And Slope and intercept of standard curve equation, calculate DNA concentrations of target fragments of standard curve sample, HQC, MQC, LQC sample and sample to be measured, etc., conc=10 (CT value-y-int)/Slope Concentration data were rounded to retain 3 bits after the decimal point,% RE (relative error), and% CV (coefficient of variation) retained 2 bits after the decimal point.
The% RE, standard Deviation (SD), and% CV used in the report and the equivalent DNA concentration of interest were calculated by the Office Excel 2010 (Microsoft corporation, USA) software. The calculation formula is as follows:
average value:
percentage of relative error:
percentage coefficient of variation:
standard deviation:
sample judgment standard: 1. when the CT values of LLOQ and LOD are both less than the CT values of NTC and Neg: (1) The complex hole CT values of the sample to be tested are smaller than the average CT value of LLOQ, and a concentration result is obtained; (2) The CT values of the complex holes of the sample to be tested are smaller than the CT value of LOD, which indicates that the sample is positive; (3) If LOD does not take on value, the batch of samples has a concentration result; 2. when one of the CT values of Neg and NTC is smaller than the CT value of LOD or LOD is not out, only when the complex hole CT values of the sample to be detected are smaller than the average CT value of LLOQ, a concentration result is obtained, and a positive sample is arranged between the minimum NTC CT value and LLOQ; 3. if one of the CT values of Neg and NTC is smaller than the CT value of LLOQ, the concentration result is obtained only when the complex pore CT values of the sample to be tested are smaller than the smallest CT value of Neg and NTC.
4. Methodological validation results
4.1 Standard Curve and lower quantitative Limit
Preparing a standard curve sample according to a test scheme 1.1, and obtaining a CT value, an amplification Efficiency (Efficiency) and R of a standard product after on-machine detection 2 And Slope (Slope) and intercept of the standard curve equation, thereby obtaining the standard curve. The linear range and lower quantification limit (lowest point of standard curve) of the method are determined. At least 2 persons verify at least 6 analytical batches in at least 2 days, and the relative error (RE%) of each concentration from the theoretical concentration in each analytical batch and the average relative error (RE%) and precision (CV%) of each concentration across all analytical batches are counted.
Acceptance criteria: the standard curve sample concentration in each analysis batch and between the analysis batches meets the relative error (RE%) of between-75% and 150%; the precision (CV%) between batches is less than or equal to 60.00%; all analytical batches required to satisfy R 2 ≥0.980。
The results show that: the linear range of standard curve of qPCR detection of human retinal pigment epithelial cell injection target fragment is: 0.032-100.000 ng/. Mu.L, the lower limit of quantification is: 0.032 ng/. Mu.L. R is R 2 In the range of 0.991 to 0.999; the accuracy percent RE in the batch of each concentration point of the standard curve is in the range of-16.75 to 43.75 percent; the accuracy percent RE between batches of each concentration point is in the range of-4.53 to 12.50 percentWithin the range of 5.42 to 13.89 percent of precision CV; meets the accuracy and precision requirements of the standard curve. The specific results are shown in Table 2.3, typical standard curves are shown in FIG. 9, and summary of standard curve fitting parameters are shown in Table 2.4.
TABLE 2.3 real-time fluorescent quantitative PCR detection of Standard Curve results for the DNA sequences of human retinal pigment epithelial cell injection
Remarks: "/" indicates no calculated data.
Table 2.4 summary of standard curve fitting parameters
Remarks: standard curve fitting formula: ct=slope LgX 0 +y-int; wherein X is 0 For the sample starting concentration, y-int is the intercept and Slope is the Slope.
4.2 precision and accuracy
To verify the intra-batch, inter-batch Precision (Precision) and relative error (Accuracy) of this method, 3 sets of ULOQ, HQC, MQC, LQC, LLOQ concentration quality control samples were prepared as per table 2.2 in the same analytical batch, and at least 2 persons separated for at least 2 days for at least 6 analytical batches. The precision (CV%), average relative error (% RE), and total precision (% CV), average relative error (RE%) were counted for each quality control sample concentration lot.
Acceptance criteria: average relative error (RE%) in each concentration batch and between batches is within-75% -150%; the precision (CV%) of each concentration in the batch and between batches is less than or equal to 60.00%.
The results show that the accuracy percent RE in the batch of each quality control sample concentration is in the range of-22.50-41.25 percent, and the precision percent CV in the batch is in the range of 1.37-60.00 percent; the accuracy percent RE between batches of each quality control sample concentration is within the range of-0.91-15.60 percent, and the precision percent CV between batches is within the range of 9.28-35.71 percent, thereby meeting the accuracy and precision requirements between batches. The data show that the accuracy and precision of the analysis method meet the requirements, and the specific results are shown in Table 2.5.
TABLE 2.5 real-time fluorescent quantitative PCR detection of the precision and accuracy of the DNA sequences of interest in human retinal pigment epithelial cell injection
/>
4.3 Effect of different blank matrix genome quality and concentration on the detection of the DNA sequence of interest
Whole blood, lung, liver, choroid+rpe (retinal pigment epithelial cells), iris DNA of a blank rhesus monkey were extracted as interfering matrices. Adding standard curve samples into a reaction system respectively containing 200ng and 100ng of blank lung and liver DNA; standard curve samples were added to the reaction system containing 100ng and 40ng total amounts of empty choroid+rpe, iris, whole blood DNA, respectively (formulated in actual total amounts when empty matrix DNA was insufficient to supplement the corresponding total amounts of DNA). Samples were tested and the relative error (RE%) of each concentration of the standard curve with blank matrix DNA added to the theoretical concentration was calculated.
Acceptance criteria: comparing the sum of the two standard curves of the blank matrix DNA added into each tissue, and taking the total amount of which is smaller as the addition amount of the template in the reaction system during the detection of the actual sample; if the sum of the two sets of standard curves is close to RE%, the total amount of the standard curves with smaller low concentration points RE% on the standard curves is selected as the addition amount of the template in the reaction system during actual sample detection, and the optimal detection concentration is calculated. In the actual sample detection, when the actual sample concentration is 20% greater than the optimal detection concentration, the sample is diluted to the optimal detection concentration, and if the actual sample concentration is less than the optimal detection concentration, the detection is performed according to the actual concentration.
The results show that when the total amount of the whole blood DNA of the blank rhesus monkey is 100ng and 40ng respectively, the sum of the two standard curves |RE| is 207.11 and 125.32 respectively, the addition amount of the template in the reaction system is 40ng when the whole blood sample is detected, and the optimal detection concentration of the sample is 20 ng/. Mu.L; when the total amount of lung DNA of a blank rhesus monkey is 200ng and 100ng respectively, the sum of two standard curves |RE% | is 549.81 and 311.49 respectively, the addition amount of a template in a reaction system is 100ng when a lung sample is detected, and the optimal detection concentration of the sample is 50 ng/. Mu.L; when the total amount of liver DNA of a blank rhesus monkey is 200ng and 100ng respectively, the sum of two standard curves |RE% | is 98.51 and 113.79 respectively, and the addition amount of a template in a reaction system is 200ng when liver samples are detected, and the optimal detection concentration of the samples is 100 ng/. Mu.L; when the total amount of the choroid+RPE DNA of the blank rhesus monkey is 100ng and 40ng respectively, the sum of the two standard curves |RE| is 356.71 and 95.04 respectively, the addition amount of the template in the reaction system is 40ng when the choroid+RPE sample is detected, and the optimal detection concentration of the sample is 20 ng/. Mu.L; when the total amount of iris DNA of a blank rhesus monkey is 100ng and 40ng respectively, the sum of two standard curves |RE% | is 576.19 and 218.31 respectively, and the addition amount of the template in a reaction system is 40ng during iris sample detection, and the optimal detection concentration of the sample is 20 ng/. Mu.L. The specific results are shown in Table 2.6.
TABLE 2.6 Effect of different blank matrix genome quality and concentration of rhesus monkeys on the detection of the DNA sequence of interest
/>
/>
Remarks: the ". Times." indicates that the values are not shown and the actual concentration is calculated as 0.
4.4 detection Limit (LOD)
LLOQ was diluted with pure water to give samples of concentrations S1 (0.016 ng/. Mu.L), S2 (0.008 ng/. Mu.L), S3 (0.004 ng/. Mu.L), and S4 (0.002 ng/. Mu.L), and the sensitivity of the assay was determined for each of 16 single wells, and the detection Limit (LOD) of the assay was determined by using whole blood, lung, liver, choroid+RPE, and iris-mixed DNA of a blank rhesus as negative controls, and if a certain concentration of the sample had failed to meet the acceptance criteria, no assay was performed for samples lower than that concentration.
Acceptance criteria: the lowest concentration satisfying the CT value of 60% sample < CT value of blank mixed DNA or CT value of sensitive sample and CT value of blank mixed DNA is used as the detection limit of the method, and the concentration is used as the detection Limit (LOD) in actual detection. If the CT value of the sample to be detected is larger than the CT value of the lower limit of quantification (LLOQ), and the calculated concentration is larger than the detection Limit (LOD), the sample is defined as positive, but the accurate concentration is not available.
The results showed that at a concentration of S1 (0.016 ng/. Mu.L), the CT of the 62.50% S1 sample gave a value for the blank mixed DNA; at a concentration of S2 (0.008 ng/. Mu.L), the CT value of the 31.25% S2 sample < CT value of the blank mixed DNA gave a limit of detection of S1 (0.016 ng/. Mu.L) for this method. The specific results are shown in tables 2.7 and 2.8.
TABLE 2.7 real-time fluorescence quantitative PCR detection of the detection Limit determination result (I) of the target DNA sequence of the human retinal pigment epithelial cell injection
Remarks: "NaN" means no CT value.
TABLE 2.8 real-time fluorescence quantitative PCR detection of the detection Limit determination result of the target DNA sequence of the human retinal pigment epithelial cell injection (II)
Remarks: "NaN" means no CT value.
4.5 Selectivity
In order to evaluate the influence of blank matrix (i.e. test animal tissue and blood genome) on sample detection, the DNA of rhesus whole blood, lung, liver, choroid+RPE and iris are extracted and diluted to the optimal detection concentration determined in the section 4.3, and CT of blank matrix is detected without obvious endogenous DNA interference affecting negative and positive judgment of sample.
Acceptance criteria: the CT value of each well of rhesus blank rhesus whole blood, lung, liver, choroid+rpe, DNA of iris and pure water (NTC) > large CT in LOD multiplex wells (or blank matrix shows no CT).
The results show that CT values of the rhesus monkey blank whole blood, lung, choroid+RPE, iris DNA and pure water (NTC) all show no CT, only one CT in the compound holes of the liver is 39.54, and the CT value is larger than the large CT value in the compound holes of the LOD, and the requirements are met, so that no obvious endogenous DNA interference influences the negative and positive judgment of the sample. The specific results are shown in Table 2.9.
TABLE 2.9 real-time fluorescence quantitative PCR detection of the results of the Selective determination of the DNA sequences of human retinal pigment epithelial cell injection
Remarks: "NaN" means CT-free
5. Conclusion(s)
The above verification results show that the linear range of the method for detecting the human DNA (human retinal pigment epithelial cell DNA) in the rhesus monkey body by using the real-time fluorescence quantitative PCR is as follows: 0.032-100.000 ng/. Mu.L, the lower limit of quantification is 0.032 ng/. Mu.L, and the detection limit is 0.016 ng/. Mu.L; the precision and the accuracy meet the requirements, the negative and positive judgment of the sample is not affected by obvious endogenous DNA interference, the selectivity is good, and the method can be used for detecting the concentration of the target DNA sequence of the human retina pigment epithelial cells in rhesus tissue and blood samples.
The foregoing embodiments are to be considered as illustrative rather than limiting the application described herein. The scope of the application is indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.
Sequence listing
<110> Jiangsu ai Erkang biomedical technology Co., ltd
<120> method for differentiating human DNA based on fluorescent quantitative PCR technique
<130> AJ2349PI19001
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 205
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 1
tttaaaaacc tccctatcac ctccgatcac tgttgaaaaa gcattaaact gtaagaaggg 60
gttagtattg ggggaagcat gtcgtttcta aggatgggaa aggaaaatga agtgcttctc 120
ctccctgatc caagagaggc agcttcatga aacttctgta tgaaaatggg agcgtctgta 180
ggaagaggga ctctatttac ataac 205
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer R1
<400> 2
ggggaagcat gtcgtttcta 20
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer F1
<400> 3
tcttggatca gggaggagaa 20
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer R2
<400> 4
acctccctat cacctccgat 20
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer F2
<400> 5
cttcctacag acgctcccat 20
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer R3
<400> 6
gggttagtat tgggggaagc 20
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer F3
<400> 7
atgaagctgc ctctcttgga 20
<210> 8
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer R4
<400> 8
ggatgggaaa ggaaaatgaa g 21
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer F4
<400> 9
ttcctacaga cgctcccatt 20
<210> 10
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> Probe1
<400> 10
cacttcattt tcctttccca tcctt 25
<210> 11
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> Probe2
<400> 11
cctccctgat ccaagagagg cagc 24
<210> 12
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer SRGAP2-F
<400> 12
cgatactcag gtcaaaggta agg 23
<210> 13
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer SRGAP2-R
<400> 13
ctgcaaatca cggtggaaat ac 22
<210> 14
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> Probe SRGAP2-Probe
<400> 14
tgcaaatgct ctgtggactg gtga 24
<210> 15
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer Qhomo2-F
<400> 15
gtgggtggga agagggaagc 20
<210> 16
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer Qhomo2-R
<400> 16
actcggcatt cacacatttc tcag 24
<210> 17
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> Probe Qhomo2-Probe
<400> 17
cagcagtggc gtgtgggaac ctg 23
<210> 18
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> primer Alu-F
<400> 18
gtcaggagat cgagaccatc ct 22
<210> 19
<211> 17
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_structure
<223> downstream primer Alu-R
<400> 19
agtggcgcaa tctcggc 17
<210> 20
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<223> Probe Alu-Probe
<400> 20
agctactcgg gaggctgagg cagga 25
Claims (13)
1. Use of a reagent for detecting a DNA sequence selected from the group consisting of the sequence shown in SEQ ID NO. 1 or a fragment thereof, a reverse complement of SEQ ID NO. 1 or a fragment thereof for the preparation of a reagent or kit for distinguishing human and non-human animal DNA in a tissue sample mixed with human and non-human animals,
wherein the reagent for detecting the DNA sequence is selected from primers and probes required for amplifying the DNA sequence by a PCR technology, wherein the sequence of the probes is shown as SEQ ID NO. 10, and the sequence of the primers is selected from sequences shown as SEQ ID NO. 2 and SEQ ID NO. 3; sequences shown as SEQ ID NO. 2 and SEQ ID NO. 5; sequences shown as SEQ ID NO. 4 and SEQ ID NO. 3; sequences shown in SEQ ID NO. 6 and SEQ ID NO. 7; and the sequences shown as SEQ ID No. 4 and SEQ ID No. 7.
2. The use of claim 1, wherein the probe has a detection label thereon, the detection label being selected from the group consisting of FAM, TET, alexa 488, alexa 532, CF, HEX, VIC, ROX, texas Red, quasarFITC, cy3, cy5, 6-joe, EDANS, rhodamine 6G, TMR, TMRITC, x-rhodoamine, texas Red, biotin, and avidin.
3. The use of claim 1 or 2, wherein the non-human animal is selected from the group consisting of rhesus, green monkey, cynomolgus monkey, rat, mouse, rabbit.
4. The use according to claim 1 or 2, wherein the mixed human and non-human animal tissue is a tissue and blood sample of a non-human animal in which human DNA derived from human cells is mixed, and the non-human animal is a rhesus monkey.
5. The use of claim 4, wherein the human cells are human retinal pigment epithelial cells.
6. A composition comprising a primer and a probe, wherein the probe has a sequence as shown in SEQ ID No. 10, wherein the primer has a sequence selected from the group consisting of sequences as shown in SEQ ID No. 2 and SEQ ID No. 3; sequences shown as SEQ ID NO. 2 and SEQ ID NO. 5; sequences shown as SEQ ID NO. 4 and SEQ ID NO. 3; sequences shown in SEQ ID NO. 6 and SEQ ID NO. 7; and the sequences shown as SEQ ID No. 4 and SEQ ID No. 7.
7. The composition of claim 6, wherein the probe has a detection label thereon, the detection label being selected from the group consisting of FAM, TET, alexa 488, alexa 532, CF, HEX, VIC, ROX, texas Red, quasarFITC, cy3, cy5, 6-joe, EDANS, rhodamine 6G, TMR, TMRITC, x-rhodoamine, texas Red, biotin, and avidin.
8. A kit comprising the composition of claim 6 or 7.
9. A method for non-diagnostic therapeutic purposes for distinguishing human and non-human animal DNA sequences in mixed human and non-human animal tissues, wherein a PCR amplification of DNA is performed on a sample mixed human and non-human animal tissues using the composition of claim 6 or 7 or the kit of claim 8.
10. The method according to claim 9, comprising the steps of:
1) Extracting DNA from a sample of mixed human and non-human animal tissue using a combination and cellular DNA extraction kit;
2) Carrying out Taqman qPCR amplification using the composition of claim 6 or 7 or the primer and probe of claim 8;
3) Fluorescence signals are collected, a cycle threshold CT value is calculated, and the concentration of human DNA in the sample is calculated.
11. The method of claim 9 or 10, wherein the non-human animal is selected from the group consisting of rhesus, green monkey, cynomolgus monkey, rat, mouse, rabbit.
12. The method of claim 9 or 10, wherein the mixed human and non-human animal tissue is a tissue and blood sample of a non-human animal in which human DNA derived from human cells is mixed, and the non-human animal is a rhesus monkey.
13. The method of claim 12, wherein the human cells are human retinal pigment epithelial cells.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/790,490 US20230279504A1 (en) | 2019-12-30 | 2019-01-25 | A fluorescent quantitative PCR technology-based method for distinguishing human DNA |
| CN201911394885.7A CN111041106B (en) | 2019-12-30 | 2019-12-30 | Method for distinguishing human DNA based on fluorescent quantitative PCR technology |
| PCT/CN2021/073569 WO2021136559A1 (en) | 2019-12-30 | 2021-01-25 | Method for distinguishing human dna based on fluorescent quantitative pcr technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911394885.7A CN111041106B (en) | 2019-12-30 | 2019-12-30 | Method for distinguishing human DNA based on fluorescent quantitative PCR technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111041106A CN111041106A (en) | 2020-04-21 |
| CN111041106B true CN111041106B (en) | 2023-10-27 |
Family
ID=70241793
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911394885.7A Active CN111041106B (en) | 2019-12-30 | 2019-12-30 | Method for distinguishing human DNA based on fluorescent quantitative PCR technology |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20230279504A1 (en) |
| CN (1) | CN111041106B (en) |
| WO (1) | WO2021136559A1 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20230279504A1 (en) * | 2019-12-30 | 2023-09-07 | Eyecure Therapeutics, Inc. (Jiangsu) | A fluorescent quantitative PCR technology-based method for distinguishing human DNA |
| CN111471751B (en) * | 2020-06-05 | 2024-02-02 | 成都华西海圻医药科技有限公司 | Method for quantitatively detecting human DNA in animal blood or tissue |
| CN116103379A (en) * | 2023-01-18 | 2023-05-12 | 广东医科大学附属医院 | Detection method and application of human cells in animal body |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107960107A (en) * | 2015-06-15 | 2018-04-24 | 默多克儿童研究所 | The method for measuring chimerism |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7537889B2 (en) * | 2003-09-30 | 2009-05-26 | Life Genetics Lab, Llc. | Assay for quantitation of human DNA using Alu elements |
| CN101988123A (en) * | 2010-08-24 | 2011-03-23 | 中国医学科学院医学实验动物研究所 | Human mitochondria DNA specific fragment amplification detection method for human cells |
| WO2018101375A1 (en) * | 2016-11-30 | 2018-06-07 | 国立大学法人秋田大学 | Method for detecting human genomic dna |
| CN108384842B (en) * | 2018-02-27 | 2021-04-27 | 宁波海尔施基因科技有限公司 | Composite PCR amplification method for identifying species and human individual of unknown biological sample suspected to be human |
| CN110218770B (en) * | 2019-06-03 | 2023-09-12 | 上海爱萨尔生物科技有限公司 | Primer for specifically detecting humanized genome DNA and application thereof |
| US20230279504A1 (en) * | 2019-12-30 | 2023-09-07 | Eyecure Therapeutics, Inc. (Jiangsu) | A fluorescent quantitative PCR technology-based method for distinguishing human DNA |
-
2019
- 2019-01-25 US US17/790,490 patent/US20230279504A1/en active Pending
- 2019-12-30 CN CN201911394885.7A patent/CN111041106B/en active Active
-
2021
- 2021-01-25 WO PCT/CN2021/073569 patent/WO2021136559A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107960107A (en) * | 2015-06-15 | 2018-04-24 | 默多克儿童研究所 | The method for measuring chimerism |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2021136559A1 (en) | 2021-07-08 |
| US20230279504A1 (en) | 2023-09-07 |
| CN111041106A (en) | 2020-04-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111041106B (en) | Method for distinguishing human DNA based on fluorescent quantitative PCR technology | |
| CN110878343B (en) | Cpf1 kit for rapidly detecting genetic deafness pathogenic gene SLC26A4 mutation and detection method thereof | |
| WO2020243978A1 (en) | Primer for specific detection of human source genomic dna and application thereof | |
| AU2008216998A1 (en) | Method of detecting aneuploidy | |
| WO2023216707A1 (en) | Universal preclinical bio-distribution detection kit for nk cell therapy products | |
| CN113308544A (en) | Reagent for DNA methylation detection and esophageal cancer detection kit | |
| CN114350670B (en) | Aptamer capable of specifically recognizing soluble ST2 protein and application thereof | |
| CN113913530A (en) | Molecular marker related to sheep body height and application thereof | |
| CN115029444A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN111154892B (en) | Primer pair, kit, method and application for detecting sheep BMPR1B gene insertion/deletion polymorphism | |
| EP3805409B1 (en) | Quantitative pcr probe | |
| CN117089625A (en) | Specific humanized cell gene fragment, primer and probe for detecting same and application | |
| CN113930485B (en) | Reagent for detecting gene copy number variation and application thereof | |
| JP5301281B2 (en) | Organ-specific gene, identification method thereof and use thereof | |
| CN112063719B (en) | Marker for detecting or assisting in detecting retinal cone cells and application thereof | |
| CN117867032B (en) | Construction method and application of aplastic anemia zebra fish model | |
| CN108949968B (en) | A kind of mankind's liver fibrosis, liver cancer risk genes TNF-α polymorphic detection kit and its preparation method and application | |
| CN109486957A (en) | Pig multiple groups integrate accurate breeding method | |
| CN113249446B (en) | Nucleic acid isothermal amplification-based whole genome 5hmC level quantification method and application thereof | |
| TWI308595B (en) | Probe set, kit and method for sex determination of bovine or ovine cells | |
| CN113981058A (en) | Primer group, probe, kit and method for detecting human HLA-B8 gene | |
| CN108018285A (en) | A kind of hypersensitization primer and its design method and application | |
| CN114438219A (en) | Application of long-chain non-coding RNA as human embryonic stem cell marker | |
| WO2022058295A1 (en) | Method for diagnosing diseases induced by repeat expansion using optical mapping | |
| CN111440853A (en) | Primer group for rapidly detecting THRA gene mutation and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |