CN111012906B

CN111012906B - New application of collagen VI antibody

Info

Publication number: CN111012906B
Application number: CN201911342241.3A
Authority: CN
Inventors: 赵明
Original assignee: Guangzhou Wenrui Biotechnology Co ltd
Current assignee: Guangzhou Wenrui Biotechnology Co ltd
Priority date: 2019-12-23
Filing date: 2019-12-23
Publication date: 2023-11-07
Anticipated expiration: 2039-12-23
Also published as: CN111012906A

Abstract

The application discloses application of a collagen VI antibody in preparing a medicament for activating liver cells or restoring liver cell functions, application of the collagen VI antibody in preparing a medicament for preventing and treating liver function damage induced by reversing high-fat diet, and application of the collagen VI antibody in preparing a medicament for reversing ox-LDL induced reduced liver cell cholesterol antiport related protein expression and bile acid synthetase expression.

Description

New application of collagen VI antibody

Technical Field

The application relates to the field of biotechnology, in particular to a novel application of a collagen VI antibody.

Background

The applicant of the present application reports in a prior patent application (201710262718.1): apoE on high fat diet ^-/- Following treatment with collagen VI antibodies in mice, inflammation is differentiated into the correct direction, i.e. from Th 1-type disease to Th2, macrophages differentiate from M1 to type-transferred macrophages, i.e. M2 macrophages, phagocytose and ingest lipids in the plaque, and these phagocytosed lipids are transferred to ApoAI via the ATP-binding cassette (ABC) transporter ABCA 1. The plaque area of the antibody treated group was reduced by more than 40% compared to the control group.

ABCA1 is one of the most important components of proteins in the cholesterol reverse transport pathway (CRT). Classical CRT pathways include ABCA1, apolipoproteins (such as ApoAI and ApoAII) that transfer excess cholesterol from surrounding tissues to HDL, which carry lipids back to the liver. Hepatocytes selectively ingest HDL through their scavenger receptors, i.e., type I scavenger receptor class B SR-BI, and excrete lipids by synthesizing bile acids with cholesterol or subsequently secreting lipids into the bile, and eventually scavenge excess lipids by fecal forms. Thus, in order to be able to complete the plaque regression process by antibody therapy, it is necessary to activate inflammatory cells in a correct way to enable inflammatory cells, in particular macrophages, to take up lipids from the plaque, which is the first step, and the second step also needs to function as lipid, in particular cholesterol, reverse transport pathways, which would otherwise not be able to clear the lipids engulfed by M2 macrophages. During the course of experiments, the inventors of the present application found that protein levels of HDL receptor (SR-BI) and ApoAI, apoAII in the liver of mice after collagen VI antibody treatment, the expression of these proteins was restored by antibody therapy. Thus, antibody therapy can actually reactivate hepatocytes or restore their function through IgG1 Fc fragments.

Not all hepatocytes have receptors for the Fc fragment of the antibody, indeed, some hepatocytes have FcRn on the membrane. The major proteins in the CRT pathway have been reported to include ABCA1, SR-BI, apoAI, apoAII and the rate-limiting enzymes CYP7A1 and CYP27A1 for bile acid synthesis, both driving their expression by pparα/RXR transcription factor complexes. In the present application, the inventors examined whether CVI antibodies activate hepatocytes, particularly their CRT function, through FcRn→MAPKs→PPARα/RXR signaling pathways.

Disclosure of Invention

It is an object of the present application to provide novel actions of collagen VI antibodies.

The technical scheme for achieving the purpose is as follows.

The application of collagen VI antibody in preparing medicine for activating liver cell or restoring liver cell function.

Use of collagen VI antibodies in the manufacture of a medicament for the prevention and treatment of liver function damage induced by a reverse lipid diet.

In one embodiment, the collagen VI antibody is used in the preparation of a medicament for reversing ox-LDL (oxidized low-density lipoprotein, ox-LDL) induced reduced expression of hepatocyte cholesterol antiport related protein and/or bile acid synthetase.

In one embodiment, the collagen VI antibody is a sequence in which the amino acid sequences of CDR1, CDR2, and CDR3 of the heavy chain in the complementarity determining region are sequentially shown in SEQ ID No.1, SEQ ID No.2, and SEQ ID No.3, and zero, one, or more amino acids are substituted, and the activity is unchanged after substitution; and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 in sequence, and zero, one or more amino acids are substituted, and the activity is unchanged after substitution.

Further preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain in the complementarity determining region are the sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 in sequence; and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 in sequence.

In one embodiment, the heavy chain expression sequence of the collagen VI antibody is shown in SEQ ID NO.19, and the light chain expression sequence is shown in SEQ ID NO. 20.

In one embodiment, the collagen VI antibody is a sequence in which the amino acid sequences of CDR1, CDR2, and CDR3 of the heavy chain in the complementarity determining region are shown in SEQ ID No.7, SEQ ID No.8, and SEQ ID No.9 in sequence, and zero, one, or more amino acids are substituted, and the activity is unchanged after substitution; and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 in sequence, and zero, one or more amino acids are substituted, and the activity is unchanged after substitution. Further preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain in the complementarity determining region are the sequences shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9 in sequence; and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 in sequence.

The heavy chain expression sequence of the collagen VI antibody is shown as SEQ ID NO.21, and the light chain expression sequence is shown as SEQ ID NO. 22.

In the present application, the inventors found that in the case of abnormal liver cell function induced by a high-fat diet or oxidized LDL, the administration of immunoglobulin (collagen VI antibody) treatment interferes with immunity, and the function of liver cells, especially the expression of protein in the cholesterol reverse transport pathway in liver cells, is restored or enhanced, and then HDL is taken up, and the liver cells synthesize bile acid by using these cholesterol, and biliary excretion is performed through biliary tract, thereby discharging excessive lipids. Thus, we propose a new concept that the immune system may play an important role in maintaining or supporting hepatocyte function.

Our direct evidence now found is that the CVI mAb reverses high-fat diet-induced liver function impairment, and in vitro studies indicate that CVI mAb reverses ox-LDL-induced liver cell (HepG 2) cholesterol antiport protein expression and bile acid synthesis dysfunction. This may provide a clue to us to regulate or restore liver function, regulate lipid metabolism by balancing the immune system.

Drawings

FIG. 1 CVI Abs enhance SR-BI expression in liver and HepG2 cells.

FIG. 2 CVI Abs enhanced SR-BI protein expression is FcRn dependent.

FIG. 3 CVI antibody activates the MAPK-ERK1/2 signaling pathway.

FIG. 4 CVI Abs induced SR-BI and PPARα protein expression that was ERK1/2 and FcRn dependent.

FIG. 5 CVI antibody increases the uptake of Dil-HDL, while PD98059 inhibits it.

Figure 6 cvi Abs up-regulate apoaii and apoai protein expression.

Figure 7.Cvi Abs up-regulate expression of rate-limiting enzymes of bile acid synthesis CYP7A1 and CYP27A1 in HepG 2.

FIG. 8.14 Ab is a schematic representation of the results of enhancing bile acid excretion in the feces of HFD-fed apoE-/-mice.

Detailed Description

The following examples illustrate the standard laboratory practice of the inventors for purposes of illustrating the modes of the application and should not be construed as limiting the scope of these examples. These embodiments are described in order to provide an understanding of the present application, and a general level of skill in the art will appreciate that the following is given by way of example only, and that various alterations, modifications and adaptations can be made without exceeding the scope of the application. The techniques involved are, unless specifically stated otherwise, conventional techniques in various fields of molecular biology, cell biology, biochemistry and the like, which are well known to those skilled in the art.

The scheme of the present application will be explained below with reference to examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the present application and should not be construed as limiting the scope of the application. The specific techniques or conditions are not noted in the examples and are carried out according to the techniques or conditions described in the literature in the art (for example, refer to J. Sam Brookfield et al, code Huang Peitang et al, molecular cloning Experimental guidelines, third edition, scientific Press) or according to the product specifications. The reagents or apparatus used are conventional products available commercially, such as those available from Illumina corporation, without the manufacturer's knowledge.

Example 1

Materials and methods

Material

Dulbecco's modified version Eagle Medium (DMEM), RPMI 1640 medium, fetal Bovine Serum (FBS), phosphate Buffer (PBS) and HEPES were purchased from Invitrogen (Berlington, analogia, canada). TRIzol reagent was obtained from Takara Bio Inc. (Japan). 1,1 '-octadecyl-3, 3' -tetramethylindole carbocyanine perchlorate (Dil) -labeled HDL was obtained from Yi Yuan Biotechnology Co (Guangzhou, china). FcRn siRNA was designed and synthesized by GenePharma (su state of china). Antibodies recognizing P-ERK, P-P38 and P-JNK phosphorylation were from Cell Signaling Technology (Danver, massachusetts, U.S.A.). Antibodies recognizing SR-BI were purchased from Abcam (Cambridge, mass.). ERK inhibitors (PD 98059) were from Beyotidme (Beijing, china). Antibodies to FcRn, apoA-I, apoA-II and pparα were purchased from Proteintech Group, inc (rosomud, il.a.).

The collagen VI antibodies of the present application are all suitable, and the collagen VI antibodies can be a batch of phage monoclonal antibodies specifically binding to collagen VI obtained by enriching and screening a constructed atherosclerosis phage antibody library with collagen VI as a target, and in the following examples, the following anti-collagen VI fully human antibodies are exemplified.

The amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain in the complementarity determining region of the anti-collagen VI fully human antibody with the code number of 6Ab are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6; the amino acid sequences of CDR1, CDR2 and CDR3 of a heavy chain in a complementarity determining region of the anti-collagen VI fully human antibody with the code number of 14Ab are shown as SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9, and the amino acid sequences of CDR1, CDR2 and CDR3 of a light chain in a complementarity determining region are shown as SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO. 12; the code number 64Ab is a human antibody losing the binding capacity to collagen VI, the amino acid sequences of CDR1, CDR2 and CDR3 of a heavy chain in a complementarity determining region are shown as SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.15, and the amino acid sequences of CDR1, CDR2 and CDR3 of a light chain in a complementarity determining region are shown as SEQ ID NO.16, SEQ ID NO.17 and SEQ ID NO. 18. Specifically, the results are shown in Table 1.

Table 1: CDR sequences of each antibody:

6Ab heavy chain complete sequence:

ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATTCCCAGGTGCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACAATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGTCGCTCAGGATGATGCTTTTGATATCTGGGGCCAGGGGACAATGGTCACCGTCTCCTCAGCGTCGACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCTGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAATGATGA(SEQ ID NO.19)

6Ab light chain complete sequence:

ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATTCAGCCATCCGGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGCAGCTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCTCACTTTCGGCGGAGGGACCAAGCTGGAAATCAAACGTACGGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTACCCCAGAGAAGCCAAAGTGCAGTGGAAGGTGGACAACGCCCTGCAGAGCGGAAACAGCCAGGAAAGCGTGACAGAGCAGGATTCCAAGGATTCCACATACAGCCTGAGCAGCACACTGACACTGTCCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAAGTGACACACCAGGGACTGTCCTCCCCTGTGACAAAGAGCTTCAACAGAGGAGAATGCTGA(SEQ ID NO.20)

14Ab heavy chain complete sequence:

ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATTCCCAGGTGCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCCATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGAGTATTACTGTGCCCAAACTCTAACTGGGTATGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCGTCGACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCTGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAATGA(SEQ ID NO.21)

14Ab light chain complete sequence:

ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGT

GTACATTCAGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGCAGCTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTCCGACGTTCGGCCAAGGGACCAAGCTGGAAATCAAACGTACGGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTACCCCAGAGAAGCCAAAGTGCAGTGGAAGGTGGACAACGCCCTGCAGAGCGGAAACAGCCAGGAAAGCGTGACAGAGCAGGATTCCAAGGATTCCACATACAGCCTGAGCAGCACACTGACACTGTCCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAAGTGACACACCAGGGACTGTCCTCCCCTGTGACAAAGAGCTTCAACAGAGGAGAATGCTGA(SEQ ID NO.22)

the person skilled in the art can, based on his general knowledge, suitably modify the anti-collagen VI fully human antibodies identified above with the codes 6Ab and 14Ab, e.g. one or more amino acids may be substituted in the heavy chain H1, H2, H3 in the complementarity determining regions, but the activity is unchanged; or L1, L2, L3 of the light chain in the complementarity determining region, may have one or more amino acids substituted, but the activity is unchanged, i.e., the anti-collagen VI fully human antibody has the activity unchanged by making the appropriate amino acid substitution according to H1, H2, H3 and L1, L2, L3 of 6Ab or 14 Ab; such fully human anti-collagen VI antibodies, which are still active as described above, modified by conventional techniques, are also within the scope of the present application.

Cell culture

The human hepatoma cell line HepG2 was obtained from ATCC (marassas, usa) and grown in DMEM containing 10% fbs. Primary isolated cultured hepatocytes were obtained from 8 week old male C57/B6 mice by a two-step collagenase perfusion technique. Cells (4X 105) were plated in 35 mm rat tail collagen coated dishes containing 1640 medium with 20mM HEPES,1mM sodium pyruvate and 10% FBS added for 3 days prior to treatment. All cells were cultured in a cell incubator containing 5% CO2 and 95% air at a constant temperature of 37 ℃.

RNA isolation and RT-PCR analysis

Briefly, total RNA was extracted using TRIzol reagent according to the instructions. cDNA was obtained by reverse transcription using First-Strand cDNA Synthesis Kit (Genecopoeia, USA) and then PCR was performed on a real-time RT-PCR machine (ABI 7500, USA). GADPH was used as an internal control. The sequences of the primers used in the experiments were as follows: SR-BI forward direction, 5'-GAGAGGCTCGTCAACAAG-3' (SEQ ID NO. 23), and SR-BI antisense, 5'-GTCCATAGGATGATGTCAGTT-3' (SEQ ID NO. 24); GADPH sense 5'-GGCTCTCCAGAACATCATC-3 (SEQ ID NO. 25)' and GADPH antisense 5'-TCTTCCTCTTGTGCGCTTG-3' (SEQ ID NO. 26). Single DNA duplex was generated by melting curve analysis and quantitatively measured using the ΔΔct method.

Western blot analysis

Briefly, total protein was extracted and its concentration was then determined using BCA kit (beyotidme; beijing, china). Proteins were then separated by 10% SDS-PAGE (20. Mu.g per lane) and transferred onto PVDF membrane which was immunoblotted with antibodies against GAPDH, apoA-I, apoA-II and SR-BI. After a series of washes in TBS-T, the membrane was incubated with a peroxidase-conjugated secondary antibody. Finally, the proteins were visualized by enhanced chemiluminescence (ECL; merck Millipore, germany) and the relative expression levels were assessed by densitometry by Image J.

Cell transfection

According to the instructions, small interfering RNAs (sirnas) specific for human FcRn were transfected into approximately 80% fused HepG2 cells using lipofectamine 2000 (Invitrogen). Cells were harvested for western blot analysis 48 hours after transfection. Western blot analysis was used to assess silencing efficiency.

Luciferase reporter detection

A2.5 kb human SR-BI promoter fragment was amplified from the genome of the HepG2 cell line by PCR, and then cloned into the reporter vector pGL3-basic (Promega, USA), and a truncated SR-BI-Luc vector strategy was constructed in the same manner. Transfection experiments were performed in 24-well plates using Lipofectamine 2000 (Invitrogen). After 4 hours, luciferase activity was assessed using a dual luciferase reporter assay system (Promega) according to the manufacturer's instructions. Data are expressed as fold change (firefly luciferase activity/Renilla luciferase activity).

Dil-HDL uptake assay

Dil-HDL binding assays were performed to assess cholesterol uptake. After pretreatment with CVI antibody for 40min with 10. Mu. MPD98059, cells were incubated with 10. Mu.g/ml Dil-HDL for an additional 4 hours at 37 ℃. Adherent cells were then collected and washed 3 times with PBS. Analysis was performed on a FACScalibur flow cytometer (Becton Dickinson, franklin lake, new jersey) using Cell Quest Pro software (Becton Dickinson Biosciences).

Treatment of mice

apoE ^-/- Mice were fed free to eat in the 12 hour light/dark cycle. Male apoE ^-/- Mice (4 years old) were fed with high fat for 20 days, then transferred to normal feed for 1 week, and then intraperitoneally injected with 1mg of CVI antibody or PBS. The injections were repeated twice at 1 week intervals, mice were sacrificed 2 weeks after the last injection, and livers were isolated to detect the expression of SR-BI, apoA-I and ApoA-II. All animal procedures have been approved by the institutional animal care and use committee of south medical science and are conducted according to the guidelines for care and use of laboratory animals at the national institutes of health.

Statistical analysis

All data were from at least three independent experiments and analyzed by GraphPad Prism 6 software by one-way anova and Student-Newman-Keuls (SNK) post multiple comparison test. Results are expressed as mean ± Standard Deviation (SD). P <0.05 is considered statistically significant.

Experimental results

1.CVI Abs enhance SR-BI expression in liver and HepG2 cells.

In fig. 1, the experiment is: A. apoE-/-mice were fed high fat diet for 20 weeks and then changed to normal diet for 1 week, and then injected intraperitoneally with 1mg CVI antibody or PBS. The injections were repeated twice at 1 week intervals, and the mice were sacrificed 2 weeks after the last injection. Plaques were stained with oil red O and SR-BI protein expression in the liver of apoE-/-mice treated with PBS or CVI, respectively, was determined by Western blotting. C. HepG2 cells were treated with different doses of CVI antibody (14 th Ab) for 24h, d. HepG2 cells were treated with 100ug/ml CVI antibody (14 th Ab) for different times and E.HepG2 cells were treated with 100ug/ml CVI Abs for 24 hours. Following stimulation, proteins were collected from the cell lysates and subjected to western blot analysis to determine the expression level of SR-BI. GAPDH was used as an internal control. F. HepG2 cells were treated with 100. Mu.g/ml CVI Abs for 24 hours. After stimulation, cellular mRNA is extracted and reverse transcribed into cDNA. The cDNA was subjected to quantitative PCR to determine the transcription level of SR-BI. FITC-8 antibody was used as a control antibody.

As we reported previously, in this experiment, the area of resolved plaques was also over 40% after antibody treatment, and there was no significant difference in the protein level of SR-BI expression in liver tissue of PBS group compared to the unreacted control antibody (64 Ab) (FIG. 1A). However, SR-BI protein levels were significantly up-regulated in either 6Ab or 14Ab alone or in combination of both antibody groups (FIG. 1B). For this, we stimulated HepG2 cells in vitro, and SR-BI expression was dose-dependent (fig. 1C) and time-dependent (fig. 1D). Then, when CVI stimulated HepG2 cells for 24 hours, we again examined the protein level (FIG. 1E) and mRNA level (FIG. 1F) of SR-BI expression.

2.CVI Abs enhance SR-BI protein expression via FcRn.

In fig. 2, the experiment is: A. HepG2 cells were treated with transfection reagent, negative control siRNA and FcRn siRNA for 48 hours, respectively, and FcRn transcript levels and protein expression were detected by qPCR and western blot, respectively. C. HepG2 cells were transfected with FcRn siRNA for 48 hours and then treated with CVI antibody (100 ug/ml) for 24 hours. Following stimulation, proteins were collected from the cell lysates and subjected to western blot analysis to determine the expression level of SR-BI. GAPDH was used as an internal control.

Hepatocytes do not have many Fc receptors such as Fcγ -receptor-I, -II (including IIa and IIb), -III, etc. monocytes or macrophages have many Fc receptors. Hepatocytes have predominantly no Fc receptors, but of which about 20% express FcRn. Then, we blocked FcRn expression in HepG2 cells using siRNA and examined mRNA (fig. 2A) and protein levels (fig. 2B), and found that up-regulated expression of SR-BI was eliminated by interfering with the receptor FcRn of antibody Fc in hepatocytes.

3.CVI Abs activate the MAPK-ERK1/2 signaling pathway and are FcRn dependent.

Since the transcriptional activation function of PPAR granmar is MAPK dependent, we examined whether the antibodies activated MAPK.

In fig. 3, the experiment is: A. HepG2 cells were treated with CVI antibody (14 th Ab) at different times at 100 ug/ml. Following stimulation, proteins were collected from cell lysates and western blotted to determine activation of ERK 1/2. B. HepG2 cells were treated with 100. Mu.g/ml CVI antibody for 30min. Following stimulation, proteins were collected from cell lysates and Western blot was performed to determine activation of JNK, ERK1/2 and p 38. GAPDH was used as an internal control. Hepg2 (left) and mouse primary hepatocytes (right) were pretreated with PD98059 (10 uM) for 40min, d.hepg2 cells were transfected with FcRn siRNA for 48h, followed by 30min treatment with 100ug/ml CVI antibody. Following stimulation, proteins were collected from cell lysates and Western blot was performed to determine JNK, ERK and p38 activation.

Fig. 3A shows that collagen VI antibodies (14 Ab and 27 Ab) specifically activated ERK MAPK, but not p38 and JNK MAPK. Activation of ERK by CVI antibody was time dependent (fig. 3B), and ERK MAPK inhibitor PD98059 could specifically inhibit activation of ERK activation by CVI Abs (fig. 3C). Interference of FcRn expression abrogated ERK activation by CVI antibody stimulation in HepG2 cells (fig. 3D).

4. Activation of PPARs and overexpression of SR-BI are FcRn and ERK MAPK dependent.

In fig. 4, the experiment is: A. HepG2 cells were pre-treated with PD98059 (10 uM) for 40min, then b. HepG2 cells were transfected with control siRNA or FcRn siRNA for 48 hours, then treated with 100ug/ml CVI antibody for 24 hours. Following stimulation, proteins were collected from cell lysates and subjected to western blot analysis to determine expression of SR-BI and pparα. With the C.SR-BI promoter-Luc and D.SR-BI promoter->-Luc transfected HepG2 cells. PRL-TK plasmid was co-transfected as a transfection control. Cells were then treated with CVI Abs for 24 hours. Promoter activity was measured by relative luciferase activity, renilla luciferin being an internal reference.

FIG. 4A shows that CVI-induced SR-BI expression is inhibited by the phosphorylation levels of ERK MAPK-specific inhibitors PD98059 and PPARα. Since CVI antibody-induced SR-BI expression and ERK activation are both dependent on FcRn, we examined whether PPARα phosphorylation is also dependent on FcRn (FIG. 4B). Reporter gene analysis by using SR-BI promoter when the promoter has PPARα/RXR binding sitesWhen CVI antibody significantly activates SR-BI expression, the absence of promoter is +.>(FIGS. 4C and 4D).

5.CVI antibodies increase HDL uptake depending on ERK MAPK.

HepG2 cells were pretreated for 40min with or without PD98059 (20 uM), then treated with CVI Abs (100 ug/ml) for 24 hours, then incubated with 10ug/ml Dil-HDL for an additional 4h at 37 ℃. After stimulation, cells were fixed with 4% paraformaldehyde and incubated with DAPI. Images were taken using ZSIS fluorescence microscopy.

To confirm the importance of ERK MAPK in activating CVI antibody-induced expression of HDL receptor SR-BI, we then used Dil-labeled HDL to examine whether it was taken up by HepG2 cells. FIG. 5 shows that PD98059 significantly inhibits CVI antibody-induced uptake of HDL by HepG2 cells.

6.CVI Abs up-regulate apoAI and ApoAII expression and are also FcRn and ERK MAPK dependent.

Since pparα/RXR also regulates ApoAI and ApoAII expression, we also examined the expression of both proteins in animal models of CVI antibody treatment.

In fig. 6, the experiment is: A. apoE-/-mice treated with PBS or CVI antibodies were assayed for expression of the ApoA II and ApoA I proteins in the liver using western blot, using GAPDH as an internal control. B. Expression of ApoA II and ApoA I proteins in HepG2 cells treated with 100 μg/ml CVI antibody for 24 hours. HepG2 cells were pretreated with PD98059 for 40min and then with 100ug/ml CVI antibody for 24 hours to determine ApoA II expression. D. Transfection of ApoA II and ApoA i.f. hepg2 cells with control siRNA or FcRn siRNA for 48 hours, followed by treatment with 100 μg/ml CVI antibody for 24 hours.

Fig. 6A shows that either 6Ab or 14Ab alone or in combination up-regulates ApoAI and ApoAII protein expression in mouse liver tissue. In vitro studies showed that the protein level (fig. 6B) and mRNA level of CVI antibodies in HepG2 cells induced expression of both proteins. PD98059 and FcRn siRNA greatly reduced CVI antibody-induced expression of these two proteins, so CVI antibody-induced ApoAI and ApoAII are also FcRn and ERK MAPK dependent.

7.CVI Abs also up-regulated the expression of CYP7A1 and CYP27A1 in HepG 2.

We also examined the bile synthesis rate-limiting enzymes CYP7A1 and CYP27A1, whose expression was also driven by pparα/RXR complexes.

HepG2 cells were treated with 100ug/ml CVI antibody for 24 hours, after stimulation, mRNA from the cells was extracted and reverse transcribed into cDNA, which was subjected to quantitative PCR to determine the transcript levels of A.CYP7A1 and B.CYP27A1. We did not find differences in protein levels (data not shown), but there was a significant difference in mRNA levels when CVI antibodies stimulated HepG2 cells (fig. 7A and 7B).

apoE-/-mice were fed High Fat Diet (HFD) for 20 weeks, then transferred to normal diet for 1 week, and then injected intraperitoneally with 1mg CVI antibody (14 Ab) or PBS. The injections were repeated twice at 1 week intervals, and the mice were sacrificed 2 weeks after the last injection. Faeces were collected and bile acid (Total bile acid) was detected according to the instrument.

As can be seen from fig. 8, injection of 14Ab enhanced excretion of bile acids in HFD-fed apoE-/-mouse faeces.

In the description of the present specification, a description referring to terms "one embodiment," "some embodiments," "examples," "specific examples," or "some examples," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present application. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

Although embodiments of the present application have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the application, and that variations, modifications, alternatives, and variations may be made in the above embodiments by those skilled in the art without departing from the spirit and principles of the application.

SEQUENCE LISTING

<110> Guangzhou Wen Rui Biotech Co., ltd

<120> New use of collagen VI antibodies

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 12

<212> PRT

<213> 6Ab H1(Artificial Sequence)

<400> 1

Gly Gly Thr Phe Ser Ser Tyr Ala Ile Ser Trp Val

1 5 10

<210> 2

<211> 10

<212> PRT

<213> 6Ab H2(Artificial Sequence)

<400> 2

Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr

1 5 10

<210> 3

<211> 11

<212> PRT

<213> 6Ab H3(Artificial Sequence)

<400> 3

Ala Arg Val Ala Gln Asp Asp Ala Phe Asp Ile

1 5 10

<210> 4

<211> 12

<212> PRT

<213> 6Ab L1(Artificial Sequence)

<400> 4

Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln Gln

1 5 10

<210> 5

<211> 10

<212> PRT

<213> 6Ab L2(Artificial Sequence)

<400> 5

Ala Ala Ser Ser Leu Gln Ser Gly Val Pro

1 5 10

<210> 6

<211> 8

<212> PRT

<213> 6Ab L3(Artificial Sequence)

<400> 6

Gln Gln Ser Tyr Ser Thr Leu Thr

1 5

<210> 7

<211> 12

<212> PRT

<213> 14Ab H1(Artificial Sequence)

<400> 7

Gly Gly Thr Phe Ser Ser His Ala Ile Ser Trp Val

1 5 10

<210> 8

<211> 10

<212> PRT

<213> 14Ab H2(Artificial Sequence)

<400> 8

Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr

1 5 10

<210> 9

<211> 12

<212> PRT

<213> 14Ab H3

<400> 9

Ala Gln Thr Leu Thr Gly Tyr Asp Ala Phe Asp Ile

1 5 10

<210> 10

<211> 11

<212> PRT

<213> 14Ab L1(Artificial Sequence)

<400> 10

Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln

1 5 10

<210> 11

<211> 10

<212> PRT

<213> 14Ab L2(Artificial Sequence)

<400> 11

Ala Ala Ser Ser Leu Gln Ser Gly Val Pro

1 5 10

<210> 12

<211> 9

<212> PRT

<213> 14Ab L3(Artificial Sequence)

<400> 12

Gln Gln Ser Tyr Ser Thr Pro Pro Thr

1 5

<210> 13

<211> 12

<212> PRT

<213> 64Ab H2(Artificial Sequence)

<400> 13

Gly Phe Thr Phe Ser Ser Tyr Ala Met His Trp Val

1 5 10

<210> 14

<211> 10

<212> PRT

<213> 64Ab H2(Artificial Sequence)

<400> 14

Ile Ser Ser Asn Gly Gly Ser Thr Tyr Tyr

1 5 10

<210> 15

<211> 15

<212> PRT

<213> 64Ab H3(Artificial Sequence)

<400> 15

Val Lys Asp Pro Phe Trp Ser Gly Tyr Arg Asp Ala Phe Asp Ile

1 5 10 15

<210> 16

<211> 12

<212> PRT

<213> 64Ab L1(Artificial Sequence)

<400> 16

Gln Ser Val Ser Ser Ser Tyr Leu Ala Trp Tyr Gln

1 5 10

<210> 17

<211> 10

<212> PRT

<213> 64Ab L2(Artificial Sequence)

<400> 17

Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro

1 5 10

<210> 18

<211> 9

<212> PRT

<213> 64Ab L3(Artificial Sequence)

<400> 18

Gln Gln Tyr Gly Ser Ser Pro Tyr Thr

1 5

<210> 19

<211> 1407

<212> DNA

<213> 6Ab heavy chain complete sequence (Artificial Sequence)

<400> 19

atgggatggt catgtatcat cctttttcta gtagcaactg caaccggtgt acattcccag 60

gtgcagctgg tacagtctgg ggctgaggtg aagaagcctg ggtcctcggt gaaggtctcc 120

tgcaaggctt ctggaggcac cttcagcagc tatgctatca gctgggtgcg acaggcccct 180

ggacaagggc ttgagtggat gggagggatc atccctatct ttggtacagc aaactacgca 240

cagaagttcc agggcagagt cacaattacc gcggacgaat ccacgagcac agcctacatg 300

gagctgagca gcctgagatc tgaggacacg gccgtgtatt actgtgcgag agtcgctcag 360

gatgatgctt ttgatatctg gggccagggg acaatggtca ccgtctcctc agcgtcgacc 420

aagggcccat cggtcttccc cctggcaccc tcctccaaga gcacctctgg gggcacagcg 480

gccctgggct gcctggtcaa ggactacttc cccgaacctg tgacggtgtc gtggaactca 540

ggcgccctga ccagcggcgt gcacaccttc ccggctgtcc tacagtcctc aggactctac 600

tccctcagca gcgtggtgac cgtgccctcc agcagcttgg gcacccagac ctacatctgc 660

aacgtgaatc acaagcccag caacaccaag gtggacaaga aagttgagcc caaatcttgt 720

gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 780

ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 840

tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 900

ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcacgtac 960

cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag 1020

tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc caaagccaaa 1080

gggcagcccc gagaaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 1140

aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 1200

tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 1260

gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 1320

aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc 1380

ctctccctgt ctccgggtaa atgatga 1407

<210> 20

<211> 699

<212> DNA

<213> 6Ab light chain complete sequence (Artificial Sequence)

<400> 20

atgggatggt catgtatcat cctttttcta gtagcaactg caaccggtgt acattcagcc 60

atccggttga cccagtctcc atcctccctg tctgcatctg taggagacag agtcaccatc 120

acttgccggg caagtcagag cattagcagc tatttaaatt ggtatcagca gaaaccaggg 180

aaagccccta agctcctgat ctatgctgca tccagtttgc aaagtggggt cccatcaagg 240

ttcagtggca gtggatctgg gacagatttc actctcacca tcagcagtct gcaacctgaa 300

gattttgcaa cttactactg tcaacagagt tacagtaccc tcactttcgg cggagggacc 360

aagctggaaa tcaaacgtac ggtggctgca ccatctgtct tcatcttccc gccatctgat 420

gagcagttga aatctggaac tgcctctgtt gtgtgcctgc tgaataactt ctaccccaga 480

gaagccaaag tgcagtggaa ggtggacaac gccctgcaga gcggaaacag ccaggaaagc 540

gtgacagagc aggattccaa ggattccaca tacagcctga gcagcacact gacactgtcc 600

aaggccgact acgagaagca caaggtgtac gcctgcgaag tgacacacca gggactgtcc 660

tcccctgtga caaagagctt caacagagga gaatgctga 699

<210> 21

<211> 1407

<212> DNA

<213> 14Ab heavy chain complete sequence (Artificial Sequence)

<400> 21

atgggatggt catgtatcat cctttttcta gtagcaactg caaccggtgt acattcccag 60

gtgcagctgg tacagtctgg ggctgaggtg aagaagcctg ggtcctcggt gaaggtctcc 120

tgcaaggctt ctggaggcac cttcagcagc catgctatca gctgggtgcg acaggcccct 180

ggacaagggc ttgagtggat gggagggatc atccctatct ttggtacagc aaactacgca 240

cagaagttcc agggcagagt cacgattacc gcggacgaat ccacgagcac agcctacatg 300

gagctgagca gcctgagatc tgaggacacg gccgagtatt actgtgccca aactctaact 360

gggtatgatg cttttgatat ctggggccaa gggacaatgg tcaccgtctc ttcagcgtcg 420

accaagggcc catcggtctt ccccctggca ccctcctcca agagcacctc tgggggcaca 480

gcggccctgg gctgcctggt caaggactac ttccccgaac ctgtgacggt gtcgtggaac 540

tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 600

tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcaccca gacctacatc 660

tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agaaagttga gcccaaatct 720

tgtgacaaaa ctcacacatg cccaccgtgc ccagcacctg aactcctggg gggaccgtca 780

gtcttcctct tccccccaaa acccaaggac accctcatga tctcccggac ccctgaggtc 840

acatgcgtgg tggtggacgt gagccacgaa gaccctgagg tcaagttcaa ctggtacgtg 900

gacggcgtgg aggtgcataa tgccaagaca aagccgcggg aggagcagta caacagcacg 960

taccgtgtgg tcagcgtcct caccgtcctg caccaggact ggctgaatgg caaggagtac 1020

aagtgcaagg tctccaacaa agccctccca gcccccatcg agaaaaccat ctccaaagcc 1080

aaagggcagc cccgagaacc acaggtgtac accctgcccc catcccggga tgagctgacc 1140

aagaaccagg tcagcctgac ctgcctggtc aaaggcttct atcccagcga catcgccgtg 1200

gagtgggaga gcaatgggca gccggagaac aactacaaga ccacgcctcc cgtgctggac 1260

tccgacggct ccttcttcct ctacagcaag ctcaccgtgg acaagagcag gtggcagcag 1320

gggaacgtct tctcatgctc cgtgatgcat gaggctctgc acaaccacta cacgcagaag 1380

agcctctccc tgtctccggg taaatga 1407

<210> 22

<211> 702

<212> DNA

<213> 14Ab light chain complete sequence (Artificial Sequence)

<400> 22

atgggatggt catgtatcat cctttttcta gtagcaactg caaccggtgt acattcagac 60

atccagatga cccagtctcc atcctccctg tctgcatctg taggagacag agtcaccatc 120

acttgccggg caagtcagag cattagcagc tatttaaatt ggtatcagca gaaaccaggg 180

aaagccccta agctcctgat ctatgctgca tccagtttgc aaagtggggt cccatcaagg 240

ttcagtggca gtggatctgg gacagatttc actctcacca tcagcagtct gcaacctgaa 300

gattttgcaa cttactactg tcaacagagt tacagtaccc ctccgacgtt cggccaaggg 360

accaagctgg aaatcaaacg tacggtggct gcaccatctg tcttcatctt cccgccatct 420

gatgagcagt tgaaatctgg aactgcctct gttgtgtgcc tgctgaataa cttctacccc 480

agagaagcca aagtgcagtg gaaggtggac aacgccctgc agagcggaaa cagccaggaa 540

agcgtgacag agcaggattc caaggattcc acatacagcc tgagcagcac actgacactg 600

tccaaggccg actacgagaa gcacaaggtg tacgcctgcg aagtgacaca ccagggactg 660

tcctcccctg tgacaaagag cttcaacaga ggagaatgct ga 702

<210> 23

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 23

gagaggctcg tcaacaag 18

<210> 24

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

gtccatagga tgatgtcagt t 21

<210> 25

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 25

ggctctccag aacatcatc 19

<210> 26

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

tcttcctctt gtgcgcttg 19

Claims

1. Application of a collagen VI antibody in preparing a medicament for preventing and treating and reversing liver function damage induced by high fat diet, wherein the amino acid sequences of CDR1, CDR2 and CDR3 of a heavy chain in a complementarity determining region of the collagen VI antibody are sequentially shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3; and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 in sequence.

2. The use according to claim 1, wherein the heavy chain expression sequence of the collagen VI antibody is shown in SEQ ID No.19 and the light chain expression sequence is shown in SEQ ID No. 20.

3. The application of the collagen VI antibody in preparing medicaments for preventing and reversing liver function damage induced by high fat diet is characterized in that the amino acid sequences of CDR1, CDR2 and CDR3 of a heavy chain in a complementarity determining region are sequentially shown as sequences shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO. 9; and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 in sequence.

4. The use according to claim 3, wherein the heavy chain expression sequence of the collagen VI antibody is shown in SEQ ID No.21 and the light chain expression sequence is shown in SEQ ID No. 22.