CN111012906A

CN111012906A - Novel application of collagen VI antibody

Info

Publication number: CN111012906A
Application number: CN201911342241.3A
Authority: CN
Inventors: 赵明
Original assignee: Guangzhou Wenrui Biotechnology Co ltd
Current assignee: Guangzhou Wenrui Biotechnology Co ltd
Priority date: 2019-12-23
Filing date: 2019-12-23
Publication date: 2020-04-17
Anticipated expiration: 2039-12-23
Also published as: CN111012906B

Abstract

The invention discloses application of a collagen VI antibody in preparing a medicament for activating liver cells or recovering the functions of the liver cells, application of the collagen VI antibody in preparing a medicament for preventing and treating high-fat diet-induced liver function damage, and application of the collagen VI antibody in preparing a medicament for reversing ox-LDL induced reduction of hepatic cell cholesterol reverse transport related protein expression and bile acid synthetase expression.

Description

Novel application of collagen VI antibody

Technical Field

The invention relates to the field of biotechnology, in particular to a novel application of a collagen VI antibody.

Background

The applicant of the present application has reported in a previous patent application (201710262718.1): ApoE on high fat diet^-/-Following treatment with collagen VI antibody in mice, inflammation differentiates in the correct direction, i.e. from Th1 type disease to Th2, macrophages differentiate from M1 into type-shifted macrophages, i.e. M2 macrophages, phagocytose and uptake lipids in the plaque, and transfer these phagocytosed lipids to ApoAI via the ATP-binding cassette (ABC) transporter ABCA 1. The plaque area was reduced by more than 40% in the antibody-treated group compared to the control group.

ABCA1 is one of the most important components of proteins in the reverse cholesterol transport pathway (CRT). The classical CRT pathway involves ABCA1, an apolipoprotein that transfers excess cholesterol from surrounding tissues to HDL (e.g., ApoAI and ApoAII), which carries lipids back to the liver. Hepatocytes selectively take up HDL through their scavenger receptors, i.e., class I scavenger receptors class B SR-BI, and excrete lipids by synthesizing bile acids with cholesterol or subsequently secreting lipids into bile, and finally clear excess lipids through the form of feces. Therefore, in order to be able to carry out the plaque regression process by antibody therapy, it is necessary to activate the inflammatory cells in a correct way so that the inflammatory cells, in particular macrophages, can take up the lipids from the plaque, which is the first step, and the second step also needs to function as the reverse transport pathway for lipids, in particular cholesterol, which otherwise would not clear the lipids phagocytosed by M2 macrophages. In the course of experiments, the inventors of the present application found the protein levels of HDL receptor (SR-BI) and ApoAI, ApoAII in the liver of mice treated with collagen VI antibody, and the expression of these proteins was restored by antibody therapy. Thus, antibody therapy can actually reactivate hepatocytes or restore their function through the IgG1 Fc fragment.

Not all hepatocytes have receptors for antibody Fc fragments, indeed, some hepatocytes have FcRn on their membranes, it has been reported that the major proteins in the CRT pathway, including ABCA1, SR-BI, ApoAI, ApoAII and the rate-limiting enzymes of bile acid synthesis, CYP7a1 and CYP27a1, are driven by the PPAR α/RXR transcription factor complex.

Disclosure of Invention

One of the objects of the present invention is to provide a novel effect of collagen VI antibody.

The technical scheme for achieving the purpose is as follows.

The application of the collagen VI antibody in preparing a medicament for activating liver cells or restoring the functions of the liver cells.

Use of a collagen VI antibody in the manufacture of a medicament for the prevention or treatment of reversing high fat diet-induced liver function damage.

In one embodiment, the collagen VI antibody is used in the preparation of a medicament for reversing ox-LDL (oxidized low-density lipoprotein) induced decreased expression of a protein associated with reverse cholesterol transport in hepatocytes and/or expression of bile acid synthase.

In one embodiment, the collagen VI antibody is a sequence in which the amino acid sequences of CDR1, CDR2, and CDR3 of the heavy chain in the complementarity determining region are shown as SEQ ID No.1, SEQ ID No.2, and SEQ ID No.3, and zero, one, or more amino acids are substituted, and the activity is unchanged after the substitution; and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 in sequence, and zero, one or more amino acids are substituted, and the activity of the substituted sequence is unchanged.

Further preferably, the amino acid sequences of the CDR1, CDR2 and CDR3 of the heavy chain in the complementarity determining region are the sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 in sequence; and the amino acid sequences of the CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown as the sequences in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 in sequence.

In one embodiment, the collagen VI antibody has a heavy chain expression sequence as shown in SEQ ID NO.19 and a light chain expression sequence as shown in SEQ ID NO. 20.

In one embodiment, the collagen VI antibody is a sequence in which the amino acid sequences of CDR1, CDR2, and CDR3 of the heavy chain in the complementarity determining region are shown as SEQ ID No.7, SEQ ID No.8, and SEQ ID No.9, and zero, one, or more amino acids are substituted, and the activity is unchanged after the substitution; and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown as SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 in sequence, and zero, one or more amino acids are substituted, and the activity of the substituted sequence is unchanged. Further preferably, the amino acid sequences of the CDR1, CDR2 and CDR3 of the heavy chain in the complementarity determining region are the sequences shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9 in sequence; and the amino acid sequences of the CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown as the sequences in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 in sequence.

The heavy chain expression sequence of the collagen VI antibody is shown as SEQ ID NO.21, and the light chain expression sequence is shown as SEQ ID NO. 22.

In the present invention, the inventors have found that in the case of hepatic cell dysfunction induced by high-fat diet or oxidized LDL, treatment with immunoglobulin (collagen VI antibody) interferes with immunity, restores or enhances the function of hepatic cells, and particularly, proteins in the reverse cholesterol transport pathway are expressed in hepatic cells, and then HDL is taken up, and the hepatic cells synthesize bile acid using the cholesterol, excrete bile via the biliary tract, and thus excrete excessive lipids. Therefore, we propose a new concept that the immune system may play an important role in maintaining or supporting hepatocyte function.

Our current direct evidence found is that CVI mabs reverse high-fat diet-induced liver function impairment, and in vitro studies indicate that CVI mabs reverse ox-LDL induced hepatocyte (HepG2) cholesterol reverse transporter expression and bile acid synthesis dysfunction. This can provide a clue to us to regulate or restore liver function by balancing the immune system, regulating lipid metabolism.

Drawings

FIG. 1 CVI Abs enhance SR-BI expression in liver and HepG2 cells.

FIG. 2 CVI Abs enhance SR-BI protein expression is FcRn dependent.

FIG. 3 CVI antibody activates the MAPK-ERK1/2 signaling pathway.

FIG. 4 CVI Abs induced SR-BI and PPAR α protein expression to be ERK1/2 and FcRn dependent.

FIG. 5 CVI antibody increases the uptake of Dil-HDL, while PD98059 inhibits it.

FIG. 6 CVI Abs up-regulate ApoAII and ApoAII protein expression.

FIG. 7.CVI Abs up-regulate the expression of rate-limiting enzymes for bile acid synthesis of CYP7A1 and CYP27A1 in HepG 2.

FIG. 8.14 Ab is a graphical representation of the results of enhancing bile acid excretion in apoE-/-mouse feces fed HFD.

Detailed Description

The following examples illustrate standard laboratory practice of the inventors for illustrating the mode of the invention, and the invention should not be construed as being limited in scope to these examples. These examples are given by way of illustration only and it will be understood by those of ordinary skill in the art that various changes, modifications and adaptations may be made without departing from the scope of the invention as disclosed herein and as such are within the ordinary skill in the art. The techniques involved therein are, unless otherwise specified, conventional techniques in various fields of molecular biology, cell biology, biochemistry, and the like, which are well known to those skilled in the art.

The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not specify particular techniques or conditions, and are carried out according to techniques or conditions described in literature in the art (for example, refer to molecular cloning, a laboratory Manual, third edition, scientific Press, written by J. SammBruke et al, Huang Petang et al) or according to product instructions. The reagents or apparatus used are not indicated by the manufacturer, but are conventional products available commercially, for example from Illumina.

Example 1

Materials and methods

Material

Dulbecco's Modified Eagle Medium (DMEM), RPMI 1640 medium, Fetal Bovine Serum (FBS), Phosphate Buffered Saline (PBS) and HEPES purchased from Invitrogen (Burlington, Ontario, Canada.) TRIzol reagent from Takara Bio Inc. (Japan) 1,1' -octadecyl-3, 3,3', 3' -tetramethylindocarbocyanine perchlorate (Dil) labeled HDL was obtained from the Biotech company of origin, Guangzhou, Fcn siRNA, JN-ERK-recognizing P-P38 and P-FcRn phosphorylated antibody from Cell Signaling Technology, ApoF R, ApoBI, USA purchased from Abcam (Apocyn, Massachusetts.) ERK inhibitor (PD98059) from Beyotime (Apocyn technologies, Apocyn, North, Ishikyo, Okyo, One, Inc., PPAR alpha-I, Inc., Noninx, Inc., USA).

The collagen VI antibody of the present invention is suitable, and the constructed atherosclerosis phage antibody library can be enriched and screened by using collagen VI as a target to obtain a batch of phage monoclonal antibodies specifically binding to collagen VI, for example, the following anti-collagen VI fully human antibodies are exemplified in the following examples.

The anti-collagen VI fully human antibody with the code number of 6Ab has the amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain in the complementarity determining region as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6; the anti-collagen VI fully human antibody with the code number of 14Ab has the amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain in the complementarity determining region shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9, and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO. 12; the code number 64Ab is a human antibody which loses the binding capacity to the collagen VI, the amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain in the complementarity determining region are shown as SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.15, and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown as SEQ ID NO.16, SEQ ID NO.17 and SEQ ID NO. 18. Specifically, the results are shown in Table 1.

Table 1: CDR sequences of each antibody:

6Ab heavy chain complete sequence:

ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATTCCC AGGTGCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAA GGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCG ACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTAC AGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACAATTACCGCGGACGAATCCA CGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTAT TACTGTGCGAGAGTCGCTCAGGATGATGCTTTTGATATCTGGGGCCAGGGGACAATG GTCACCGTCTCCTCAGCGTCGACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCC TCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTT CCCCGAACCTGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCAC ACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACC GTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCC CAGCAACACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCAC ACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTT CCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCG TGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGA CGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGC ACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAA GGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCA TCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCC CGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTA TCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTAC AAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCT CACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGC ATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAA TGATGA(SEQID NO.19)

6Ab light chain complete sequence:

ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGT GTACATTCAGCCATCCGGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAG ACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGCAGCTATTTAAATTGGT ATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGC AAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTC ACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTAC AGTACCCTCACTTTCGGCGGAGGGACCAAGCTGGAAATCAAACGTACGGTGGCTGC ACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCT GTTGTGTGCCTGCTGAATAACTTCTACCCCAGAGAAGCCAAAGTGCAGTGGAAGGT GGACAACGCCCTGCAGAGCGGAAACAGCCAGGAAAGCGTGACAGAGCAGGATTCC AAGGATTCCACATACAGCCTGAGCAGCACACTGACACTGTCCAAGGCCGACTACGA GAAGCACAAGGTGTACGCCTGCGAAGTGACACACCAGGGACTGTCCTCCCCTGTG ACAAAGAGCTTCAACAGAGGAGAATGCTGA(SEQ ID NO.20)

14Ab heavy chain complete sequence:

ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGTGTACATTCCC AGGTGCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAA GGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCCATGCTATCAGCTGGGTGC GACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGT ACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATC CACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGAGT ATTACTGTGCCCAAACTCTAACTGGGTATGATGCTTTTGATATCTGGGGCCAAGGGA CAATGGTCACCGTCTCTTCAGCGTCGACCAAGGGCCCATCGGTCTTCCCCCTGGCAC CCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGAC TACTTCCCCGAACCTGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGT GCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGT GACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACA AGCCCAGCAACACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAAC TCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCC TCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACAT GCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGT GGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAAC AGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGG CAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAA ACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCC ATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCT TCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAA CTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAA GCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGA TGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGT AAATGA(SEQID NO.21)

14Ab light chain complete sequence:

ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACCGGT

GTACATTCAGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGA GACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGCAGCTATTTAAATTGG TATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTG CAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCT CACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTA CAGTACCCCTCCGACGTTCGGCCAAGGGACCAAGCTGGAAATCAAACGTACGGTGG CTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTG CCTCTGTTGTGTGCCTGCTGAATAACTTCTACCCCAGAGAAGCCAAAGTGCAGTGG AAGGTGGACAACGCCCTGCAGAGCGGAAACAGCCAGGAAAGCGTGACAGAGCAG GATTCCAAGGATTCCACATACAGCCTGAGCAGCACACTGACACTGTCCAAGGCCGA CTACGAGAAGCACAAGGTGTACGCCTGCGAAGTGACACACCAGGGACTGTCCTCCC CTGTGACAAAGAGCTTCAACAGAGGAGAATGCTGA(SEQ IDNO.22)

the person skilled in the art can appropriately modify the anti-collagen VI fully human antibodies with the 6Ab and 14Ab, for example, one or more amino acids of H1, H2, and H3 of the heavy chain in the complementarity determining region can be substituted without changing the activity thereof, based on his general knowledge; or one or more amino acids in L1, L2 and L3 of the light chain in the complementarity determining region can be substituted, but the activity is unchanged, namely, the anti-collagen VI fully human antibody with unchanged activity is subjected to appropriate amino acid substitution according to H1, H2, H3, L1, L2 and L3 of 6Ab or 14 Ab; such anti-collagen VI fully human antibodies, which are still active after modification of the conventional techniques, are also within the scope of the present invention.

Cell culture

Human hepatoma cell line HepG2 was obtained from ATCC (manassas, usa) and grown in DMEM containing 10% FBS. Primary isolated cultured hepatocytes were obtained from 8-week-old male C57/B6 mice by a two-step collagenase perfusion technique. Cells (4X 105) were plated on 35 mM rat tail collagen-coated plates containing 1640 medium supplemented with 20mM HEPES, 1mM sodium pyruvate and 10% FBS for 3 days prior to treatment. All cells were cultured in a cell incubator containing 5% CO2 and 95% air at a constant temperature of 37 ℃.

RNA isolation and RT-PCR analysis

Briefly, total RNA was extracted using TRIzol reagent according to the instructions. cDNA was obtained by reverse transcription using the First-Strand cDNAsynthesis Kit (Genencopoeia, USA), followed by PCR on a real-time RT-PCR machine (ABI7500, USA). GADPH was used as an internal control. The sequences of the primers used for the experiments were as follows: SR-BI forward, 5'-GAGAGGCTCGTCAACAAG-3' (SEQ ID NO.23), and SR-BI antisense, 5'-GTCCATAGGATGATGTCAGTT-3' (SEQ ID NO. 24); GADPH sense 5'-GGCTCTCCAGAACATCATC-3(SEQ ID NO.25)' and GADPH antisense 5'-TCTTCCTCTTGTGCGCTTG-3' (SEQ ID NO. 26). Single DNA duplexes were generated by melting curve analysis and quantified using the Δ Δ Ct method.

Western blot analysis

Briefly, total protein was extracted and its concentration was determined using BCA kit (Beyotime; Beijing, China). Proteins were then separated by 10% SDS-PAGE (20. mu.g per lane) and transferred to PVDF membrane, which was immunoblotted with antibodies against GAPDH, ApoA-I, ApoA-II and SR-BI. After a series of washes in TBS-T, the membranes were incubated with peroxidase-conjugated secondary antibodies. Finally, the proteins were visualized by enhanced chemiluminescence (ECL; Merck Millipore, Germany) and the relative expression levels were assessed by densitometry by Image J.

Cell transfection

Small interfering rna (sirna) specific for human FcRn was transfected into approximately 80% fused HepG2 cells using lipofectamine 2000(Invitrogen) according to the instructions. 48 hours after transfection, cells were harvested for Western blot analysis. Western blot analysis was used to assess silencing efficiency.

Luciferase reporter gene assay

A2.5 kb fragment of the human SR-BI promoter was amplified by PCR from the genome of the HepG2 cell line, cloned into the reporter vector pGL3-basic (Promega, USA) and the truncated SR-BI-Luc vector strategy was constructed in the same way. Transfection experiments were performed in 24-well plates using Lipofectamine TM 2000 (Invitrogen). After 4 hours, luciferase activity was assessed using the dual luciferase reporter assay system (Promega) according to the manufacturer's instructions. Data are expressed as fold change (firefly luciferase activity/renilla luciferase activity).

Dil-HDL uptake assay

Dil-HDL binding assays were performed to assess cholesterol uptake. After pretreatment with 10. mu.MPD 98059 for 40 minutes after treatment with CVI antibody, cells were incubated with 10. mu.g/ml Dil-HDL for an additional 4 hours at 37 ℃. Adherent cells were then collected and washed 3 times with PBS. Analysis was performed on a FACScalibur flow cytometer (Becton Dickinson, franklin lake, nj, usa) using Cell Quest Pro software (Becton Dickinson Biosciences).

Mouse treatment

Will apoE^-/-Mice were housed in a 12 hour light/dark cycle, with free access to food. Male apoE^-/-Mice (4 years old) were given high fat feeding for 20 days, then transferred to normal diet for 1 week, and then injected intraperitoneally with 1mg of CVI antibody or PBS. Repeating at 1 week intervalsTwo injections, mice were sacrificed 2 weeks after the last injection, and livers were isolated to detect the expression of SR-BI, ApoA-I and ApoA-II. All animal procedures were approved by the southern medical university committee for animal care and use and were conducted according to the guidelines for care and use of laboratory animals of the national institute of health.

Statistical analysis

All data were from at least three independent experiments and analyzed by GraphPad Prism 6 software by one-way anova and Student-Newman-keuls (snk) post hoc multiple comparison tests. Results are expressed as mean ± Standard Deviation (SD). P <0.05 was considered statistically significant.

Results of the experiment

First, CVI Abs enhance SR-BI expression in liver and HepG2 cells.

In fig. 1, the experiment is: A. and B. apoE-/-mice were fed high fat diet for 20 weeks, then replaced with normal diet for 1 week, and then mice were injected intraperitoneally with 1mg of CVI antibody or PBS. Two injections were repeated at 1 week intervals, and mice were sacrificed 2 weeks after the last injection. Plaques were stained with oil red O and the expression of SR-BI protein in the liver of apoE-/-mice treated with PBS or CVI, respectively, was determined by western blotting. C. HepG2 cells were treated with different doses of CVI antibody (14th Ab) for 24h, D. HepG2 cells were treated with CVI antibody (14th Ab) at different times at 100ug/ml and e.hepg2 cells were treated with CVI Abs at 100ug/ml for 24 hours. Following stimulation, proteins were collected from the cell lysates and subjected to western blot analysis to determine the expression level of SR-BI. GAPDH was used as an internal control. F. HepG2 cells were treated with 100. mu.g/ml of CVI Abs for 24 hours. After stimulation, the mRNA of the cells is extracted and reverse transcribed into cDNA. Quantitative PCR was performed on the cDNA to determine the SR-BI transcription level. FITC-8 antibody was used as a control antibody.

As we reported previously, the area of resolved plaques after antibody treatment was also over 40% in this experiment, nor was the protein level expressed by SR-BI significantly different in liver tissue of the PBS group compared to the unreacted control antibody (64Ab) (FIG. 1A). However, expression of SR-BI protein levels was significantly upregulated in either the 6Ab or 14Ab alone or the combination of the two antibody groups (fig. 1B). To this end, we stimulated HepG2 cells in vitro and SR-BI expression was dose-dependent (fig. 1C) and time-dependent (fig. 1D). Then, when the CVI antibody stimulated HepG2 cells for 24 hours, we again examined SR-BI expressed protein levels (fig. 1E) and mRNA levels (fig. 1F).

Secondly, CVI Abs enhance SR-BI protein expression by FcRn.

In fig. 2, the experiment is: A. HepG2 cells were treated with transfection reagent, negative control siRNA and FcRn siRNA for 48 hours, respectively, and FcRn transcript levels and protein expression were detected by qPCR and western blot, respectively. C. HepG2 cells were transfected with FcRn siRNA for 48h and then treated with CVI antibody (100ug/ml) for 24 h. Following stimulation, proteins were collected from the cell lysates and subjected to western blot analysis to determine the expression level of SR-BI. GAPDH was used as an internal control.

Hepatocytes do not have many Fc receptors such as monocytes or macrophages with Fc γ -receptors-I, -II (including IIa and IIb), -III, etc. Hepatocytes have mainly no Fc receptors, but about 20% of them express FcRn. Then, we blocked FcRn expression in HepG2 cells using siRNA and examined mRNA (fig. 2A) and protein levels (fig. 2B), and found that upregulation of SR-BI was abolished by interfering with the receptor FcRn of antibody Fc in hepatocytes.

Thirdly, CVI Abs activation of the MAPK-ERK1/2 signaling pathway is FcRn dependent.

Since the transcriptional activation function of PPAR gamma is MAPK dependent, we examined whether the antibody activates MAPK.

In fig. 3, the experiment is: A. HepG2 cells were treated with 100ug/ml of CVI antibody (14th Ab) at different times. Following stimulation, proteins were collected from cell lysates and subjected to western blotting to determine activation of ERK 1/2. B. HepG2 cells were treated with 100. mu.g/ml of CVI antibody for 30 minutes. Following stimulation, proteins were collected from cell lysates and Western blots were performed to determine activation of JNK, ERK1/2, and p 38. GAPDH was used as an internal control. Hepg2 (left) and mouse primary hepatocytes (right) were pre-treated with PD98059(10uM) for 40min, and d.hepg2 cells were transfected with FcRn siRNA for 48h, followed by treatment with 100ug/ml CVI antibody for 30 min. Following stimulation, proteins were collected from cell lysates and Western blots were performed to determine activation of JNK, ERK and p 38.

Figure 3A shows that collagen VI antibodies (14Ab and 27Ab) specifically activate ERK MAPK, but not p38 and JNK MAPK. Activation of ERK by CVI antibodies was time-dependent (fig. 3B), and activation of ERK activation by CVI Abs was specifically inhibited by ERK MAPK inhibitor PD98059 (fig. 3C). Interference of FcRn expression abolished ERK activation by CVI antibody stimulation in HepG2 cells (fig. 3D).

Activation of PPAR and overexpression of SR-BI are FcRn and ERK MAPK dependent.

In FIG. 4, the experiment was A. HepG2 cells were pretreated with PD98059(10uM) for 40 minutes, then B. HepG2 cells were transfected with control siRNA or FcRn siRNA for 48 hours, then treated with CVI antibody at 100ug/ml for 24 hours after stimulation, proteins were collected from cell lysates and subjected to Western blot analysis to determine the expression of SR-BI and PPAR α, and C.SR-BI promoter was used

Luc and D.SR-BI promoters

Luc transfected HepG2 cells. The PRL-TK plasmid was co-transfected as a transfection control. Cells were then treated with CVI Abs for 24 hours. Renilla luciferin was used as an internal reference by measuring promoter activity relative to luciferase activity.

FIG. 4A shows that CVI antibody-induced SR-BI expression is inhibited by phosphorylation levels of ERK MAPK specific inhibitors PD98059 and PPAR α since CVI antibody-induced SR-BI expression and ERK activation are both dependent on FcRn, we examined whether phosphorylation of PPAR α is also dependent on FcRn (FIG. 4B). by reporter gene analysis using the SR-BI promoter, when the promoter has a PPAR α/RXR binding site

When CVI antibody significantly activated SR-BI expressionWhile without a promoter is

(FIGS. 4C and 4D).

Fifth, CVI antibodies increase HDL uptake depending on ERK MAPK.

HepG2 cells were pre-treated for 40min with or without PD98059(20uM), then treated with CVI Abs (100ug/ml) for 24h, then incubated with 10ug/ml Dil-HDL for an additional 4h at 37 ℃. After stimulation, cells were fixed with 4% paraformaldehyde and incubated with DAPI. Images were taken using a ZSIS fluorescence microscope.

To confirm the importance of ERK MAPK in activating CVI antibody-induced expression of the HDL receptor SR-BI, we then used Dil-labeled HDL to check whether it was taken up by HepG2 cells. FIG. 5 shows that PD98059 significantly inhibits HDL uptake by HepG2 cells induced by CVI antibody.

Sixth, CVI Abs up-regulate ApoAI and ApoAII expression as well as FcRn and ERK MAPK dependent.

Since PPAR α/RXR also modulates ApoAI and ApoAII expression, we also examined the expression of both proteins in an animal model of CVI antibody therapy.

In fig. 6, the experiment is: A. expression of ApoA II and ApoA I proteins in the liver of apoE-/-mice treated with PBS or CVI antibodies was determined using western blots and GAPDH was used as an internal control. B. ApoA II and ApoA I protein expression in HepG2 cells treated with 100. mu.g/ml of CVI antibody for 24 hours. Hepg2 cells were pretreated with PD98059 for 40min and then with CVI antibody at 100ug/ml for 24h to determine ApoA II expression. D. Transfection of transcript levels of ApoA II and ApoA i.f. hepg2 cells with control siRNA or FcRn siRNA for 48 hours followed by treatment with CVI antibody at 100 μ g/ml for 24 hours.

Fig. 6A shows that either 6Ab or 14Ab alone or a combination thereof up-regulated ApoAI and ApoAII protein expression in mouse liver tissue. In vitro studies showed that protein levels (fig. 6B) and mRNA levels of CVI antibody in HepG2 cells induced the expression of both proteins. PD98059 and FcRn siRNA greatly reduced CVI antibody-induced expression of these two proteins, so CVI antibody-induced ApoAI and ApoAII were also FcRn and ERK MAPK dependent.

Seventhly, CVI Abs also up-regulate the expression of CYP7a1 and CYP27a1 in HepG 2.

We then also examined bile synthesis rate limiting enzymes CYP7a1 and CYP27a1, the expression of which is also driven by the PPAR α/RXR complex.

HepG2 cells were treated with 100ug/ml CVI antibody for 24 hours, after stimulation, mRNA of the cells was extracted and reverse transcribed to cDNA, which was subjected to quantitative PCR to determine the transcription levels of a.cyp7a1 and b.cyp27a 1. We did not find differences in protein levels (data not shown), but there were significant differences in mRNA levels when the CVI antibody stimulated HepG2 cells (fig. 7A and 7B).

apoE-/-mice were fed High Fat Diet (HFD) for 20 weeks, then transferred to normal diet for 1 week, and then injected intraperitoneally with 1mg of CVI antibody (14Ab) or PBS. Two injections were repeated at 1 week intervals, and mice were sacrificed 2 weeks after the last injection. Feces were collected and tested for bile acid (Total bile acid) according to the instrument.

As can be seen in FIG. 8, injection of 14Ab enhanced bile acid excretion in feces of HFD-fed apoE-/-mice.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made in the above embodiments by those of ordinary skill in the art without departing from the principle and spirit of the present invention.

SEQUENCE LISTING

<110> Guangzhou Wenry Biotechnology Ltd

New application of <120> collagen VI antibody

<160>26

<170>SIPOSequenceListing 1.0

<210>1

<211>12

<212>PRT

<213>6Ab H1(Artificial Sequence)

<400>1

Gly Gly Thr Phe Ser Ser Tyr Ala Ile Ser Trp Val

1 5 10

<210>2

<211>10

<212>PRT

<213>6Ab H2(Artificial Sequence)

<400>2

Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr

1 5 10

<210>3

<211>11

<212>PRT

<213>6Ab H3(Artificial Sequence)

<400>3

Ala Arg Val Ala Gln Asp Asp Ala Phe Asp Ile

1 5 10

<210>4

<211>12

<212>PRT

<213>6Ab L1(Artificial Sequence)

<400>4

Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln Gln

1 5 10

<210>5

<211>10

<212>PRT

<213>6Ab L2(Artificial Sequence)

<400>5

Ala Ala Ser Ser Leu Gln Ser Gly Val Pro

1 5 10

<210>6

<211>8

<212>PRT

<213>6Ab L3(Artificial Sequence)

<400>6

Gln Gln Ser Tyr Ser Thr Leu Thr

1 5

<210>7

<211>12

<212>PRT

<213>14Ab H1(Artificial Sequence)

<400>7

Gly Gly Thr Phe Ser Ser HisAla Ile Ser Trp Val

1 5 10

<210>8

<211>10

<212>PRT

<213>14Ab H2(Artificial Sequence)

<400>8

Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr

1 5 10

<210>9

<211>12

<212>PRT

<213>14Ab H3

<400>9

Ala Gln Thr Leu Thr Gly Tyr Asp Ala Phe Asp Ile

1 5 10

<210>10

<211>11

<212>PRT

<213>14Ab L1(Artificial Sequence)

<400>10

Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln

1 5 10

<210>11

<211>10

<212>PRT

<213>14Ab L2(Artificial Sequence)

<400>11

Ala Ala Ser Ser Leu Gln Ser Gly Val Pro

1 5 10

<210>12

<211>9

<212>PRT

<213>14Ab L3(Artificial Sequence)

<400>12

Gln Gln Ser Tyr Ser Thr Pro Pro Thr

1 5

<210>13

<211>12

<212>PRT

<213>64Ab H2(Artificial Sequence)

<400>13

Gly Phe Thr Phe Ser Ser Tyr Ala Met His Trp Val

1 5 10

<210>14

<211>10

<212>PRT

<213>64Ab H2(Artificial Sequence)

<400>14

Ile Ser Ser Asn Gly Gly Ser Thr Tyr Tyr

1 5 10

<210>15

<211>15

<212>PRT

<213>64Ab H3(Artificial Sequence)

<400>15

Val Lys Asp Pro Phe Trp Ser Gly Tyr Arg Asp Ala Phe Asp Ile

1 5 10 15

<210>16

<211>12

<212>PRT

<213>64Ab L1(Artificial Sequence)

<400>16

Gln Ser Val Ser Ser Ser Tyr Leu Ala Trp Tyr Gln

1 5 10

<210>17

<211>10

<212>PRT

<213>64Ab L2(Artificial Sequence)

<400>17

Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro

1 5 10

<210>18

<211>9

<212>PRT

<213>64Ab L3(Artificial Sequence)

<400>18

Gln Gln Tyr Gly Ser Ser Pro Tyr Thr

1 5

<210>19

<211>1407

<212>DNA

<213>6Ab heavy chain complete Sequence (Artificial Sequence)

<400>19

atgggatggt catgtatcat cctttttcta gtagcaactg caaccggtgt acattcccag 60

gtgcagctgg tacagtctgg ggctgaggtg aagaagcctg ggtcctcggt gaaggtctcc 120

tgcaaggctt ctggaggcac cttcagcagc tatgctatca gctgggtgcg acaggcccct 180

ggacaagggc ttgagtggat gggagggatc atccctatct ttggtacagc aaactacgca 240

cagaagttccagggcagagt cacaattacc gcggacgaat ccacgagcac agcctacatg 300

gagctgagca gcctgagatc tgaggacacg gccgtgtatt actgtgcgag agtcgctcag 360

gatgatgctt ttgatatctg gggccagggg acaatggtca ccgtctcctc agcgtcgacc 420

aagggcccat cggtcttccc cctggcaccc tcctccaaga gcacctctgg gggcacagcg 480

gccctgggct gcctggtcaa ggactacttc cccgaacctg tgacggtgtc gtggaactca 540

ggcgccctga ccagcggcgt gcacaccttc ccggctgtcc tacagtcctc aggactctac 600

tccctcagca gcgtggtgac cgtgccctcc agcagcttgg gcacccagac ctacatctgc 660

aacgtgaatc acaagcccag caacaccaag gtggacaaga aagttgagcc caaatcttgt 720

gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 780

ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 840

tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 900

ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcacgtac 960

cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag 1020

tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc caaagccaaa 1080

gggcagcccc gagaaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 1140

aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 1200

tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 1260

gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 1320

aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc 1380

ctctccctgt ctccgggtaa atgatga 1407

<210>20

<211>699

<212>DNA

<213>6Ab light chain complete Sequence (Artificial Sequence)

<400>20

atgggatggt catgtatcat cctttttcta gtagcaactg caaccggtgt acattcagcc 60

atccggttga cccagtctcc atcctccctg tctgcatctg taggagacag agtcaccatc 120

acttgccggg caagtcagag cattagcagc tatttaaatt ggtatcagca gaaaccaggg 180

aaagccccta agctcctgat ctatgctgca tccagtttgc aaagtggggt cccatcaagg 240

ttcagtggca gtggatctgg gacagatttc actctcacca tcagcagtct gcaacctgaa 300

gattttgcaa cttactactg tcaacagagt tacagtaccc tcactttcgg cggagggacc 360

aagctggaaa tcaaacgtac ggtggctgca ccatctgtct tcatcttccc gccatctgat 420

gagcagttga aatctggaac tgcctctgtt gtgtgcctgc tgaataactt ctaccccaga 480

gaagccaaag tgcagtggaa ggtggacaac gccctgcaga gcggaaacag ccaggaaagc 540

gtgacagagc aggattccaa ggattccaca tacagcctga gcagcacact gacactgtcc 600

aaggccgact acgagaagca caaggtgtac gcctgcgaag tgacacacca gggactgtcc 660

tcccctgtga caaagagctt caacagagga gaatgctga 699

<210>21

<211>1407

<212>DNA

<213>14Ab heavy chain complete Sequence (Artificial Sequence)

<400>21

atgggatggt catgtatcat cctttttcta gtagcaactg caaccggtgt acattcccag 60

gtgcagctgg tacagtctgg ggctgaggtg aagaagcctg ggtcctcggt gaaggtctcc 120

tgcaaggctt ctggaggcac cttcagcagc catgctatca gctgggtgcg acaggcccct 180

ggacaagggc ttgagtggat gggagggatc atccctatct ttggtacagc aaactacgca 240

cagaagttcc agggcagagt cacgattacc gcggacgaat ccacgagcac agcctacatg 300

gagctgagca gcctgagatc tgaggacacg gccgagtatt actgtgccca aactctaact 360

gggtatgatg cttttgatat ctggggccaa gggacaatgg tcaccgtctc ttcagcgtcg 420

accaagggcc catcggtctt ccccctggca ccctcctcca agagcacctc tgggggcaca 480

gcggccctgg gctgcctggt caaggactac ttccccgaac ctgtgacggt gtcgtggaac 540

tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 600

tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcaccca gacctacatc 660

tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agaaagttga gcccaaatct 720

tgtgacaaaa ctcacacatg cccaccgtgc ccagcacctg aactcctggg gggaccgtca 780

gtcttcctct tccccccaaa acccaaggac accctcatga tctcccggac ccctgaggtc 840

acatgcgtgg tggtggacgt gagccacgaa gaccctgagg tcaagttcaa ctggtacgtg 900

gacggcgtgg aggtgcataa tgccaagaca aagccgcggg aggagcagta caacagcacg 960

taccgtgtgg tcagcgtcct caccgtcctg caccaggact ggctgaatgg caaggagtac 1020

aagtgcaagg tctccaacaa agccctccca gcccccatcg agaaaaccat ctccaaagcc 1080

aaagggcagc cccgagaacc acaggtgtac accctgcccc catcccggga tgagctgacc 1140

aagaaccagg tcagcctgac ctgcctggtc aaaggcttct atcccagcga catcgccgtg 1200

gagtgggaga gcaatgggca gccggagaac aactacaaga ccacgcctcc cgtgctggac 1260

tccgacggct ccttcttcct ctacagcaag ctcaccgtgg acaagagcag gtggcagcag 1320

gggaacgtct tctcatgctc cgtgatgcat gaggctctgc acaaccacta cacgcagaag 1380

agcctctccc tgtctccggg taaatga 1407

<210>22

<211>702

<212>DNA

<213>14Ab light chain complete Sequence (Artificial Sequence)

<400>22

atgggatggt catgtatcat cctttttcta gtagcaactg caaccggtgt acattcagac 60

atccagatga cccagtctcc atcctccctg tctgcatctg taggagacag agtcaccatc 120

acttgccggg caagtcagag cattagcagc tatttaaatt ggtatcagca gaaaccaggg 180

aaagccccta agctcctgat ctatgctgca tccagtttgc aaagtggggt cccatcaagg 240

ttcagtggca gtggatctgg gacagatttc actctcacca tcagcagtct gcaacctgaa 300

gattttgcaa cttactactg tcaacagagt tacagtaccc ctccgacgtt cggccaaggg 360

accaagctgg aaatcaaacg tacggtggct gcaccatctg tcttcatctt cccgccatct 420

gatgagcagt tgaaatctgg aactgcctct gttgtgtgcc tgctgaataa cttctacccc 480

agagaagcca aagtgcagtg gaaggtggac aacgccctgc agagcggaaa cagccaggaa 540

agcgtgacag agcaggattc caaggattcc acatacagcc tgagcagcac actgacactg 600

tccaaggccg actacgagaa gcacaaggtg tacgcctgcg aagtgacaca ccagggactg 660

tcctcccctg tgacaaagag cttcaacaga ggagaatgct ga 702

<210>23

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

gagaggctcg tcaacaag 18

<210>24

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

gtccatagga tgatgtcagt t 21

<210>25

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

ggctctccag aacatcatc 19

<210>26

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>26

tcttcctctt gtgcgcttg 19

Claims

1. The application of the collagen VI antibody in preparing a medicament for activating liver cells or restoring the functions of the liver cells.

2. Application of the collagen VI antibody in preparing a medicine for reversing ox-LDL induced reduction of reverse cholesterol transport related protein expression and/or bile acid synthetase expression of liver cells.

3. Use of a collagen VI antibody in the manufacture of a medicament for the prevention or treatment of reversing high fat diet-induced liver function damage.

4. The use according to any one of claims 1 to 3, wherein the collagen VI antibody is a phage monoclonal antibody specifically binding to collagen VI, which is obtained by enriching and screening the constructed atherosclerosis phage antibody library with collagen VI as a target.

5. The use according to claim 4, wherein the collagen VI antibody is a sequence in which the amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain in the complementarity determining region are shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, and zero, one or more amino acids are substituted, and the activity is unchanged after the substitution; and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 in sequence, and zero, one or more amino acids are substituted, and the activity of the substituted sequence is unchanged.

6. The use according to claim 5, wherein the amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain in the complementarity determining region of the collagen VI antibody are the sequences shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, respectively; and the amino acid sequences of the CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown as the sequences in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 in sequence.

7. The use according to claim 4, wherein the collagen VI antibody has a heavy chain expression sequence as shown in SEQ ID No.19 and a light chain expression sequence as shown in SEQ ID No. 20.

8. The use according to claim 14, wherein the collagen VI antibody is a sequence in which the amino acid sequences of CDR1, CDR2, and CDR3 of the heavy chain in the complementarity determining region are shown in SEQ ID No.7, SEQ ID No.8, and SEQ ID No.9, respectively, and zero, one, or more amino acids are substituted, and the activity is unchanged after the substitution; and the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown as SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 in sequence, and zero, one or more amino acids are substituted, and the activity of the substituted sequence is unchanged.

9. The use according to claim 8, wherein the amino acid sequences of the CDR1, CDR2 and CDR3 of the heavy chain in the complementarity determining region are the sequences shown in SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9, in that order; and the amino acid sequences of the CDR1, CDR2 and CDR3 of the light chain in the complementarity determining region are shown as the sequences in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 in sequence.

10. The use according to claim 4, wherein the collagen VI antibody has a heavy chain expression sequence as shown in SEQ ID No.21 and a light chain expression sequence as shown in SEQ ID No. 22.