CN110951922A

CN110951922A - RAA primer probe for detecting Hendra virus and detection method

Info

Publication number: CN110951922A
Application number: CN201911402509.8A
Authority: CN
Inventors: 吴晓东; 樊晓旭; 赵洋; 胡永新; 蔡禹希; 郭利川; 应清界; 李林; 赵永刚; 王志亮; 马洪超
Original assignee: Jiangsu Qitian Gene Biotechnology Co ltd; CHINA ANIMAL HEALTH AND EPIDEMIOLOGY CENTER
Current assignee: Jiangsu Qitian Gene Biotechnology Co ltd; CHINA ANIMAL HEALTH AND EPIDEMIOLOGY CENTER
Priority date: 2019-12-25
Filing date: 2019-12-31
Publication date: 2020-04-03

Abstract

The invention discloses a primer, a probe and a detection method for detecting Hendra virus by an RAA fluorescence method, wherein the primer and the probe are suitable for RAA fluorescence method detection, can accurately detect Hendra virus plasmids, have no cross reaction with Nipah virus plasmids, equine influenza virus, equine arteritis virus and equine infectious anemia virus, and have 100% specificity; the detection method is rapid, high throughput is easy to realize, and detection time and detection cost are reduced at the same time.

Description

RAA primer probe for detecting Hendra virus and detection method

Technical Field

The invention belongs to the technical field of virus detection, and particularly relates to a primer, a probe and a detection method for detecting Hendra virus by an RAA fluorescence method.

Background

Hendra virus (HeV) can cause acute febrile diseases, horses are characterized by fever, accelerated respiratory rate, and massive nasal secretion outflow, sometimes with jaundice and neurological symptoms, and ultimately death. Horses are the only livestock naturally infected with HeV, humans can also be infected with HeV, which is the natural host for HeV. HeV is a member of the subfamily paramyxoviridae of the family paramyxoviridae, originally called equine measles virus, which was later reclassified as henipa. In the initial outbreak, the horse trainer may inadvertently pass the virus to the horse or to another person due to close contact with the horse. In horses, the incidence of HeV is low and the mortality is high. The outbreak of the feed additive in australia and other areas brings great threat to the life safety of human beings and horses in epidemic areas and causes huge economic loss.

Given the widespread and high mortality rate following infection of the HeV host, it is classified by the U.S. CDC and WHO as the highest risk viral bio-safety class four (BSL-4) pathogen and is considered a potential bioterrorism weapon. At present, no natural HeV infection cases in China are reported at home and abroad, but the modern horse racing industry in China is still in the initial stage, and parts of the regions have horse breeding bases which have necessary propagation conditions, but the existence of recessive infection cannot be ignored. With the continuous rise of new projects such as the marbles in China, the transition from the sport type to the entertainment type in China enters a substantial stage, the risk of introducing the disease is increased day by day, the gap of the HeV detection requirement in China is increased due to the bottleneck of the detection technology, and therefore, the enhancement of the research and monitoring of the HeV detection technology has important significance for the development of the rising Chinese horse racing industry.

The current diagnostic methods for HeV include several:

1) on-site diagnostics

In areas infected with HeV, the horse should be suspected of sudden death, severe respiratory disease with clinical symptoms, and a post-mortem necropsy with pulmonary edema lesions.

2) Laboratory diagnostics

The most sensitive to vero cells and PK-13 cells, HeV, is useful for virus isolation. But in fact, HeV can be cultured on a variety of tissue cells. Typical cytopathic effects (CPE) are present within 3d and virus identification can be performed by fluorescent antibody detection assays, electron microscopy and molecular detection. Antibodies in acute and convalescent serum can be detected using a virus neutralization assay or indirect ELISA.

In the conventional virus detection method, virus separation and identification and Serum Neutralization Test (SNT) are difficult to widely use and are not suitable for large-scale epidemiological investigation or on-site rapid diagnosis. Enzyme-linked immunosorbent assay (ELISA) has poor specificity, cross reaction exists, and false positive is easy to occur. Although the fluorescence quantitative PCR method has high specificity and sensitivity and good repeatability, the problems of expensive and huge instruments and high requirements on experimental sites and personnel still exist, the fluorescence quantitative PCR method is difficult to be suitable for large-scale on-site screening, and the detection time is long and needs 1-2 hours. All of the above methods are not suitable for performing under field conditions or at quarantine stations and require highly skilled personnel and a fully equipped laboratory; therefore, based on the defects of long time, inconvenient operation, high false positive and the like of the existing detection technology, the technical staff in the field needs to solve the problem of providing an RAA fluorescence method which is accurate, sensitive, simple and convenient to operate and suitable for rapidly detecting the HeV on site.

Disclosure of Invention

In view of the above, the invention provides a primer, a probe and a detection method for detecting HeV by RAA fluorescence method, which can realize detection of HeV within 20min at 39 ℃, and have the characteristics of rapidness, sensitivity, simple and convenient operation and suitability for rapid field detection.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention firstly provides a primer and a probe for detecting the amplification of a HeV by an RAA fluorescence method, wherein the primer is used for detecting a fragment with a sequence of SEQ ID NO. 1, and the probe detects a product amplified by the primer;

specifically, the primer comprises:

an upstream primer: 5'-CTGATGGAGGTAAAGAAAGGCGGATCAGCTAAAG-3' (SEQ ID NO: 5);

a downstream primer: 5'-CAGCCCTTTGATGGTATTGAGATCACTCTGGAAC-3' (SEQ ID NO: 7);

the invention also provides a probe for detecting the primer amplification product, wherein the sequence of the probe is as follows:

5’-GTCGAGGAAACAGGAATGGCCGGCTTCTTTGCGACTATCAGATTCGGTCTTGA-3’(SEQ IDNO：9)；

the probe is modified by adopting a fluorescent reporter group and a fluorescent quenching group, and the fluorescent reporter group is modified at the position 35bp away from the 5' end base number of the probe sequence; the fluorescence quenching group is modified on the position 15bp away from the 3' end base number of the probe sequence, 1 base A is arranged between the fluorescence reporting group and the quenching group, wherein A is replaced by idSp;

the modified probe is as follows:

5’-GTCGAGGAAACAGGAATGGCCGGCTTCTTTGCGAC/i6FAMdT//idSp//iBHQ1dT/CAGATTCGGTCTTGA-3’。

further, the fluorescent reporter group is FAM, HEX, TET, JOE or VIC; the fluorescence quenching group is BHQ1, BHQ2 or BHQ 3.

Preferably, the fluorescent reporter group is FAM; the fluorescence quenching group is BHQ 1.

The primer and the probe are used for preparing an RAA fluorescence detection kit.

Further, the invention also provides a method for detecting HeV by using an RAA fluorescence method, which comprises the following specific steps:

1) extracting a nucleic acid sample of an object to be detected;

2) switching on a power supply to preheat the constant-temperature fluorescent gene detector, and setting reaction parameters; the reaction parameters were set at 39 ℃, reaction time: 20 min;

3) adding 13.7 muL of water, 2.1 muL of the upstream and downstream primers and 0.6 muL of the probe with the concentration of 15 muM into 25 muL of reaction buffer solution, fully mixing, adding into the RAA fluorescence basic reaction reagent, and mixing to obtain reaction premix;

4) 2.5. mu.L of Mg was added to the reaction tube cap²⁺Fully mixing 4 mu L of the nucleic acid sample obtained in the step 1) with the reaction premixed solution obtained in the step 3), and putting the obtained reaction system into a constant-temperature fluorescent gene detector to detect a fluorescent signal;

5) according to the positive determination method in the RAA-F1620 detection apparatus, it can be determined that the curve amplified by the forward primer and the backward primer is positive when the relative fluorescence value of the curve amplified by the forward primer and the backward primer is more than 1500mV, and the curve amplified by the forward primer and the backward primer is negative when the relative fluorescence value is less than 1500mV without a significant amplification curve.

Further, the use concentration of the upstream primer and the downstream primer is 1-50 mu M.

Preferably, the upstream primer and the downstream primer are used at a concentration of 15. mu.M.

Furthermore, the concentration of the probe is 1-50 mu M.

Preferably, the concentration of the probe is 15. mu.M.

Compared with the prior art, the invention has the following advantages:

1) the primer and the probe provided by the invention are suitable for RAA fluorescence method detection, and can accurately detect HeV, and have no cross reaction with NiV plasmid, Equine Influenza Virus (EIV), Equine Arteritis Virus (EAV) and Equine Infectious Anemia Virus (EIAV), and the specificity reaches 100%;

2) the detection method provided by the invention is rapid, high flux is easy to realize, and meanwhile, the detection time and the detection cost are reduced, the method for rapidly detecting the HeV based on the RAA fluorescence method provided by the invention has high sensitivity, and the reaction detection sensitivity reaches 39 copies/reaction under the probability of 95%;

3) the method for rapidly detecting the HeV by the RAA fluorescence method can conveniently, rapidly and accurately identify the HeV, is simple and convenient to operate, has short detection time, and can complete detection within 20 min; the DNA is annealed after being uncoiled and finally re-extended by high-temperature denaturation without PCR, and the detection can be finished by only carrying out isothermal amplification at 39 ℃; the amplification is carried out without using 4-6 primers like LAMP technology, and false positive is easy to generate.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1: the invention relates to a primer probe combination screening result chart;

FIG. 2: the invention is a HeV sensitivity detection result graph after single serial plasmid dilution;

FIG. 3: the invention HeV plasmid sensitivity probability regression analysis chart;

FIG. 4: the invention HeV plasmid repeatability test result chart;

FIG. 5: the specificity detection result diagram of the HeV plasmid of the invention;

FIG. 6: the invention relates to a detection result graph of a HeV clinical sample.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

Selecting a HeV N gene conserved sequence to carry out primer and probe design, finding a corresponding whole gene sequence in Genebank (www.ncbi.nlm.nih.gov), and screening out the HeVN gene highly conserved sequence by using DNASTAR software to carry out homology analysis and Blast sequence analysis as follows:

CTGATGGAGGTAAAGAAAGGCGGATCAGCTAAAGGAAGGGCCGTTGAGATAATATCTGACATAGGAAATTATGTCGAGGAAACAGGAATGGCCGGCTTCTTTGCGACTATCAGATTCGGTCTTGAAACAAGATACCCTGCACTTGCCCTCAATGAGTTCCAGAGTGATCTCAATACCATCAAAGGGCTGATGCTGCTCTACAGAGAAATAGGGCCTCGAG(SEQ ID NO.1)；

and (3) taking the highly conserved sequence obtained by screening as a target gene fragment for detection, and carrying out primer and probe design screening detection.

DNA plasmid was synthesized according to the above HeV N gene conserved sequence of Venezetian engineering bioengineering (Shanghai) Inc., with a plasmid size of 6595 bp.

(1) Primer design

Designing a primer for RAA detection, wherein the lengths of an upstream primer and a downstream primer are 30-35 bp; according to the conserved sequence of the HeV N gene, the primer design comprises an upstream primer and a downstream primer, and the upstream primer and the downstream primer have the following design sequences:

RAA-F1：5’-CAATCCATTCTTTGCCTTAACCCAGCAATGGC-3’；SEQ ID NO.2；

RAA-F2：5’-CAGAGATGAGGAATCTCCTCTCACAAAGTCTCTC-3’；SEQ ID NO.3；

RAA-F3：5’-CATGGTGGAAATTCTGATGGAGGTAAAGAAAG-3’；SEQ ID NO.4；

RAA-F4：5’-CTGATGGAGGTAAAGAAAGGCGGATCAGCTAAAG-3’；SEQ ID NO.5；

RAA-R1：5’-CTCGAGGCCCTATTTCTCTGTAGAGCAGCATCAGC-3’；SEQ ID NO.6；

RAA-R2：5’-CAGCCCTTTGATGGTATTGAGATCACTCTGGAAC-3’；SEQ ID NO.7；

RAA-R3：5’-CTCTGGAACTCATTGAGGGCAAGTGCAGGGTATC-3’；SEQ ID NO.8；

RAA-P：5’-GTCGAGGAAACAGGAATGGCCGGCTTCTTTGCGACTATCAGATTCGGTCT TGA-3’；SEQ ID NO.9；

the primers were combined into 10 primer combinations, which are shown in Table 1.

Table 1: sequence information of HeV-specific primers

As shown in fig. 1, in 10 primer probe combinations,

combinations

6, 7, 9 and 10 have relatively high peak time and fluorescence values at the same concentration of the HeV plasmid; as assessed by the sensitivity detection of the

combination

6, 7, 9, 10, more preferably combination 9, in particular:

RAA-F4：5’-CTGATGGAGGTAAAGAAAGGCGGATCAGCTAAAG-3’；SEQ ID NO.5；

RAA-R2：5’-CAGCCCTTTGATGGTATTGAGATCACTCTGGAAC-3’；SEQ ID NO.7。

(2) probe design

1) Designing a probe by adopting an RAA technology probe design principle, wherein the designed probe sequence is as follows according to a HeV N gene conserved sequence:

5’-GTCGAGGAAACAGGAATGGCCGGCTTCTTTGCGACTATCAGATTCGGTCTTGA-3’；SEQ IDNO.9。

2) selection of fluorescence modifying group and fluorescence quenching group

According to the experimental instrument, the RAA-F1620 fluorescence gene detector produced by Wuxi-Tian-bioscience instruments, Inc. is adopted, and the detected fluorescence is FAM fluorescence, so that a fluorescence modifying group is selected as FAM, and a fluorescence quenching group is selected as BHQ 1;

or selecting the fluorescent modifying group as HEX, TET, JOE or VIC according to the fluorescent performance detected by the instrument; the fluorescence quenching group is BHQ2 or BHQ 3;

however, the preferred fluorescence modifying group is FAM, and the preferred fluorescence quenching group is BHQ 1.

3) The modification method of the probe comprises the following steps: the fluorescent reporter group is modified on the position of 35bp away from the 5' end base number of the probe sequence; the fluorescence quenching group is modified on the position 15bp away from the 3' end base number of the probe sequence, 1 base A is arranged between the fluorescence reporting group and the quenching group at an interval, and the base A is replaced by idSp;

5’-GTCGAGGAAACAGGAATGGCCGGCTTCTTTGCGAC/i6FAMdT//idSp//iBH Q1dT/CAGATTCGGTCTTGA-3’。

(3) the primers, probes and plasmids were synthesized by the firm of Hippon Biotechnology engineering (Shanghai) Ltd.

(4) The detection reagent for rapidly detecting the Hendra virus based on the RAA fluorescence method comprises an RAA fluorescence basic reaction reagent, a reaction buffer solution, purified water, magnesium acetate, a positive quality control product, a negative quality control product, a primer and a probe;

the RAA fluorescence basic reaction reagent is freeze-dried powder which is subjected to low-temperature freeze drying, is purchased from Jiangsu Qitian gene biotechnology limited, has the product number of RAA-F1620 and the reaction specification of 50 mu L, and is re-dissolved by using a reaction buffer solution before use, wherein the reaction buffer solution is a reagent matched with the RAA fluorescence basic reaction reagent.

The synthesized HeV plasmid is subjected to concentration measurement by using an ultramicro ultraviolet spectrophotometer, the copy number is calculated, and the synthesized HeV plasmid is diluted according to the concentration gradient to prepare 2.4 multiplied by 10⁰copies/μl～2.4×10¹⁰copies/. mu.L standard for use.

The negative quality control product is ddH₂O or purified water. The concentration of the upstream primer and the downstream primer is 15 mu M; probeThe concentration of the needles was 15. mu.M.

Example 2

The method for detecting the HeV virus by the RAA fluorescence method comprises the following steps:

(1) homogenizing the sample tissue to be detected, extracting nucleic acid according to a tissue DNA extraction method, and storing at-20 ℃ for later use; if the sample is whole blood, serum and plasma, extracting nucleic acid by steps of cracking, magnetic bead enrichment, washing, eluting and the like;

(2) switching on a power supply to preheat a constant-temperature fluorescent gene detector RAA-F1620, setting reaction parameters to 39 ℃, and setting reaction time to be as follows: 20 min;

(3) adding 13.7 muL of water, 2.1 muL of upstream and downstream primers with the concentration of 15 muM and 0.6 muL of probe into 25 muL of reaction buffer solution, fully mixing, adding into RAA fluorescence basic reaction reagent, and mixing to obtain reaction premix;

(4) 2.5. mu.L of Mg was added to the reaction tube cap²⁺Fully mixing 4 mu L of the nucleic acid extracting solution obtained in the step (1) with the reaction premixed solution obtained in the step (3), and putting the obtained reaction system into a constant-temperature fluorescent gene detector RAA-F1620 for detecting a fluorescent signal;

(5) according to the positive determination method in the RAA-F1620 detection apparatus, it can be determined that the curve amplified by the forward primer and the backward primer is positive when the relative fluorescence value of the curve amplified by the forward primer and the backward primer is more than 1500mV, and the curve amplified by the forward primer and the backward primer is negative when the relative fluorescence value is less than 1500mV without a significant amplification curve.

Relative fluorescence-initial amplification fluorescence (actual value normalized to 500mV) the sensitivity, reproducibility and specificity of the primers of the invention for the probe was determined.

1. Sensitivity test

(1) Primer and method for producing the same

An upstream primer: 5'-CTGATGGAGGTAAAGAAAGGCGGATCAGCTAAAG-3' (SEQ ID NO: 5);

a downstream primer: 5'-CAGCCCTTTGATGGTATTGAGATCACTCTGGAAC-3' (SEQ ID NO: 7);

(2) probe needle

The probe sequence is as follows:

modifying the probe by adopting a fluorescence reporter group (FAM) and a fluorescence quenching group (BHQ 1);

the modified probe was:

(3) preparing a plasmid working standard, which respectively comprises the following steps:

working standard 1, containing 2.4X 10⁴copies/. mu.L of non-infectious DNA fragment of the HeV virus plasmid.

Working standard 2, containing 2.4X 10³copies/. mu.L of non-infectious DNA fragment of the HeV virus plasmid.

Working standard 3, containing 2.4X 10²copies/. mu.L of non-infectious DNA fragment of the HeV virus plasmid.

Working standard 4, containing 24 copies/. mu.L of a non-infectious DNA fragment of the HeV virus plasmid.

Working standard 5, containing 2.4 copies/. mu.L of a non-infectious DNA fragment of the HeV virus plasmid.

(4) The sensitivity implementation method comprises the following steps:

step 1, preparing a reaction solution (prepared according to 6 reactions):

after 150. mu.L of the reaction buffer was aspirated into a 1.5mL EP tube prepared in advance, 82.2. mu.L of water, 12.6. mu.L of the primer, and 3.6. mu.L of the probe (primer concentration: 15. mu.M, probe concentration: 15. mu.M) were added thereto, and the mixture was thoroughly mixed to obtain a uniformly mixed reaction solution.

Step 2, re-dissolving RAA fluorescence basic reaction reagent

Preparing 6 RAA fluorescence basic reaction reagents, sucking 43.5 mu L of the reaction buffer solution uniformly mixed in the step 1 each time, respectively adding the reaction buffer solution into the prepared 6 RAA fluorescence basic reaction reagent tubes, fully dissolving and uniformly mixing the freeze-dried powder to form an RAA reaction system, and marking.

Step 3, sample addition reaction

Adding 2.5 μ L Mg on the test tube covers of the 6 prepared RAA fluorescent basic reaction reagents²⁺Then, respectively toAdding 4 mu L of negative quality control material, 4 mu L of standard work 5, 4 mu L of

standard work

4, 4 mu L of standard work 3, 4 mu L of

standard work

2 and 4 mu L of standard work 1 into the tube as templates, and fully and uniformly mixing each reaction tube after adding the sample, wherein the total volume of each reaction tube is 50 mu L.

Step 4, detection and result

And (3) putting the uniformly mixed 6 reaction tubes into a constant-temperature fluorescent gene detector RAA-F1620, setting the reaction temperature to be 39 ℃, and reacting for 20 min.

According to the positive determination method in the RAA-F1620 detection apparatus, it can be determined that the curve amplified by the forward primer and the backward primer is positive when the relative fluorescence value of the curve amplified by the forward primer and the backward primer is more than 1500mV, and the curve amplified by the forward primer and the backward primer is negative when the relative fluorescence value is less than 1500mV without a significant amplification curve.

Relative fluorescence-initial amplification fluorescence (actual value normalized to 500mV)

And (3) detection results: as shown in fig. 2, results of a single RAA sensitivity experiment; in order to confirm the detection limit of the method, the sensitivity experiment is repeated 8 times, qPCR sensitivity experiment comparison is carried out simultaneously, probability regression analysis is carried out by combining the results (shown in table 2) of 8 times of RAA sensitivity experiment and 3 times of qPCR sensitivity experiment, the analysis result is shown in figure 3, the analysis sensitivity of the RAA fluorescence method is determined by probability analysis, the result shows that the detection limit of 95% probability is 39 copies/reaction within 20min, and the quick and sensitive detection result is realized.

Table 2: RAA and qPCR sensitivity test Table

2. Repeatability test

(1) The sequences of the primers, the probe and the negative quality control substance are the same as those in example 1.

(2) Using working standard 3 (containing 2.4X 10)²copies/. mu.L of non-infectious DNA fragment of HeV plasmid) were performed for 8 confirmatory duplications:

(3) the method is repeatedly implemented:

step 1, preparing a reaction solution (prepared according to 9 reactions):

mu.L of the reaction buffer was pipetted and added to a previously prepared 1.5mL EP tube, 123.3. mu.L of water, 18.9. mu.L of the primer, and 5.4. mu.L of the probe (primer concentration: 15. mu.M, probe concentration: 15. mu.M) were added thereto, and the mixture was thoroughly mixed to obtain a uniformly mixed reaction solution.

Step 2, re-dissolving RAA fluorescence basic reaction reagent

Preparing 9 RAA fluorescence basic reaction reagents, sucking 43.5 mu L of the reaction buffer solution uniformly mixed in the step 1 each time, respectively adding the reaction buffer solution into the prepared 9 RAA fluorescence basic reaction reagent tubes, fully dissolving and uniformly mixing the freeze-dried powder to form an RAA reaction system, and marking.

Step 3, sample addition reaction

Adding 2.5 μ L Mg on the test tube covers of the above 9 prepared RAA fluorescent basic reaction reagents²⁺Then, 4 μ L of negative quality control material is added into one of the 9 prepared RAA fluorescent basic reaction reagent test tubes, 4 μ L of standard work 3 is added into the other 8 reaction tubes respectively as a template, and each reaction tube is fully and uniformly mixed after the sample is added, wherein the total volume of each reaction tube is 50 μ L.

Step 4, detection and result

And (3) putting the uniformly mixed 9 reaction tubes into a constant-temperature fluorescent gene detector RAA-F1620, setting the reaction temperature to be 39 ℃, and reacting for 20 min.

The detection results are shown in fig. 4: the results show that all the working standard 3 except the negative control have amplification within 20min, and the repeatability is better.

3. Experiment of specificity

(2) The Hendra virus and Nipah virus plasmids in the specificity experiment are provided by the national foreign animal epidemic disease research center. Sample nucleic acids for Equine Influenza Virus (EIV), Equine Arteritis Virus (EAV), and Equine Infectious Anemia Virus (EIAV) are provided by the harbin veterinary institute.

(3) The sample extraction method comprises the following steps:

homogenizing the tissue sample, and extracting nucleic acid by a DNA extraction method according to the commercial tissue of the radix asparagi; extracting nucleic acid from whole blood, serum and plasma by steps of cracking, magnetic bead enrichment, washing, eluting and the like; storing at-20 deg.C for use.

(4) Specific experiment implementation method:

step 1, preparing a reaction solution (prepared according to 7 reactions):

after sucking 175. mu.L of the reaction buffer solution into a previously prepared 1.5mL EP tube, 95.9. mu.L of water, 14.7. mu.L of the primer, and 4.2. mu.L of the probe (the concentration of the primer was 15. mu.M, and the concentration of the probe was 15. mu.M) were added thereto, and the mixture was thoroughly mixed to obtain a uniformly mixed reaction solution.

Step 2, re-dissolving RAA fluorescence basic reaction reagent

Preparing 7 RAA fluorescence basic reaction reagents, sucking 43.5 mu L of the reaction buffer solution uniformly mixed in the step 1 each time, respectively adding the reaction buffer solution into the prepared 7 RAA fluorescence basic reaction reagent tubes, fully dissolving and uniformly mixing the freeze-dried powder to form an RAA reaction system, and marking.

Step 3, sample addition reaction

Adding 2.5 μ L Mg on the test tube covers of the 7 prepared RAA fluorescence basic reaction reagents²⁺Then, 4. mu.L of negative quality control material is added into 1 of 7 prepared RAA fluorescent basic reaction reagent test tubes, and 4. mu.L of working standard substance 3 and 3.5 × 10 are respectively added into the other 6 reaction tubes⁶copies/. mu.L NiV plasmid, 3.5X 10²The nucleic acids of samples of copies/mu L NiV plasmid, EIV, EAV and EIAV are added and fully mixed in each reaction tube, and each reaction tube is used for mixingThe total volume of each reaction tube was 50. mu.L.

Step 4, detection and result

And (3) putting the uniformly mixed 7 reaction tubes into a constant-temperature fluorescent gene detector RAA-F1620, setting the reaction temperature to be 39 ℃, and reacting for 20 min.

The detection results are shown in fig. 5: the results show that only the working standard 3 is obviously amplified, and the nucleic acids of samples of NiV plasmids, EIV, EAV and EIAV are not obviously amplified, thereby showing good specificity.

EXAMPLE 3 actual sample testing

(2) In the experiment, 14 clinical samples 1-14 are provided in total and provided by the national foreign animal epidemic disease research center;

(3) the sample extraction method comprises the following steps:

homogenizing the tissue sample, and extracting nucleic acid by a DNA extraction method according to the commercial tissue of the radix asparagi; extracting nucleic acid from serum and plasma by steps of cracking, magnetic bead enrichment, washing, eluting and the like; storing at-20 deg.C for use;

(4) method of implementation

Step 1, preparing a reaction solution (prepared according to 16 reactions):

mu.L of the reaction buffer was pipetted and added to a previously prepared 1.5mL EP tube, 219.2. mu.L of water, 33.6. mu.L of the primer, and 9.6. mu.L of the probe (primer concentration: 15. mu.M, probe concentration: 15. mu.M) were added thereto, and the mixture was thoroughly mixed to obtain a uniformly mixed reaction solution.

Step 2, re-dissolving RAA fluorescence basic reaction reagent

Preparing 16 RAA fluorescence basic reaction reagents, sucking 43.5 mu L of the reaction buffer solution uniformly mixed in the step 1 each time, respectively adding the reaction buffer solution into the prepared 16 RAA fluorescence basic reaction reagent tubes, fully dissolving and uniformly mixing the freeze-dried powder to form an RAA reaction system, and marking.

Step 3, sample addition reaction

Adding 2.5 μ L of Mg on the test tube covers of the 16 prepared RAA fluorescent basic reaction reagents²⁺Then, 4 muL of negative quality control material and 1 of working standard 3 are added into 1 of the 16 prepared RAA fluorescent basic reaction reagent test tubes, 4 muL of HeV sample nucleic acid is respectively added into the other 14 reaction tubes, and each reaction tube is fully and uniformly mixed after the sample is added, wherein the total volume of each reaction tube is 50 muL.

Step 4, detection and result

Placing the uniformly mixed 16 reaction tubes into a constant temperature fluorescent gene detector RAA-F1620, setting the reaction temperature to 39 ℃ and the reaction time to 20 min.

The detection results are shown in fig. 6: the results show that the results of 14 cases of the HeV sample nucleic acids by the RAA detection method and the qPCR detection method are 100 percent in consistency and are negative; negative control samples were not amplified, while positive control samples gave rise to the target curve.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Jiangsu Qitian gene Biotechnology GmbH of China center for animal health and epidemiology

<120> RAA primer probe for detecting Hendra virus and detection method

<160>9

<170>SIPOSequenceListing 1.0

<210>1

<211>220

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ctgatggagg taaagaaagg cggatcagct aaaggaaggg ccgttgagat aatatctgac 60

ataggaaatt atgtcgagga aacaggaatg gccggcttct ttgcgactat cagattcggt 120

cttgaaacaa gataccctgc acttgccctc aatgagttcc agagtgatct caataccatc 180

aaagggctga tgctgctcta cagagaaata gggcctcgag 220

<210>2

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

caatccattc tttgccttaa cccagcaatg gc 32

<210>3

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

cagagatgag gaatctcctc tcacaaagtc tctc 34

<210>4

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

catggtggaa attctgatgg aggtaaagaa ag 32

<210>5

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ctgatggagg taaagaaagg cggatcagct aaag 34

<210>6

<211>35

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ctcgaggccc tatttctctg tagagcagca tcagc 35

<210>7

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

cagccctttg atggtattga gatcactctggaac 34

<210>8

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ctctggaact cattgagggc aagtgcaggg tatc 34

<210>9

<211>53

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gtcgaggaaa caggaatggc cggcttcttt gcgactatca gattcggtct tga 53

Claims

1. A primer and a probe for detecting the amplification of a HeV by an RAA fluorescence method are characterized in that the primer is used for detecting a segment with a sequence of SEQ ID NO. 1, and the probe detects a product amplified by the primer.

2. The primers and probes as claimed in claim 1, wherein the sequence of the primer upstream of the primer is seq id NO: 5; the sequence of the downstream primer is SEQ ID NO: 7.

3. the primers and probe as claimed in claim 1, wherein the probe is modified with a fluorescent reporter group and a fluorescent quencher group, the fluorescent reporter group is modified at the position 35bp away from the 5' end base of the probe sequence; the fluorescence quenching group is modified on the position 15bp away from the 3' end base number of the probe sequence, and 1 base is separated between the fluorescence reporting group and the quenching group.

4. The primers and probes as claimed in claim 3, wherein the fluorescent reporter group is FAM, HEX, TET, JOE or VIC; the fluorescence quenching group is BHQ1, BHQ2 or BHQ 3.

5. The primers and probe of claim 3, wherein said fluorescent reporter is FAM; the fluorescence quenching group is BHQ 1.

6. The primers and probes as claimed in claim 3, wherein the sequence of said probe is SEQ ID NO: 10.

7. the primers and probe as claimed in claim 3, wherein the probe is modified with a fluorescent reporter group and a fluorescent quencher group, the fluorescent reporter group is modified at the position 35bp away from the 5' end base of the probe sequence; the fluorescence quenching group is modified on the position 15bp away from the 3' end base number of the probe sequence, and 1 base A is separated between the fluorescence reporting group and the quenching group, wherein A is replaced by idSp.

8. Use of the primers and probes of any of claims 1-7 in the preparation of a RAA fluorescence detection kit.

9. A RAA fluorescence detection kit comprising the primers and probes of any of claims 1-7.

10. A method for detecting HeV by RAA fluorescence, wherein the primers and probes of any one of claims 1 to 7 are used; the method comprises the following steps:

1) extracting a nucleic acid sample of an object to be detected;

5) according to the positive judgment method in the RAA-F1620 detection instrument, the judgment can be carried out according to an amplification curve, an obvious amplification curve is formed, the curve amplified by the upstream primer and the downstream primer is judged to be positive when the relative fluorescence value is more than 1500mV, and the curve without the obvious amplification curve and the relative fluorescence value is less than 1500mV is judged to be negative;

the use concentration of the upstream primer and the downstream primer is 1-50 mu M;

the upstream and downstream primers were used at a concentration of 15. mu.M.