CN110951851A - Primer set and method for microsatellite instability detection - Google Patents
Primer set and method for microsatellite instability detection Download PDFInfo
- Publication number
- CN110951851A CN110951851A CN201911351291.8A CN201911351291A CN110951851A CN 110951851 A CN110951851 A CN 110951851A CN 201911351291 A CN201911351291 A CN 201911351291A CN 110951851 A CN110951851 A CN 110951851A
- Authority
- CN
- China
- Prior art keywords
- primer
- amplification
- detection
- microsatellite
- primer set
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of nucleic acid detection, in particular to a primer group and a method for microsatellite instability detection. According to the invention, 0-25 bases are added at the 5' end of the primers, so that the difference of the lengths of the amplification products of the primers is at least 15bp, 6 microsatellite loci can be simultaneously detected in a PCR reaction system without fluorescent markers, the problem of fluorescent interference generated by the fluorescent markers is effectively avoided, the operation steps are simple, the detection cost is reduced, the safety is higher, the flux is more flexible, the amplification efficiency and the specificity are higher, the method is suitable for fresh samples and FFPE samples with serious degradation, and the application prospect is wide.
Description
Technical Field
The invention relates to the technical field of nucleic acid detection, in particular to a primer group and a method for microsatellite instability detection.
Background
Microsatellites (MS) are short tandem repeats of less than 10 nucleotides in the genome, typically 1-6 nucleotides in length. Microsatellites are present throughout the genome, often in introns of genes, and also in promoters, transcribed untranslated regions (UTRs), and exons. In the human genome, at least 50 ten thousand MS sites are predicted to be present. Microsatellite instability (MSI) is an increase or decrease in simple sequence, i.e. the length of a microsatellite, due to Replication Errors (RER) caused by defects in the DNA mismatch repair system (MMR). Thus, MSI is also referred to as RER phenotype. The mismatch repair system defects mainly comprise two types: (1) germline mutations occurred in one or more of the mismatch repair genes MLH1, MSH2, MSH6 and PMS2, resulting in a mismatch repair defect; (2) hypermethylation of MLH1 promoter region. Studies have shown that about 15% of colorectal cancer patients exhibit microsatellite high instability (MSI-H), and more than 90% of hereditary nonpolyposis colon cancer (HNPCC) patients have MSI-H characteristics. MSI-H phenomenon is also spread in various cancers such as endometrial cancer, ovarian cancer, gastric cancer, etc.
In 1993, Altonen first found a number of MSI phenomena in HNPCC cells. In 1997, relevant criteria were identified for the academic name, definition, detection method, levels in CRC and other cancers of MSI, including 5 reference markers for MSI detection (Bat25, Bat26,5S346, D2S123, D17S250, also known as Bethesda panel) using PCR in combination with denaturing electrophoresis. Since the specificity of a two-base marker was experimentally demonstrated to be less high than a single-base marker, a reevaluation of the Bethesda panel at the 2002 NCI conference suggested the use of single-base and five-base markers. Bacher et al screened 266 MSI sites using fluorescence PCR in combination with capillary electrophoresis, and determined a detection Panel consisting of 7 markers, including BAT-25, BAT-26, NR-21, NR-24, and MONO-27(MSI scale determination), and Penta C and Penta D (identification of potential sample contamination and cross-contamination). The Promega corporation developed MSI detection kits including BAT-25, BAT-26, NR-21, NR-24, and MONO-27(MSI rating decision) as well as Amel, Penta C, and Penta D (recognition of potential sample contamination and cross-contamination) and passed FDA approval.
The PCR detection method of MSI is a gold standard for judging the instability of the microsatellite: and judging that the sample with 2 or more unstable microsatellite loci is a microsatellite high unstable sample (MSI-H), and judging that the sample with 1 unstable microsatellite loci is a microsatellite low unstable sample (MSI-L) or a Microsatellite Stable Sample (MSS). Studies have shown that testing MSI typing in patients is of great clinical significance. Among patients with stage II colorectal cancer, patients with the MSI-H phenotype had a good prognosis; however, patients with the MSI-H phenotype did not benefit from 5-fluorouracil treatment.
The types of samples used for microsatellite instability detection typically include fresh tissue and FFPE samples. Among them, the DNA degradation of FFPE samples is severe, so the PCR product of MSI cannot be too long, otherwise it will result in amplification failure and no amplification product. In order to effectively detect the severely degraded FFPE sample, the size of the PCR product of the MSI is generally designed to be 80-200 bp. In addition, the detection of a plurality of microsatellite loci is realized in a PCR reaction system, and the PCR products are easy to overlap with each other, so that the loci are judged wrongly. In the prior art, PCR products with similar sizes are divided into different groups by grouping the PCR products, the PCR products are distinguished by adopting different fluorescence labeling modes, and the sizes of fragments of different fluorescence channels are detected by capillary electrophoresis to obtain the detection result of each fluorescence channel. However, this method has the following problems: (1) the cost of fluorescent labeling is high; (2) the obtained PCR product needs to be detected by a first-generation sequencer, so that the detection labor, material and time costs and the method complexity are greatly increased, and the method cannot be widely popularized and applied; when a first-generation sequencer is used, formamide is needed for DNA denaturation, is a highly toxic substance, and has potential influence on the health of operators; (3) different fluorescence channels are mutually permeated due to the problem of grating, and the generated higher background value and non-specific peak interfere with the interpretation of the result. Therefore, it is important to develop a method for efficiently detecting a plurality of MSI sites in a single reaction system by using ordinary PCR without fluorescent labeling.
Disclosure of Invention
In order to solve the technical problems in the prior art, the invention aims to provide a primer group for microsatellite unstable multiplex PCR detection and a kit containing the primer group.
Although there are many defects in detecting MSI using different fluorescence-labeled primers, it is necessary to overcome the problems of differential detection of PCR amplification products and the mutual influence of PCR amplification of each site (between primers and target sequence) if the detection of multiple MS sites (especially more than 5 sites) is achieved in a single PCR reaction system independently of fluorescence labeling. In particular, the length of PCR amplification products limited to the MS site is more difficult to distinguish effectively between different amplification products in a shorter length range. According to the invention, 0-25 bases are added at the 5' end of the MS locus amplification primer, so that the difference between amplification products is more than 15bp, and the requirement of a non-fluorescence labeled DNA distinguishing detection technology is met. On the basis of the design concept, the invention develops the tumor cell MSI detection primer group aiming at BAT25, NR24, MONO27, BAT26, NR21, NR-27 sites and individual recognition sites Amel, and the primer group realizes the simultaneous amplification of 6 MS sites and 1 individual recognition site in a PCR reaction system under the condition of not using fluorescent markers and can realize the high-efficiency detection of each PCR amplification product by using a non-fluorescent marker detection technology (such as capillary electrophoresis).
Specifically, the technical scheme of the invention is as follows:
the invention provides a microsatellite unstable multiplex PCR detection primer set, wherein primers in the primer set comprise a detection target complementary pairing region and a detection target non-complementary pairing region; the detection target non-complementary pairing region is located at the 5' end of the primer, and the length of the detection target non-complementary pairing region is 0-25 bp; and adjusting the length of the detection target non-complementary pairing region of each primer in the primer group to ensure that the length difference between target amplification products of each primer is at least 15 bp.
In the invention, the detection target complementary pairing region is a sequence which can be complementarily paired with the detection target; the detection target non-complementary pairing region is a sequence which cannot be complementarily paired with a detection target sequence.
The length difference between the amplification products of the primers is at least 15bp by adjusting the length of the detection target non-complementary pairing region in each primer, and specifically comprises the following steps: determining the length of each amplification product according to the detection target complementary pairing region of each primer pair, then determining the number of the added bases at the 5 'end of the corresponding primer (at the 5' end of the forward primer and/or the reverse primer) by integrating the lengths of the amplification products of the primers in the primer group, and under the condition that the number of the added bases is 0-25, enabling the length difference between the amplification products to be at least 15 bp.
In order to ensure the amplification efficiency of the primer, the sequence added at the 5' end should not affect the binding and amplification of the primer and the target sequence as much as possible, and at the same time, the occurrence of non-specific amplification should be reduced as much as possible.
In the invention, the primers in the primer group are not modified by fluorescent labels.
The number of MS sites that can be simultaneously amplified in one reaction system is limited by the length of the amplification product. Specifically, when the length of the amplification product is 80-200bp, the primer group comprises no more than 10 primer pairs for amplifying microsatellite unstable markers.
The invention provides a microsatellite instability detection kit which comprises a microsatellite instability multiple PCR detection primer set.
Further, based on the design concept of the microsatellite unstable multiplex PCR detection primer set, aiming at a specific MS locus, the base composition of a detection target non-complementary pairing region at the 5' end and the sequence of the detection target complementary pairing region are optimized, so that the detection target non-complementary pairing region and the detection target complementary pairing region can be well adapted, the specific amplification efficiency of the primers is not influenced, the non-specific amplification is reduced, and the adverse influence of the interaction between the primer pairs on the amplification is reduced as much as possible.
The primer sequences are specifically as follows:
SEQ ID NO.1：BAT25-F：GTCCTCGCCTCCAAGAATGTAAG；
SEQ ID NO.2：BAT25-R：GTCTGCATTTTAACTATGGCTC；
SEQ ID NO.3：NR24-F：GTGTCTTGCTGAATTTTACCTCCTGA；
SEQ ID NO.4：NR24-R：GCAGTGAGCGGAGATTGTGCC；
SEQ ID NO.5：NR27-F：CCTGGAAACAAAGCATTGAAGTCTG；
SEQ ID NO.6：NR27-R：GAGGTTCTGAGTCGATTAATACTAG；
SEQ ID NO.7：MONO27-F：TCGGTGGATCAAATTTCACTTGG；
SEQ ID NO.8：MONO27-R：TGAAATGGTGGGAACCCAG；
SEQ ID NO.9：BAT26-F：TTCCCTTTGGACAGTTTGAACTGAC；
SEQ ID NO.10：BAT26-R：AGCTCCTTTATAAGCTTCTTCAGT。
on the basis of the above 5 pairs of primers, other MS amplification primer pairs can be further introduced. Preferably, the primer group further comprises a primer pair for amplifying the microsatellite locus NR27, and the sequence of the primer pair is shown as SEQ ID NO. 11-12. The primer pair sequences are optimally designed, and the introduction of the primer pair sequences can still ensure the amplification efficiency of each MS site in an amplification system and simultaneously reduce non-specific amplification.
SEQ ID NO.11：NR21-F：CGTCTGAGACCAAGCAGATAAAAGAGAACACG；
SEQ ID NO.12：NR21-R：CGGATGTGTACCCTTTCAGCAGAATTCCAGCC。
An individual recognition site is further introduced into the primer set to identify potential sample contamination and cross contamination. Preferably, the primer set further comprises a primer pair for amplifying the individual recognition site Ame1, and the sequence of the primer pair is shown as SEQ ID NO. 13-14.
SEQ ID NO.13：Ame1-F：CCCTGGGCTCTGTAAAGAATAG；
SEQ ID NO.14：Ame1-R：ATCAGAGCTTAAACTGGGAAGCTG。
Furthermore, the invention also provides application of the tumor cell microsatellite unstable multiplex PCR detection primer group in preparing a reagent or a kit for detecting the tumor cell microsatellite unstable.
The invention provides a tumor cell microsatellite instability detection kit which comprises a tumor cell microsatellite instability multiple PCR detection primer set.
Preferably, when the kit works, the final concentration of each primer of the tumor cell microsatellite unstable multiplex PCR detection primer group in a PCR reaction system is 0.1-0.5 mu M of BAT25 amplification primer pair, 0.2-1 mu M of NR24 amplification primer pair, 0.2-2 mu M of MONO27 amplification primer pair, 0.1-3 mu M of BAT26 amplification primer pair, 0.1-1 mu M of NR21 amplification primer pair, 0.1-2 mu M of NR27 amplification primer pair and 0.01-0.1 mu M of Amel amplification primer pair.
More preferably, the concentration of each primer is: BAT25 amplification primer pair 0.1. mu.M, NR24 amplification primer pair 0.2. mu.M, MONO27 amplification primer pair 2. mu.M, BAT26 amplification primer pair 1. mu.M, NR21 amplification primer pair 0.3. mu.M, NR27 amplification primer pair 1. mu.M, and Amel amplification primer pair 0.05. mu.M.
The invention also provides a microsatellite instability detection method, which comprises the following steps: and performing multiplex PCR amplification by using the microsatellite unstable multiplex PCR detection primer group or the tumor cell microsatellite unstable multiplex PCR detection primer group, and detecting the fragment size of a PCR amplification product.
Specifically, the DNA of a sample to be detected is used as a template, the primer group is utilized to carry out multiple PCR amplification, and DNA detection equipment is utilized to detect the size of a fragment of a PCR amplification product.
Preferably, in the reaction system of the PCR amplification, the concentration of each primer is: BAT25 amplification primer pair 0.1. mu.M, NR24 amplification primer pair 0.2. mu.M, MONO27 amplification primer pair 2. mu.M, BAT26 amplification primer pair 1. mu.M, NR21 amplification primer pair 0.3. mu.M, NR27 amplification primer pair 1. mu.M, and Amel amplification primer pair 0.05. mu.M.
More preferably, the 20 μ L reaction system for multiplex PCR amplification is as follows: 5 Xenzyme mixture 4. mu.L, primer mixture 1. mu.L (final concentration of each primer in PCR reaction system is BAT25 amplification primer pair 0.1. mu.M, NR24 amplification primer pair 0.2. mu.M, MONO27 amplification primer pair 2. mu.M, BAT26 amplification primer pair 1. mu.M, NR21 amplification primer pair 0.3. mu.M, NR27 amplification primer pair 1. mu.M, Amel amplification primer pair 0.05. mu.M), DNA template 2. mu.L, and water 13. mu.L.
Preferably, the reaction procedure for multiplex PCR amplification comprises: 10min at 95 ℃; 5min at 95 ℃; 30 cycles of 94 ℃ for 30sec, 60 ℃ for 30sec, 70 ℃ for 30 sec; 5min at 70 ℃.
The primer group can be used for distinguishing and detecting the amplification products of each MS locus by using non-fluorescence labeling detection equipment. Detection equipment for MS site amplification products includes but is not limited to Qsep100 full-automatic nucleic acid Analyzer, Labchip, Analyzer 2100, etc.
The invention has the beneficial effects that: the microsatellite instability detection primer group and the detection method have the following advantages: the simultaneous detection of 6 microsatellite loci in a PCR reaction system can be realized without fluorescent labeling, the cost is obviously reduced, and the operation steps are simple; the detection does not depend on a first-generation sequencer, a toxic substance formamide is not needed, the safety is higher, and the flux is more flexible; the method avoids the problems of background value and non-specific peak caused by fluorescence-related interference, and has high amplification efficiency, high specificity and more accurate and reliable detection result. The primer group and the detection method disclosed by the invention are suitable for fresh samples and FFPE samples seriously degraded, and have wide application prospects.
Drawings
FIG. 1 is a diagram showing the results of detection of the MS site PCR amplification product of a control sample (peripheral blood) of M2 patient by using Qsep100 full-automatic nucleic acid analyzer in example 3 of the present invention.
FIG. 2 is a diagram showing the results of detection of the MS site PCR amplification product of a tumor tissue sample of M2 patient by using a Qsep100 full-automatic nucleic acid analyzer in example 3 of the present invention.
Detailed Description
Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 design of primer set for microsatellite instability detection
The method comprises the steps of designing amplification primers aiming at MS sites BAT25, NR24, MONO27, BAT26, NR21 and NR27 and individual recognition sites Amel, and adding sequences with different lengths within the range of 0-25 bp to the 5' ends of a forward primer and a reverse primer of each primer pair to enable the length difference (theoretical length of amplification products) between target amplification products of each site to be at least 15 bp. The overall process of primer design and screening is as follows:
in the first step, PCR primer design is carried out on MS sites BAT25, NR24, MONO27, BAT26, NR21 and NR27 and an individual recognition site Amel according to human genome sequence information, and the size of a target product is 80-200 bp. The primers with high specificity and similar annealing temperature which can ensure the amplification efficiency of each detection site are obtained by screening.
And secondly, calculating the size of an expected amplification product of each site primer obtained by screening in the first step, and carrying out secondary design on primers with the product size interval smaller than 15 bp. Adding target non-complementary sequences to the 5' ends of the forward and/or reverse primers of the primer pair such that the product size differs from the other product sizes by at least 15 bp. The target non-complementary sequence has no specific recognition region on the human genome, and can be an artificial sequence or a sequence of other species.
And thirdly, performing overall analysis, screening and optimization on all primer sequences to ensure that the primers have no mutual influence and the amplification efficiency is similar.
Through a large amount of screening, combination and optimization of the 5' end addition sequence and the target binding sequence, 7 pairs of primers which can ensure that MS sites BAT25, NR24, MONO27, BAT26, NR21 and NR27 and individual recognition sites Amel can be simultaneously, efficiently and specifically amplified in a PCR reaction system are obtained, and the primer sequences are shown in Table 1.
The primers in the table 1 are used for amplification, and the lengths of amplification products of MS sites BAT25, NR24, MONO27, BAT26, NR21 and NR27 are 127bp, 145bp, 175bp, 190bp, 205bp and 160bp respectively; the length of the amplification product of the individual recognition site Ame1 was 105 bp.
TABLE 16 amplification primer sequences for MS sites and 1 Individual recognition site
| Primer name | Sequence of |
| BAT25-F | GTCCTCGCCTCCAAGAATGTAAG |
| BAT25-R | GTCTGCATTTTAACTATGGCTC |
| NR24-F | GTGTCTTGCTGAATTTTACCTCCTGA |
| NR24-R | GCAGTGAGCGGAGATTGTGCC |
| NR27-F | CCTGGAAACAAAGCATTGAAGTCTG |
| NR27-R | GAGGTTCTGAGTCGATTAATACTAG |
| MONO27-F | TCGGTGGATCAAATTTCACTTGG |
| MONO27-R | TGAAATGGTGGGAACCCAG |
| BAT26-F | TTCCCTTTGGACAGTTTGAACTGAC |
| BAT26-R | AGCTCCTTTATAAGCTTCTTCAGT |
| NR21-F | CGTCTGAGACCAAGCAGATAAAAGAGAACACG |
| NR21-R | CGGATGTGTACCCTTTCAGCAGAATTCCAGCC |
| Ame1-F | CCCTGGGCTCTGTAAAGAATAG |
| Ame1-R | ATCAGAGCTTAAACTGGGAAGCTG |
Note: underlined bases are non-complementary pairing sequences added to the 5' end.
Example 2 detection method Using microsatellite instability detection primer set
The reaction systems for PCR amplification using the microsatellite instability detection primer set of example 1 are shown in Table 2, wherein the composition of the primer mixture is as follows: BAT 25-F0.1 μ M, BAT 25-R0.1 μ M, NR 24-F0.2 μ M, NR 24-R0.2 μ M, NR 27-F1 μ M, NR 27-R1 μ M, MONO 27-F2 μ M, MONO 27-R2 μ M, BAT 26-F1 μ M, BAT 26-R1 μ M, NR 21-F0.3 μ M, NR 21-R0.3 μ M, Amel-F0.05 μ M, Amel-R0.05 μ M.
TABLE 2 PCR reaction System
The reaction solution was prepared in a PCR tube according to the composition of the reaction system shown in Table 2, and the mixture was gently sucked up and down by a gun. The PCR tube containing the reaction system was placed in a PCR apparatus and the reaction was carried out according to the set program in Table 3.
TABLE 3 PCR reaction procedure
After the PCR amplification is finished, the fragment size of the PCR amplification product is analyzed by a Qsep100 full-automatic nucleic acid analyzer.
Example 3 microsatellite instability detection of tumor tissue samples
The microsatellite instability status of tumor tissue samples of 2 tumor patients (M1 patient, M2 patient) was tested using the microsatellite instability detection primer set of example 1 and the detection method of example 2 as follows:
1. DNA extraction: peripheral blood was extracted from the DNA of the tumor tissue samples of colorectal cancer using Qiagen FFPE DNA kit, and peripheral blood was used as a control sample, and a Tiangen blood extraction kit was used. The concentration of the extracted DNA was measured using a qubit and diluted to 2 ng/. mu.l.
2. And (3) PCR amplification: PCR amplification was performed using the microsatellite instability detection primer set of example 1 and the PCR amplification system and procedure of example 2.
3. Detection of PCR amplification product: and (3) according to the instrument operation instruction, diluting the PCR product obtained in the step (2) by 10 times by using a diluent matched with the instrument, and taking 10 mu l of the diluted product for detection by a Qsep100 full-automatic nucleic acid analyzer.
The instrument is set up: selecting a matched high-resolution card holder S1, and setting detection conditions as follows: 6kV, separation time 8 min.
4. Analysis of results
The microsatellite loci of the control sample (peripheral blood) and the tumor tissue sample were measured, and the statistics of the Qsep100 measurements for the M1 patient and the M2 patient are shown in tables 4 and 5, respectively. The control sample and the tumor tissue sample Qsep100 detection peak maps of the M2 patient are shown in FIG. 1 and FIG. 2. The results showed that both the tumor tissue of the M1 patient and the control had a single peak (single product) at 6 MS sites, i.e. no microsatellite instability occurred; the tumor tissue of M2 patient has two product peaks at BAT25 and MONO27, and the peaks are smaller than the control peak, which indicates that the microsatellite of the two sites has deletion mutation, i.e. the microsatellite is unstable. According to the microsatellite instability judgment rule (the microsatellite instability sample is judged to be existed when 2 or more sites are unstable), the M1 sample is judged to be the microsatellite stability sample, and the M2 sample is judged to be the microsatellite instability sample.
TABLE 4 detection of the size of the fragment of the PCR amplification product at the MS site of M1 patients
TABLE 5 detection of the size of the fragment of the PCR amplification product at the MS site of M2 patients
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Beijing excel medical examination laboratory Co., Ltd
<120> primer set and method for microsatellite instability detection
<130>KHP191117163.0
<160>14
<170>SIPOSequenceListing 1.0
<210>1
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gtcctcgcct ccaagaatgt aag 23
<210>2
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gtctgcattt taactatggc tc 22
<210>3
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gtgtcttgct gaattttacc tcctga 26
<210>4
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gcagtgagcg gagattgtgc c 21
<210>5
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
cctggaaaca aagcattgaa gtctg 25
<210>6
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gaggttctga gtcgattaat actag 25
<210>7
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
tcggtggatc aaatttcact tgg 23
<210>8
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
tgaaatggtg ggaacccag 19
<210>9
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
ttccctttgg acagtttgaa ctgac 25
<210>10
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
agctccttta taagcttctt cagt 24
<210>11
<211>32
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
cgtctgagac caagcagata aaagagaaca cg 32
<210>12
<211>32
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
cggatgtgta ccctttcagc agaattccag cc 32
<210>13
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
ccctgggctc tgtaaagaat ag 22
<210>14
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
atcagagctt aaactgggaa gctg 24
Claims (10)
1. A microsatellite unstable multiplex PCR detection primer set, wherein primers in the primer set comprise a detection target complementary pairing region and a detection target non-complementary pairing region; the detection target non-complementary pairing region is located at the 5' end of the primer, and the length of the detection target non-complementary pairing region is 0-25 bp; and adjusting the length of the detection target non-complementary pairing region of each primer in the primer group to ensure that the length difference between target amplification products of each primer is at least 15 bp.
2. The primer set of claim 1, wherein the primers in the primer set are free of fluorescent label modifications.
3. The primer set according to claim 1 or 2, wherein the primer set comprises no more than 10 primer pairs for microsatellite locus amplification when the length of the amplification product is 80-200 bp.
4. A microsatellite instability detection kit comprising the primer set according to any one of claims 1 to 3.
5. A tumor cell microsatellite unstable multiplex PCR detection primer set is characterized by comprising primer pairs for amplifying microsatellite loci BAT25, NR24, MONO27, BAT26 and NR21 respectively, wherein the sequences are shown as SEQ ID NO. 1-10.
6. The tumor cell microsatellite instability multiplex PCR detection primer set according to claim 5, wherein the primer set further comprises a primer pair for amplifying the microsatellite locus NR27, and the sequence of the primer pair is shown as SEQ ID NO. 11-12.
7. The tumor cell microsatellite unstable multiplex PCR detection primer set according to claim 5 or 6 further comprising a primer pair for amplifying individual recognition site Amel, wherein the sequence of the primer pair is shown as SEQ ID NO. 13-14.
8. Use of the tumor cell microsatellite instability multiple PCR detection primer set according to any one of claims 5 to 7 in the preparation of a reagent or a kit for detecting tumor cell microsatellite instability.
9. A kit for detecting microsatellite instability of tumor cells, which is characterized by comprising the tumor cell microsatellite instability multiple PCR detection primer set according to any one of claims 5 to 7;
preferably, when the kit works, the final concentration of each primer pair in the tumor cell microsatellite unstable multiplex PCR detection primer group in a PCR reaction system is 0.1-0.5 mu M of BAT25 amplification primer pair, 0.2-1 mu M of NR24 amplification primer pair, 0.2-2 mu M of MONO27 amplification primer pair, 0.1-3 mu M of BAT26 amplification primer pair, 0.1-1 mu M of NR21 amplification primer pair, 0.1-2 mu M of NR27 amplification primer pair and 0.01-0.1 mu M of Amel amplification primer pair.
10. A method for detecting microsatellite instability, comprising: performing multiplex PCR amplification using the microsatellite unstable multiplex PCR detection primer set according to any one of claims 1 to 3 or the tumor cell microsatellite unstable multiplex PCR detection primer set according to any one of claims 5 to 7 to detect the fragment size of the PCR amplification product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911351291.8A CN110951851A (en) | 2019-12-24 | 2019-12-24 | Primer set and method for microsatellite instability detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911351291.8A CN110951851A (en) | 2019-12-24 | 2019-12-24 | Primer set and method for microsatellite instability detection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110951851A true CN110951851A (en) | 2020-04-03 |
Family
ID=69983842
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911351291.8A Pending CN110951851A (en) | 2019-12-24 | 2019-12-24 | Primer set and method for microsatellite instability detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110951851A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111763739A (en) * | 2020-08-11 | 2020-10-13 | 郑州科蒂亚生物技术有限公司 | Tumor microsatellite instability detection primer and application and kit thereof |
| CN111850129A (en) * | 2020-08-17 | 2020-10-30 | 中山大学附属第六医院 | Primer pair, kit and method for detecting stability of NR21 locus of microsatellite |
| CN113223623A (en) * | 2021-04-20 | 2021-08-06 | 成都大熊猫繁育研究基地 | Method for predicting specificity of microsatellite PCR product based on genome information |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020058265A1 (en) * | 2000-09-15 | 2002-05-16 | Promega Corporation | Detection of microsatellite instability and its use in diagnosis of tumors |
| CN102230004A (en) * | 2011-06-08 | 2011-11-02 | 北京阅微基因技术有限公司 | Tumor cell microsatellite instable state complex amplification system and detection kit |
| CN108441558A (en) * | 2018-02-12 | 2018-08-24 | 杭州和壹基因科技有限公司 | The composite amplification system and detection kit of tumour cell microsatellite instability |
-
2019
- 2019-12-24 CN CN201911351291.8A patent/CN110951851A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020058265A1 (en) * | 2000-09-15 | 2002-05-16 | Promega Corporation | Detection of microsatellite instability and its use in diagnosis of tumors |
| CN102230004A (en) * | 2011-06-08 | 2011-11-02 | 北京阅微基因技术有限公司 | Tumor cell microsatellite instable state complex amplification system and detection kit |
| CN108441558A (en) * | 2018-02-12 | 2018-08-24 | 杭州和壹基因科技有限公司 | The composite amplification system and detection kit of tumour cell microsatellite instability |
Non-Patent Citations (2)
| Title |
|---|
| HASSAN ASHKTORAB等: "Clinicopathological features and microsatellite instability (MSI) in colorectal cancers from African Americans", 《INT J CANCER》 * |
| 邹莉: "《蕈菌研究方法》", 31 August 2018, 东北林业大学出版社 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111763739A (en) * | 2020-08-11 | 2020-10-13 | 郑州科蒂亚生物技术有限公司 | Tumor microsatellite instability detection primer and application and kit thereof |
| CN111850129A (en) * | 2020-08-17 | 2020-10-30 | 中山大学附属第六医院 | Primer pair, kit and method for detecting stability of NR21 locus of microsatellite |
| CN113223623A (en) * | 2021-04-20 | 2021-08-06 | 成都大熊猫繁育研究基地 | Method for predicting specificity of microsatellite PCR product based on genome information |
| CN113223623B (en) * | 2021-04-20 | 2022-12-20 | 成都大熊猫繁育研究基地 | Method for predicting specificity of microsatellite PCR product based on genome information |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200115708A1 (en) | DNA probe library for hybridization with microsatellite instability related microsatellite loci, detection method and kit | |
| CN110951851A (en) | Primer set and method for microsatellite instability detection | |
| CN105861678B (en) | Design method of primer and probe for amplifying low-concentration mutation target sequence | |
| CN107604078B (en) | Molecular marker related to sheep wool fiber diameter character and specific primer pair and application thereof | |
| EP2514836A1 (en) | Prostate cancer markers | |
| CN107267505B (en) | Microsatellite markers and application thereof in prognosis determination and/or chemotherapy sensitivity prediction of colorectal cancer | |
| CN108070658B (en) | Non-diagnostic method for detecting MSI | |
| US20090181394A1 (en) | Diagnostic methods and kits for hepatocellular carcinoma using comparative genomic hybridization | |
| Perucho et al. | [18] Fingerprinting of DNA and RNA by arbitrarily primed polymerase chain reaction: Applications in cancer research | |
| CN104894233A (en) | Multi-sample and multi-segment DNA methylation high-throughput sequencing method | |
| CN106834286B (en) | Primer combination for one-step method rapid construction of amplicon library | |
| CN115725749A (en) | Mouse source cell STR detection kit, method and application | |
| EP1650311B1 (en) | Compounds and methods for assessment of Microsatellite Instability (MSI) status | |
| CN111893192B (en) | Mixed detection material analysis micro haplotype composite amplification system and construction and haplotype frequency | |
| CN108165629A (en) | A kind of DNA point mutation quantitative detecting method | |
| CN113416769B (en) | Method, composition and use for detecting microsatellite instability of non-control sample based on next generation sequencing technology | |
| US20030113723A1 (en) | Method for evaluating microsatellite instability in a tumor sample | |
| CN109797437A (en) | A kind of construction method of sequencing library when detecting multiple samples and its application | |
| CN104152568B (en) | High-throughput STR sequence core repeat number detection method | |
| CN108315396B (en) | Novel method for simply and conveniently detecting SNP | |
| CN107904297B (en) | Primer group, joint group and sequencing method for microbial diversity research | |
| CN112553339B (en) | Guiding method and kit for irinotecan personalized medicine genes | |
| CN110592210B (en) | Sequence primer for detecting BRCA1/2 total exon and design method | |
| CN114085895B (en) | Detection primer for rapidly detecting MSI and kit thereof | |
| CN113403406B (en) | Multiplex amplification system and kit for X chromosome STR locus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200403 |