CN110951766A - Method for synthesizing L-ornithine by metabolizing mannitol by using recombinant corynebacterium glutamicum - Google Patents

Method for synthesizing L-ornithine by metabolizing mannitol by using recombinant corynebacterium glutamicum Download PDF

Info

Publication number
CN110951766A
CN110951766A CN201911334517.3A CN201911334517A CN110951766A CN 110951766 A CN110951766 A CN 110951766A CN 201911334517 A CN201911334517 A CN 201911334517A CN 110951766 A CN110951766 A CN 110951766A
Authority
CN
China
Prior art keywords
ornithine
corynebacterium glutamicum
fermentation
mannitol
mtlr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201911334517.3A
Other languages
Chinese (zh)
Other versions
CN110951766B (en
Inventor
张斌
盛琦
江燕
徐心怡
唐忠
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangxi Agricultural University
Original Assignee
Jiangxi Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangxi Agricultural University filed Critical Jiangxi Agricultural University
Priority to CN201911334517.3A priority Critical patent/CN110951766B/en
Publication of CN110951766A publication Critical patent/CN110951766A/en
Application granted granted Critical
Publication of CN110951766B publication Critical patent/CN110951766B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/10—Citrulline; Arginine; Ornithine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01255—Mannitol dehydrogenase (1.1.1.255)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses a method for synthesizing L-ornithine by using recombinant corynebacterium glutamicum to metabolize mannitol, belonging to the field of biochemical engineering. The method comprises the following steps: (1) recombinant corynebacterium glutamicum: the gene encoding MtlR was knocked out in C.glutamicum, then the strong promoter P was inserted in C.glutamicum NCgl0824 Strategy (2) overexpression of the Gene encoding mannitol dehydrogenasemtlD，Obtaining recombinant corynebacterium glutamicum; (2) aerobic fermentation to synthesize L-ornithine: inoculating the recombinant Corynebacterium glutamicum obtained in the step (1) into a culture medium containing glycerolPerforming aerobic fermentation in fermentation culture medium containing ethanol, corn steep liquor, etc. to produce L-ornithine. The method provided by the invention adopts corynebacterium glutamicum as a production strain, takes mannitol as a main component of seaweed hydrolysate as a substrate to synthesize the L-ornithine, has the potential to replace glucose to become a main carbon source for fermenting the L-ornithine, and relieves the problem that the industrial large-scale production of the L-ornithine competes with human beings for grains.

Description

Method for synthesizing L-ornithine by metabolizing mannitol by using recombinant corynebacterium glutamicum
Technical Field
The invention belongs to the field of biochemical engineering, and particularly relates to a method for synthesizing L-ornithine by utilizing recombinant corynebacterium glutamicum to metabolize mannitol.
Background
L-ornithine is an intermediate metabolite of the urea cycle and has an important role in the excretion of ammonia in the body. L-ornithine is not encoded by proteins, but is present in antibacterial peptides such as tyrocidin and gramicidin S, and has functions of protecting liver, enhancing immunity, and the like.
L-ornithine is also widely used in the fields of food, medical treatment, chemical industry, etc.: in the aspect of food, the L-ornithine is one of main components of food additives and can be used for preparing dairy food, meat food, baked food, flour food and the like; in the aspect of medical treatment, the L-ornithine can be used for preparing medicaments for protecting liver, such as ornithine aspartate, ornithine aspartate and the like; in the chemical industry, L-ornithine can replace glycerin to be used as a flavoring and anti-freezing humectant of cut tobacco and an additive of facial cleanser, shampoo, beauty cream and the like; in the aspect of feed, the L-ornithine can be used for preparing pet cans, animal feed, aquatic feed, veterinary drug products and the like.
At present, the total demand of the international market for L-ornithine exceeds 5000 tons, and main manufacturers have three enterprises of gourmet powder, Tandao pharmacy and cooperative fermentation, and the yield is short of demand. In the market, the unit price of the pharmaceutical grade L-ornithine is 35-40 ten thousand yuan/ton, and the price is high.
The industrial production of L-ornithine mainly comprises a chemical method, an enzymatic method and an industrial fermentation method, wherein the chemical method for synthesizing L-ornithine has the defects of complex operation process, strict requirements on reaction conditions, environmental damage and the like, the enzymatic method needs to use expensive arginine and arginase as raw materials, and the production cost is limited by the price of arginine. The fermentation method uses glucose as a substrate, and converts the glucose into L-ornithine through a biological metabolic pathway in an engineering strain body. Compared with chemical methods and enzymatic methods, the synthesis of L-ornithine by microbial fermentation has the advantages of low production cost, small environmental pollution and the like, and thus has become the focus of increasing attention of researchers.
Although the synthesis of L-ornithine by microbial fermentation has a wide application prospect, the method consumes a large amount of substrate glucose, and the main source of industrial glucose is the hydrolysis of starch. Under the environment that the land area of the earth is continuously reduced and the population number is continuously increased, the problem that L-ornithine is synthesized by taking glucose as a raw material and competes with human beings for food is obviously faced, and the negative effect brought by the problem is increased day by day.
Therefore, it is necessary to provide a new L-ornithine fermentation production method, which utilizes other carbon sources to replace glucose to perform fermentation synthesis of L-ornithine, and alleviates the problem that large-scale production of L-ornithine competes with human beings for food.
Disclosure of Invention
The present invention is directed to overcoming the above-mentioned drawbacks of the prior art and providing a novel method for synthesizing L-ornithine by metabolizing mannitol using recombinant Corynebacterium glutamicum.
In order to achieve the above purpose, the invention adopts the following technical scheme:
a method for synthesizing L-ornithine by utilizing recombinant corynebacterium glutamicum to metabolize mannitol comprises the following steps:
(1) recombinant corynebacterium glutamicum: constructing recombinant plasmid containing homologous upper and lower arms of the negative regulatory protein MtlR, introducing Corynebacterium glutamicum, and knocking out coding gene of the negative regulatory protein MtlRmtlR(ii) a The strong promoter was then designated as P NCgl0824 The promoter is inserted inmtlDUpstream non-coding region of gene, coding gene for enhancing expression of mannitol dehydrogenasemtlD，Obtaining recombinant corynebacterium glutamicum;
(2) aerobic fermentation to synthesize L-ornithine: inoculating the recombinant corynebacterium glutamicum obtained in the step (1) into a fermentation culture medium to perform aerobic fermentation to synthesize the L-ornithine, wherein the inoculation amount of the corynebacterium glutamicum is 1-20% by volume, and the fermentation temperature is 30 ℃; controlling the rotating speed of a shaking table to be 250 rpm, and controlling the fermentation time to be: 72 h; collecting fermentation liquor after fermentation is finished, and carrying out OD treatment on the fermentation liquor600Determination of L-ornithineAnd (4) measuring the acid concentration.
The fermentation medium comprises mannitol, corn steep liquor, ammonium sulfate and MgSO4、KH2PO4、Na2HPO4、K2HPO4、MnSO4、FeSO4、CaCO3；
In order to obtain better technical effect and further improve the yield of the L-ornithine, the concentration of mannitol in a fermentation medium needs to be optimized;
preferably, the content of each component in the fermentation medium is as follows: 20-100 g/L of mannitol, 5-25 g/L of corn steep liquor and 10-60g/L, MgSO of ammonium sulfate40.2-5 g/L、KH2PO40.5-5 g/L、Na2HPO40.5-5 g/L、K2HPO40.5-5g/L、MnSO40.001-1 g/L、FeSO40.001-1 g/L、CaCO310-30 g/L；
Preferably, the content of each component in the fermentation medium is as follows: 80 g/L of mannitol, 20 g/L of corn steep liquor and 50g/L, MgSO g of ammonium sulfate42.5 g/L、KH2PO41 g/L、Na2HPO40.5 g/L、K2HPO40.5 g/L、MnSO40.02 g/L、FeSO40.02 g/L、CaCO310 g/L。
The method provided by the invention has the beneficial effects that:
(1) the fermentation substrate of corynebacterium glutamicum is changed, and mannitol is used for replacing glucose, and can be obtained from seaweed hydrolysate by simple treatment.
(2) The encoding gene of mannitol dehydrogenase is enhanced and expressed by a genetic manipulation means of inserting a strong promoter, so that the utilization of mannitol can be accelerated, and the yield of L-ornithine can be improved.
Drawings
FIG. 1:mtlRgene knockout homology armmtlR-up andmtlR-separate PCR amplification of down;
FIG. 2:mtlRgene knockout homology armmtlR-fusion PCR amplification of up-down;
FIG. 3pk 18-. DELTA.mtlRColony PCR validation of recombinant plasmids；
FIG. 4:C.glutamicumSO26 ΔmtlRPCR screening of (3);
FIG. 5:C.glutamicumSO26 andC.glutamicumSO26ΔmtlRproducing an L-ornithine concentration line graph by the shake flask fermentation;
FIG. 6:mtlDhomologous arm for gene overexpressionmtlD-up andmtlDdown and the strong promoter P NCgl0824 PCR amplification of (3);
FIG. 7:mtlDhomologous arm for gene overexpressionmtlD-up-P NCgl0824 -fusion of down;
FIG. 8:C.glutamicumSO26 ΔmtlRP NCgl0824 -mtlDthe identification of (3);
FIG. 9: recombinant bacteriumC.glutamicumSO26 ΔmtlRAndC.glutamicumSO26 ΔmtlRP NCgl0824 -mtlDproducing L-ornithine line graph by fermentation.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are commercially available.
Example 1
Corynebacterium glutamicummtlRAnd (3) constructing a gene knockout plasmid.
Using the genome of Corynebacterium glutamicum S9114 as template and primermtlR-up-F (aacgacgggccagtgccaaagctAAATGGTGGCAACCAGCGCAC) andmtlR-up-R (CGCATATGGAATTCGATCGAGCGGGGAATCACTGGACATGTG) as primer for PCR to obtainmtlRHomologous fragment with upstream about 800bpmtlRUp and purification using PCR product recovery kit (fig. 1). Using the genome of Corynebacterium glutamicum S9114 as template and primermtlRdown-F (GCTCGATATCGAATTCCATATGCGTTTTGAGGTCAGCGCAATGAC) andmtlR-down-R (cggtacccggggatccttacgaACAAGCCTTGCAGGAT) as primer for PCR amplification to obtainmtlRDownstream homologous fragment of about 800bpmtlRDown was purified using PCR product recovery reagents (fig. 1). To be provided withmtlR-up andmtlRdown fragment as template, inmtlR-up-F andmtlRperforming overlapping PCR amplification by using-down-R as a primer to obtainmtlR-up-down fragment (FIG. 2). The suicide plasmid pK18 of Corynebacterium glutamicummobsacBDouble digestion with HindI and XbaI, using a one-step cloning kit (Novozam)mtlRThe one-step ligation of the up-down fragment to pK18mobsacBThe positive clone was verified by PCR using M13 primer (FIG. 3), and the resulting recombinant plasmid was designated pK 18-. DELTA.mtlR。
Example 2
MtlRAnd (5) constructing gene knockout bacteria.
pK18- Δ was measured using an electroporator (Berle)mtlRTransformed into Corynebacterium glutamicum SO26 which produces L-ornithine by electrotransformation under conditions of a voltage of 3000V for 4ms (cuvette width of 2 mm). The primary recombinant bacteria were screened on LB plates containing 25mg/L kanamycin. The recombinant strain was further cultured in a liquid LB medium for 2 hours, and then spread on an LB plate containing 10 g/L sucrose for secondary screening. By usingmtlR-up-F andmtlRcolony PCR with-down-R as primer to knock outmtlRThe fragment cloned from the recombinant of the gene was 1.6 Kb, wherein positive clones were selected, and the primers were reusedmtlR-check-F (ACCCGTCATGGATTCGCTCGT) andmtlRthe PCR of-down-R was verified again, and the original strain was used as a control, and if the amplification failed to reach a band around 800 (FIG. 4), it was considered thatmtlRThe gene knockout is successful, and the recombinant bacterium is named asC.glutamicumΔmtlR。
Example 3
Original bacterium Corynebacterium glutamicumC. glutamicumSO26 and recombinant Corynebacterium glutamicumC. glutamicumSO26ΔmtlRThe fermentation culture of (3).
Original bacterium Corynebacterium glutamicumC. glutamicumSO26 and recombinant Corynebacterium glutamicumC. glutamicumSO26 ΔmtlRCultured on LB plates overnight. A single colony from this fresh plate was inoculated into a 100 mL Erlenmeyer flask containing 10 mL seed medium and incubated at 32 ℃ and 220rpm for 12 h.
The formula of the seed culture medium comprises (g/L): 30 parts of glucose, 10 parts of corn steep liquor and 10 parts of yeast powder、(NH4)2 SO 415、MgSO42.5、KH2 PO 41、K2HPO40.5、Na2HPO40.5、CaCO 310。
Inoculating the seed culture solution into 20 mL of fermentation medium with the inoculation amount of 10%, fermenting in a 250 mL triangular flask at 32 deg.C and at 250 rpm.
The fermentation medium formula comprises (g/L): 80 g/L of mannitol, 20 g/L of corn steep liquor and 50g/L, MgSO g of ammonium sulfate42.5 g/L、KH2PO41 g/L、Na2HPO40.5 g/L、K2HPO40.5 g/L、MnSO40.02 g/L、FeSO40.02g/L、CaCO310 g/L。
And finishing the fermentation for 72 h. Recombinant Corynebacterium glutamicum strainsC.glutamicumSO26 ΔmtlROD of (1)600The yield of 11, L-ornithine was 22 g/L (FIG. 5). And the original bacterium Corynebacterium glutamicum strainC. glutamicumOD of SO26600At 7, the L-ornithine was produced at only 2.3 g/L.
Thus, the original bacterium Corynebacterium glutamicum SO26 has low efficiency of synthesizing L-ornithine by consuming mannitol. Knock-outmtlRThe gene can obviously improve the yield of L-ornithine synthesized by corynebacterium glutamicum through mannitol fermentation.
Example 4
Recombinant Corynebacterium glutamicumC. glutamicumSO26 ΔmtlRAnd optimizing the mannitol concentration of the fermentation medium.
Corynebacterium glutamicumC. glutamicumSO26 ΔmtlRCultured on LB plates overnight. A single colony from this fresh plate was inoculated into a 100 mL Erlenmeyer flask containing 10 mL seed medium and incubated at 32 ℃ and 220rpm for 12 h.
The formula of the seed culture medium comprises (g/L): 30 parts of glucose, 10 parts of corn steep liquor, 10 parts of yeast powder and (NH)4)2SO415、MgSO42.5、KH2PO41、K2HPO40.5、Na2HPO40.5、CaCO 310。
Inoculating the seed culture solution into 20 mL of fermentation medium with the inoculation amount of 10%, fermenting in a 250 mL triangular flask at 32 deg.C and at 250 rpm.
The fermentation medium formula comprises (g/L): 20-100 g/L of mannitol, 20 g/L of corn steep liquor and 50g/L, MgSO g of ammonium sulfate42.5 g/L、KH2PO41 g/L、Na2HPO40.5 g/L、K2HPO40.5 g/L、MnSO40.02 g/L、FeSO40.02g/L、CaCO310 g/L。
And finishing the fermentation for 72 h. As shown in the figure, the recombinant Corynebacterium glutamicum strainC. glutamicumSO26 ΔmtlRThe L-ornithine was most produced in a medium containing 80 g/L of mannitol as a carbon source (FIG. 5).
Example 5
Corynebacterium glutamicum P NCgl0824 Strong promoter insertionmtlDAnd (3) constructing a gene recombinant plasmid.
Using the genome of Corynebacterium glutamicum S9114 as template and primermtlD-up-F (aacgacgggccagtgccaaagctAACGTTGTGGGTTTCCCTCGT) andmtlD-up-R (GTTTAGCTCGAAAAACAGTTAGG) as primer to carry out PCR to obtainmtlDHomologous fragment with upstream about 800bpmtlDUp and purification using PCR product recovery kit (fig. 6, lane 1). Using the genome of Corynebacterium glutamicum S9114 as a template and a primer P-F (mtlD) (CCTAACTGTTTTTCGAGCTAAACAACTGTGCCACTAATACGGATAG) and P-R (mtlD) (GGAAAAGATCCTTTCAAGGATGGCAATTTCGCCTGCTTCCGATT) performing PCR amplification by using the primer to obtain P of about 200 bp NCgl0824 Strong promoter DNA fragment, purified using PCR product recovery reagents (FIG. 6, lane 2). Using the genome of Corynebacterium glutamicum S9114 as template and primermtlDdown-F (CCATCCTTGAAAGGATCTTTCC) andmtlD-down-R (cggtacccggggatccttacgccccattgggtgaatcttcag) as primer for PCR amplification to obtainmtlDDownstream homologous fragment of about 800bpmtlDDown was purified using PCR product recovery reagents (figure 6, lane 3). To be provided withmtlD-up、P NCgl0824 A strong promoter andmtlDdown fragment as template, inmtlD-up-F andmtlDheavy with-down-R as primerPerforming PCR amplification to obtainmtlD-up-P NCgl0824 Down fragment (FIG. 7). The suicide plasmid pK18 of corynebacterium glutamicummobsacBDouble digestion with HindI and XbaI, using a one-step cloning kit (Novozam)mtlD-up-P NCgl0824 One-step ligation of the down fragment to pK18mobsacBThe recombinant plasmid obtained above was designated pK18-P NCgl0824 -mtlD。
Example 6
Overexpression Using a Strong promoter insertion strategymtlDAnd (3) constructing a gene recombinant bacterium.
pK18-P was electroporated using an electroporator (Berle) NCgl0824 -mtlDTransferred into L-ornithine by electrotransformationC. glutamicumΔmtlRIn the middle, the shock condition is a voltage of 3000V for 4ms (the width of the shock cup is 2 mm). The primary recombinant bacteria were screened on LB plates containing 25mg/L kanamycin. The recombinant strain was further cultured in a liquid LB medium for 2 hours, and then spread on an LB plate containing 10 g/L sucrose for secondary screening. By using P-F (mtlD) AndmtlDcolony PCR with-down-R as primer, if it can amplify about 1000 bands (FIG. 8), P is considered NCgl0824 Successful insertion of promotermtlDUpstream of the gene, the recombinant bacterium is namedC. glutamicumΔmtlRP NCgl0824 -mtlD。
Example 7
Recombinant Corynebacterium glutamicumC.glutamicumSO26 ΔmtlRAndC. glutamicumΔmtlRP NCgl0824 -mtlDand (5) fermenting and culturing.
Recombinant Corynebacterium glutamicumC.glutamicumSO26 ΔmtlRAndC. glutamicumΔmtlRP NCgl0824 -mtlDcultured on LB plates overnight. A single colony from this fresh plate was inoculated into a 100 mL Erlenmeyer flask containing 10 mL of seed medium and incubated at 32 ℃ and 220rpm for 12 hours.
The formula of the seed culture medium comprises (g/L): 30 parts of glucose, 10 parts of corn steep liquor, 10 parts of yeast powder and (NH)4)2SO415、MgSO42.5、KH2PO41、K2HPO40.5、Na2HPO40.5、CaCO 310。
Inoculating the seed culture solution into 20 mL of fermentation medium with the inoculation amount of 10%, fermenting in a 250 mL triangular flask at 32 deg.C and at 250 rpm.
The fermentation medium formula comprises (g/L): 80 g/L of mannitol, 20 g/L of corn steep liquor and 50g/L, MgSO g of ammonium sulfate42.5 g/L、KH2PO41 g/L、Na2HPO40.5 g/L、K2HPO40.5 g/L、MnSO40.02 g/L、FeSO40.02g/L、CaCO310 g/L。
And finishing the fermentation for 72 h. Corynebacterium glutamicum strainsC. glutamicumSO26 ΔmtlRP NCgl0824 -mtlDThe L-ornithine yield of (2) was 27 g/L (FIG. 9). Compared withC. glutamicumSO26 ΔmtlRThe improvement is 22.5 percent.
Is described inmtlROverexpression based on Gene knock-out bacteriamtlDCan obviously improve the yield of L-ornithine synthesized by corynebacterium glutamicum through mannitol fermentation.

Claims (3)

1. The method for synthesizing the L-ornithine by utilizing the recombinant corynebacterium glutamicum to metabolize the mannitol is characterized by comprising the following steps:
(1) recombinant corynebacterium glutamicum: constructing recombinant plasmid containing homologous upper and lower arms of the negative regulatory protein MtlR, introducing Corynebacterium glutamicum, and knocking out coding gene of the negative regulatory protein MtlRmtlR(ii) a The strong promoter was then designated as P NCgl0824 The promoter is inserted inmtlDUpstream non-coding region of gene, coding gene for enhancing expression of mannitol dehydrogenasemtlDObtaining recombinant corynebacterium glutamicum;
(2) aerobic fermentation to synthesize L-ornithine: inoculating the recombinant corynebacterium glutamicum obtained in the step (1) into a fermentation culture medium to perform aerobic fermentation to synthesize the L-ornithine, wherein the inoculation amount of the corynebacterium glutamicum is 1-20% by volume, and the fermentation temperature is 30 ℃; controlling the rotating speed of a shaking table to be 250 rpm, and controlling the fermentation time to be: 72 h; collecting fermentation liquor after fermentation, and fermentingOD of liquid600Measuring the concentration of L-ornithine;
the fermentation medium comprises mannitol, corn steep liquor, ammonium sulfate and MgSO4、KH2PO4、Na2HPO4、K2HPO4、MnSO4、FeSO4、CaCO3。
2. The method for synthesizing L-ornithine by using recombinant Corynebacterium glutamicum to metabolize mannitol as claimed in claim 1, wherein the content of each component in the fermentation medium is: 20-100 g/L of mannitol, 5-25 g/L of corn steep liquor and 10-60g/L, MgSO of ammonium sulfate40.2-5 g/L、KH2PO40.5-5 g/L、Na2HPO40.5-5 g/L、K2HPO40.5-5 g/L、MnSO40.001-1 g/L、FeSO40.001-1 g/L、CaCO310-30 g/L。
3. The method for synthesizing L-ornithine by using recombinant Corynebacterium glutamicum to metabolize mannitol as claimed in claim 1, wherein the content of each component in the fermentation medium is: 80 g/L of mannitol, 20 g/L of corn steep liquor and 50g/L, MgSO g of ammonium sulfate42.5 g/L、KH2PO41 g/L、Na2HPO40.5 g/L、K2HPO40.5 g/L、MnSO40.02 g/L、FeSO40.02g/L、CaCO310 g/L。
CN201911334517.3A 2019-12-23 2019-12-23 Method for synthesizing L-ornithine by metabolizing mannitol by using recombinant corynebacterium glutamicum Active CN110951766B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911334517.3A CN110951766B (en) 2019-12-23 2019-12-23 Method for synthesizing L-ornithine by metabolizing mannitol by using recombinant corynebacterium glutamicum

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911334517.3A CN110951766B (en) 2019-12-23 2019-12-23 Method for synthesizing L-ornithine by metabolizing mannitol by using recombinant corynebacterium glutamicum

Publications (2)

Publication Number Publication Date
CN110951766A true CN110951766A (en) 2020-04-03
CN110951766B CN110951766B (en) 2023-02-24

Family

ID=69983587

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911334517.3A Active CN110951766B (en) 2019-12-23 2019-12-23 Method for synthesizing L-ornithine by metabolizing mannitol by using recombinant corynebacterium glutamicum

Country Status (1)

Country Link
CN (1) CN110951766B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114990039A (en) * 2022-06-01 2022-09-02 南京工业大学 Recombinant corynebacterium glutamicum for synthesizing L-ornithine from galactose raw material and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1626667A (en) * 1998-03-18 2005-06-15 味之素株式会社 L-glutamic acid-producing bacterium and method for producing L-glutamic acid
US20100062497A1 (en) * 2007-03-14 2010-03-11 Seizaburo Shiraga Microorganism producing an amino acid of the l-glutamic acid family and a method for producing the amino acid

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1626667A (en) * 1998-03-18 2005-06-15 味之素株式会社 L-glutamic acid-producing bacterium and method for producing L-glutamic acid
US20100062497A1 (en) * 2007-03-14 2010-03-11 Seizaburo Shiraga Microorganism producing an amino acid of the l-glutamic acid family and a method for producing the amino acid

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HOFFMANN,S.L.ET AL.: "Lysine production from the sugar alcohol mannitol: Design of the cell factory Corynebacterium glutamicum SEA-3 through integrated analysis and engineering of metabolic pathway fluxes", 《METABOLIC ENGINEERING》 *
PENG,X.ET AL.: "Characterization of the mannitol catabolic operon of Corynebacterium glutamicum", 《APPL MICROBIOL BIOTECHNOL》 *
ZHANG,Q. ET AL.: "Highly efficient biosynthesis of L-ornithine from mannitol by using recombinant Corynebacterium glutamicum", 《BIORESOURCE TECHNOLOGY》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114990039A (en) * 2022-06-01 2022-09-02 南京工业大学 Recombinant corynebacterium glutamicum for synthesizing L-ornithine from galactose raw material and application thereof
CN114990039B (en) * 2022-06-01 2023-07-04 南京工业大学 Recombinant corynebacterium glutamicum for synthesizing L-ornithine by using galactose raw material and application thereof

Also Published As

Publication number Publication date
CN110951766B (en) 2023-02-24

Similar Documents

Publication Publication Date Title
CN110607268B (en) Genetically engineered bacterium for high yield of L-valine and method for producing L-valine by fermentation
CN110982772B (en) Corynebacterium capable of producing valine at high yield and construction method and application thereof
CN110468092B (en) Genetically engineered bacterium capable of producing L-valine at high yield, and construction method and application thereof
CN105368766B (en) One plant of method for producing the genetic engineering bacterium of pentanediamine and its preparing pentanediamine
WO2022174597A1 (en) Genetically engineered bacterium for producing l-sarcosine, construction method therefor and use thereof
CN110331153B (en) Kluyveromyces tyrosol lyase mutant and application thereof
CN110951766B (en) Method for synthesizing L-ornithine by metabolizing mannitol by using recombinant corynebacterium glutamicum
CN113073074B (en) Genetically engineered bacterium for efficiently synthesizing riboflavin and application thereof
CN106635944A (en) Glutamic acid corynebacterium and construction method and application thereof
CN113549633A (en) L-cysteine transporter mutant and application thereof in production of L-cysteine
CN116286703A (en) L-alanine dehydrogenase mutant, engineering bacterium and application
CN113430127B (en) Recombinant bacterium for producing L-lactic acid and application thereof
CN101831397B (en) Escherichia coli and method for preparing L-cysteine by using same
CN108949724B (en) Novel glucoamylase as well as gene and application thereof
CN117866868B (en) L-high proline production strain and construction method and application thereof
CN110872595A (en) Acid-resistant expression cassette and application thereof in organic acid production by fermentation
CN117947075B (en) Arginine production strain, construction method and application thereof
CN118165907B (en) Gamma-aminobutyric acid production strain and construction method and application thereof
CN115960801B (en) Genetically engineered bacterium for high-yield L-threonine and application thereof
CN113249281B (en) Recombinant bacterium for producing phloroglucinol by using ethanol and construction method and application thereof
CN115896153A (en) Method for improving L-ornithine yield by utilizing recombinant corynebacterium glutamicum to metabolize mannitol for fermentation
CN116179380A (en) Yarrowia lipolytica engineering bacterium WSMHP capable of producing pyruvic acid in high yield, construction method and application
CN117265045A (en) Method for producing beta-arbutin by fermenting recombinant corynebacterium glutamicum
CN116640810A (en) Lysine production method, mutant, recombinant microorganism and application
CN116536292A (en) Phosphogluconate dehydratase mutant and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant