CN110951754A

CN110951754A - Tamarix hispida COL transcription factor coding gene and application thereof

Info

Publication number: CN110951754A
Application number: CN202010010100.8A
Authority: CN
Inventors: 高彩球; 雷晓锦; 刘中原; 谭冰; 王春瑶; 房家茹
Original assignee: Northeast Forestry University
Current assignee: Northeast Forestry University
Priority date: 2020-01-06
Filing date: 2020-01-06
Publication date: 2020-04-03
Anticipated expiration: 2040-01-06
Also published as: CN110951754B

Abstract

The invention relates to a Tamarix hispida COL transcription factor coding gene and application thereof, belonging to the technical field of plant genetic engineering breeding. The invention provides a COL transcription factor coding gene of Tamarix hispida and application thereof, aiming at solving the problem that a woody plant with excellent salt tolerance can not be cultivated by utilizing the COL transcription factor coding gene of Tamarix hispida. The full length of cDNA of the COL gene of Tamarix hispida of the invention is 1296bp, and the amino acid sequence coded by the cDNA sequence comprises 431 amino acids, thus being applicable to cultivating salt-tolerant transgenic plant varieties. And constructing an overexpression and suppression expression vector of the ThCOL gene, and obtaining the transgenic Tamarix hispida through transient infection. Experiments such as histochemical staining and physiological index determination show that the Tamarix Briggrashii ThCOL gene overexpression strain has obvious salt tolerance, so that the coding gene of the Tamarix Briggrashii COL transcription factor is an excellent gene for the breeding of forest salt tolerance gene engineering.

Description

Tamarix hispida COL transcription factor coding gene and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering breeding, and particularly relates to a Tamarix hispida COL transcription factor encoding gene and application thereof.

Background

Some abiotic stresses such as saline-alkali, low temperature and drought can cause a series of morphological, physiological, biochemical and molecular level changes of plants, seriously affect the growth and development of the plants and even cause the death of the plants. When plants are stressed by high salt, low temperature, drought and the like in order to adapt to the surrounding environment, cells quickly sense external stress signals and generate stress signals through a series of signal transmission processes, and the stress signals are converged into cell nuclei to finally activate specific transcription regulatory factors. The transcription factor enters into nucleus through functional region, and is combined directly with cis-acting element in specific gene promoter or interacted with functional region of other transcription factor to regulate the expression of specific gene. Because the transcription factor can regulate the expression of a plurality of downstream genes, in plant genetic engineering breeding, compared with the transfer of one functional gene, the transfer of one transcription factor can improve the stress resistance of plants.

Putterill et al isolated CO genes in Arabidopsis thaliana flowering-delayed mutants by map-based cloning, followed by 16 CONSTANS-LIKE (COL) genes in Arabidopsis thaliana, which together form a COL transcription factor family. COL proteins consist of an N-terminal B-box domain and a C-terminal CCT domain. It has been shown that COL transcription factors are involved in many physiological and biochemical processes in plants, such as flowering time, branching, shade-avoidance response, photomorphogenesis or root elongation.

Tamarix hispida is a woody halophyte with very good stress resistance, and can form a natural forest in soil with salt content of 1 percent, so the Tamarix hispida is an ideal material for researching salt tolerance mechanism and cloning salt tolerance genes. At present, the salt tolerance of the COL transcription factor of Tamarix hispida is less understood, the salt tolerance mechanism of the COL transcription factor cannot be deeply understood, and woody plants with excellent salt tolerance cannot be cultivated by utilizing the COL transcription factor coding gene of Tamarix hispida.

Disclosure of Invention

The invention provides a COL transcription factor coding gene of Tamarix hispida and application thereof, aiming at solving the problem that a woody plant with excellent salt tolerance can not be cultivated by utilizing the COL transcription factor coding gene of Tamarix hispida.

The technical scheme of the invention is as follows:

the Tamarix briquets COL transcription factor coding gene is Tamarix briquets ThCOL gene, and the cDNA sequence of the Tamarix briquets ThCOL gene is shown as SEQ ID No: 1 is shown.

Further, the amino acid sequence coded by the cDNA sequence is shown as SEQ ID NO: 2, respectively.

A plant overexpression vector comprising said tamarix hispida ThCOL gene.

A recombinant gene engineering bacterium containing the plant overexpression vector.

Further, the plant overexpression vector containing the Tamarix hispida ThCOL gene is introduced into host bacteria to construct the plant overexpression vector, and the host bacteria are escherichia coli or agrobacterium.

Application of Tamarix hispida ThCOL gene in improving salt tolerance of plants or breeding salt tolerance transgenic plants.

Further, the application comprises the steps of constructing a plant overexpression vector containing Tamarix hispida ThCOL genes, transforming the constructed plant overexpression vector into a woody plant, and culturing to obtain the salt-tolerant transgenic woody plant.

Further, the woody plant is poplar or white birch.

The invention has the beneficial effects that:

the tamarix British ThCOL gene has a cDNA total length of 1296bp, and an amino acid sequence coded by the cDNA sequence comprises 431 amino acids, so that the gene can be used for cultivating salt-tolerant transgenic plant varieties. Constructing an overexpression and suppression expression vector of the ThCOL gene, obtaining transgenic tamarix Brix Tamarix through transient infection, and finding that an overexpression strain of the ThCOL gene of tamarix Brix Tax has obvious salt tolerance through tests such as histochemical staining, physiological index determination and the like, so that the encoding gene of the COL transcription factor of tamarix Brix Tax is an excellent gene for breeding of salt tolerance gene engineering of forest trees.

Drawings

FIG. 1 is a diagram showing the prediction of conserved regions of COL transcription factor-encoding genes;

FIG. 2 is a graph showing the alignment of Tamarix hispidus ThCOL protein with other 16 plant COL proteins;

FIG. 3 is a graph of the analysis of the expression pattern of Tamarix hispidus ThCOL under various abiotic stresses and hormone treatments;

FIG. 4 is an analysis chart of the expression pattern of the transient transformation Tamarix chinensis ThCOL gene under NaCl stress;

FIG. 5 is a histochemical staining analysis of the Tamarix hispida Tamarix gene under NaCl stress and control;

FIG. 6 shows transgenic Tamarix Briggi H under NaCl stress₂O₂Determination analysis chart of content;

FIG. 7 is a diagram showing the analysis of the determination of the MDA content of transgenic Tamarix Briggrashii under NaCl stress;

FIG. 8 is a graph showing the analysis of the determination of relative conductivity content of transgenic Tamarix hispidus under NaCl stress.

Detailed Description

The technical solutions of the present invention are further described below with reference to the following examples, but the present invention is not limited thereto, and any modifications or equivalent substitutions may be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Example 1 cloning of Tamarix Britchuensis COL transcription factor-encoding Gene

Sowing Tamarix hispida seeds in artificial soil prepared from peat soil and sand according to the mass ratio of 2:1, and placing the artificial soil at the relative humidity of 65-75% and the light intensity of 400 mu mol.m^-2·s^-1And an average temperature of 22 + -2 deg.C. After 2 months of growth, use 0.3 mol.L^-1NaHCO₃Irrigating roots with the solution, carrying out stress treatment, and putting leaves and roots of the roots into liquid nitrogen for quick freezing for RNA extraction at 0h, 12h, 24h and 48h respectively.

And (3) extracting RNA of the tamarix chinensis seedlings in each stress treatment period by using a CTAB method, and sending the extracted RNA samples to Shenzhen Hua Dageney science and technology Limited company for construction and sequencing of a transcriptome library. And comparing and splicing the obtained RNA sequencing results of each processing period, searching the results after sequencing comparison and splicing by using a CONSTANS-LIKE translation factor as a keyword, further comparing and confirming the searched sequence by using BLASTX software, and determining whether the sequence has a complete open reading frame by combining with an ORF folder program (http:// www.ncbi.nlm.nih.gov/gorf. html). The COL gene with the complete ORF was selected.

According to the characteristics of COL transcription factor coding gene, the gene shown in SEQ ID NO: 3 and SEQ ID NO: 4, specific upstream and downstream primers ThCOL-F and ThCOL-R, taking tamarix chinensis cDNA as a template, and carrying out RT-PCR cloning on COL transcription factor coding genes.

The RT-PCR reaction system was 20. mu.L, which included 2. mu.L of template, 1. mu.L each of ThCOL-F and ThCOL-R primers (10. mu. mol/L), 0.4. mu.L of dNTP Mix (10mmol/L), 2.0. mu.L of 10 XTAAq PCR buffer, and 0.25. mu.L of LA Taq (5U/. mu.L). The reaction program is pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min, and 35 cycles; extension at 72 ℃ for 10 min.

The gene of interest obtained by gel recovery was ligated into the pMD18-T vector, the ligation product was subsequently transformed into escherichia coli competent cells, and single clones were picked up with the gene primers ThCOL-F and ThCOL-R and the nucleotide sequence as shown in SEQ ID NO: 5 and SEQ ID NO: 6, carrying out PCR verification and further sequencing verification on vector primers pMD18-T-F and pMD18-T-R to obtain a primer sequence shown as SEQ ID No: 1, and the full-length cDNA sequence of the Tamarix hispidus COL transcription factor coding gene.

Example 2 sequence analysis of Tamarix Britchii COL transcription factor-encoding Gene Using bioinformatics software and Online network resources

As shown in SEQ ID No: 1, the length of the coding region of the COL transcription factor coding gene of Tamarix hispida cloned in example 1 is 1296 bp. Encoding the polypeptide as shown in SEQ ID NO: 2, 431 amino acids.

Using the web address ofhttp://au.expasy.org/tools/protparam.html) The ProtParam software calculates the molecular weight and the theoretical isoelectric point of the protein coded by the COL transcription factor coding gene of Tamarix hispida, and the result shows that the molecular weight of the protein coded by the gene is 47.75kDa, and the theoretical isoelectric point is 5.78.

Similarity analysis was performed on tamarix Brix COL transcription factor coding genes by the BLASTx database with the website address (http:// BLAST. ncbi. nlm. nih. gov/BLAST. cgi.

Using the web address ofhttp://www.ncbi.nlm.nih.gov/BLAST/) The Blast program of (1) was subjected to sequence homology search, and COL gene amino acid sequences of other 16 different plants having a high degree of similarity thereto were selected, followed by multiple sequence alignment by BioEdit software. The COL genes of the 16 selected plants were respectively:

Herrania umbratica(XP_021296421.1)、Durio zibethinus(XP_022727938.1)、

Theobroma cacao(XP_007032965.2)、Gossypium darwinii(AJR28657.1)、

Gossypium australe(KAA3461084.1)、Thespesia populneoides(AJR28659.1)、

Gossypium raimondii(XP_012436773.1)、Populus trichocarpa(XP_006373513.2)、

Populus alba(TKS00140.1)、Oxybasis rubra(ACB36911.2)、

Populus euphratica(XP_011021143.1)、Hibiscus syriacus(KAE8659347.1)、

Malus domestica(XP_008341828.2)、Hevea brasiliensis(XP_021680019.1)、

Juglans regia(XP_018834143.1)、Arabidopsis thaliana(AT5G24930.1)。

further, the sequence homology comparison of the protein sequence encoded by the gene and other COL genes of 16 plants with high similarity degree by Clustal software shows that the COL protein of Tamarix hispida has low homology with the COL proteins of other plants, but has a conserved B-BOX domain as shown in FIG. 2.

Example 3 analysis of expression patterns of the ThCOL Gene under different abiotic stresses and hormone treatment

The ThCOL transcription factor plays an important role in plant stress tolerance regulation. 1 single tamarix chinensis ThCOL gene with a complete open code frame is obtained by cloning, and after the sequence of the tamarix chinensis ThCOL gene is analyzed, in order to research the functions of the tamarix chinensis ThCOL gene, the gene is further analyzed by real-time fluorescent quantitative RT-PCR under different abiotic stresses: high salt content-400 mmol NaCl, drought content-20% PEG, heavy metal-150. mu. mol CdCl₂And hormone stress: ABA-100. mu. mol, GA₃Expression profile under 50. mu. mol treatment conditions.

FIG. 3 is a graph showing an analysis of the expression patterns of Tamarix hispidus ThCOL protein under different abiotic stresses and hormone treatments, showing that ThCOL expression in roots and leaves of Tamarix hispidus changes at least at one stress treatment time point under three abiotic stresses and two hormone treatments, indicating that ThCOL transcription factors can respond to the three abiotic stresses: NaCl, PEG, CdCl₂And two hormonal stresses: ABA, GA₃In particular, at almost all time points studied under NaCl stress, the expression in Tamarix chinensis roots and leaves was significantly up-regulated, indicating that the ThCOL gene may be associated with salt stress.

Example 4 construction of overexpression vector of Tamarix Britchuensis ThCOL Gene

BamHI and KpnI restriction enzyme sites are respectively introduced into the 5 'end and the 3' end of the target gene according to the multiple cloning site of the plant overexpression vector pROKII and the characteristic analysis of the target gene by BioEdit software. Taking cDNA obtained by reverse transcription of leaf and root tissues of unstressed Chinese tamarisk as a template, and taking the sequence shown in SEQ ID NO: 7 and SEQ ID NO: 8, using pROKII-ThCOL-F and pROKII-ThCOL-R as primers to carry out PCR amplification.

The PCR reaction system is shown in Table 1:

TABLE 1

The PCR reaction program is pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 2min, and 30 cycles; extension at 72 ℃ for 7 min.

And recovering and purifying the ThCOL target gene obtained by PCR by using a gel recovery kit. Carrying out double enzyme digestion on the recovered and purified ThCOL target gene fragment and the pROKII vector plasmid respectively by using BamHI and KpnI restriction enzymes, reacting for 4-6 h at 37 ℃, wherein the enzyme digestion system is shown in Table 2:

TABLE 2

And (4) respectively recovering and purifying the enzyme digestion product by using a gel recovery kit. And recovering the purified ThCOL target gene fragment subjected to double enzyme digestion and the pROKII vector fragment, and connecting for 8-12 h at 16 ℃ to construct a recombinant vector pROKII-ThCOL, wherein a connecting system is shown in Table 3.

TABLE 3

The constructed recombinant vector pROKII-ThCOL is transformed into escherichia coli competent cells, and 6 positive monoclonal bacterial plaques are picked for amplification culture.

Using the peptide as set forth in SEQ ID NO: 7. SEQ ID NO: 8 and the gene-specific upstream and downstream primers pROK II-ThCOL-F, pROK II-ThCOL-R shown in SEQ ID NO: 9. SEQ ID NO: 10, bacterial liquid PCR detection is carried out on upstream and downstream primers pROK II-F, pROK II-R of an overexpression vector pROKII, and a reaction system is shown in a table 4:

TABLE 4

2 clones capable of amplifying specific target bands are selected for sequencing, the correct clone is the plant overexpression vector pROKII-ThCOL, the strain is preserved, and pROKII-ThCOL escherichia coli plasmids are extracted for later use.

Example 5 transformation of Agrobacterium tumefaciens and Positive cloning PCR assay

EHA105 was transformed by a liquid nitrogen freeze-thaw method, comprising the following specific steps:

(1) using CaCl₂Preparing EHA105 competence, taking 0.1-1 mu g (5-10 mu L) of pROKII-ThCOL plasmid obtained in example 4 to 50 mu L of Agrobacterium competent EHA105, mixing and carrying out ice bath for 30 min;

(2) placing into liquid nitrogen for 5min, rapidly transferring into 37 deg.C water bath, water bathing for 5min, and standing in ice bath for 2 min;

(3) adding 500 mu L of LB liquid culture medium without any antibiotics, placing the mixture in a shaking table at 28 ℃, and shaking at 200rpm for 2-4 h;

(4) taking 150. mu.L of the transformation mixed solution and 300. mu.L of the transformation mixed solution, uniformly spreading the transformation mixed solution on an LB solid culture medium containing 50mg/L Rif and 50mg/L Kan, and culturing the transformation mixed solution at the constant temperature of 28 ℃ for 2 days.

6 positive single clones were randomly picked and inoculated in LB liquid medium containing 50mg/L Kan and 50mg/L Rif, and cultured overnight at 28 ℃ with a shaker at 200 rpm.

10 μ L of the bacterial solution was denatured at 98 ℃ for 5 min. Taking the denatured bacterial liquid as a template, and using a nucleic acid sequence shown as SEQ ID NO: 7. SEQ ID NO: 8 and the gene-specific upstream and downstream primers pROK II-ThCOL-F, pROK II-ThCOL-R shown in SEQ ID NO: 9. SEQ ID NO: positive clones were detected by PCR using the upstream and downstream primers pROK II-F, pROK II-R of the overexpression vector pROKII shown in FIG. 10.

Detecting with 1% agarose gel electrophoresis, and if the target band is specific and correct in size, preserving pROKII-ThCOL Agrobacterium strain for later use.

Comparative example 1: construction of expression vector for inhibiting Tamarix hispida ThCOL gene

1. Construction of pFGC5941-ThCOL-Cis

The target gene was characterized according to the multiple cloning site of the plant interference vector pFGC5941, and the BioEdit software. Restriction enzyme sites NcoI and AscI are respectively introduced at the 5 'end and the 3' end of the target gene.

Using pROKII-ThCOL plasmid as a template, as shown in SEQ ID NO: 11 and SEQ ID NO: pFGC5941-ThCOL-Cis-F/R shown in 12 is used as a primer for PCR, and a target gene with NcoI and AscI restriction enzyme sites is amplified. The PCR system is shown in Table 5:

TABLE 5

The PCR reaction program is pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 59 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles; extension at 72 ℃ for 10 min.

And recovering and purifying the target fragment of the PCR product ThCOL-Cis by using a gel recovery kit. The ThCOL-Cis target gene fragment and the plant interference vector pFGC5941 plasmid are double-digested by restriction enzymes NcoI and AscI respectively.

The double digestion reaction system is shown in Table 6:

TABLE 6

After incubation at 37 ℃ for 4h, the resulting cleavage products were recovered and purified, respectively.

The purified ThCOL-Cis double-restriction enzyme target fragment is connected with a plant interference vector pFGC5941 double-restriction enzyme large fragment by using T4 DNA ligase, and a T4 DNA ligase connecting system is shown in a table 7:

TABLE 7

And connecting for 12-16 h at 16 ℃, and recombining into a vector pFGC 5941-ThCOL-Cis.

pFGC5941-ThCOL-Cis ligation liquid heat shock method was used to transform competent E.coli cells, and 6 positive single clones were randomly picked and inoculated into LB liquid medium containing 50mg/L Kan, shaking table at 37 ℃ and 200rpm overnight.

10 μ L of the bacterial solution was denatured at 98 ℃ for 5 min. Taking bacterial liquid as a template, and respectively taking SEQ ID NO: 13 and SEQ ID NO: 14 and Cis-F/R and SEQ ID NO: 11 and SEQ ID NO: pFGC5941-ThCOL-Cis-F/R shown in 12 is used as a primer to carry out bacteria liquid PCR detection positive cloning, and a PCR reaction system is shown in Table 8:

TABLE 8

Detecting with 1% agarose gel electrophoresis, if the size of the band is correct, preserving strain, extracting plasmid with plasmid (small amount) extraction kit, and sequencing.

2. Construction of pFGC5941-ThCOL-Anti

pROKII-ThCOL plasmid is used as a template, and is shown as SEQ ID NO: 15 and SEQ ID NO: 16 pFGC5941-ThCOL-Anti-F/R as a primer is used for PCR amplification of a target gene with XbaI and BamHI restriction enzyme sites.

The PCR reaction system is shown in Table 9:

TABLE 9

The PCR reaction program is pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 59 ℃ for 30s, and extension at 72 ℃ for 40s for 30 cycles; extension at 72 ℃ for 10 min. And recovering the PCR product, namely a ThCOL-Anti target fragment by using a gel recovery kit for purification.

The ThCOL-Anti target gene fragment and the recombinant vector pFGC5941-ThCOL-Cis are subjected to double digestion by XbaI and BamHI restriction enzymes respectively. The double digestion reaction system is shown in table 10:

watch 10

Incubate at 37 ℃ for 2 h. Respectively recovering and purifying the obtained enzyme digestion products, connecting the purified ThCOL-Anti double enzyme digestion target fragment with the pFGC5941-ThCOL-Cis double enzyme digestion large fragment by using T4 DNA ligase,

t4 DNA ligase ligation system, as shown in Table 11:

TABLE 11

And (3) catalytically connecting for 12-16 h at 16 ℃ and recombining a vector pFGC 5941-ThCOL. pFGC5941-ThCOL was transformed into E.coli competent cells.

6 positive single clones were randomly picked and inoculated in LB liquid medium containing 50mg/L Kan, shaking at 37 ℃ and cultured overnight at 200 rpm.

10 μ L of the bacterial solution was denatured at 98 ℃ for 5 min. Taking the modified bacterial liquid as a template, and respectively taking the nucleotide sequences shown in SEQ ID NO: 17 and SEQ ID NO: 18 and Anti-F/R shown in SEQ ID NO: 15 and SEQ ID NO: and (3) carrying out bacteria liquid PCR detection on positive clones by taking pFGC5941-ThCOL-Anti-F/R as a primer.

The PCR reaction system is shown in Table 12:

TABLE 12

Detecting by using 1% agarose gel electrophoresis, if the target band is specific and has correct size, storing pFGC5941-ThCOL escherichia coli strains, extracting plasmids, sequencing and verifying, and transforming agrobacterium strains EHA 105.

6 positive single clones were randomly picked and inoculated in LB liquid medium containing 50mg/L Kan and 50mg/L Rif, and cultured overnight at 200rpm with a shaker at 28 ℃.

10 μ L of the bacterial solution was denatured at 98 ℃ for 5 min. Taking the modified bacterial liquid as a template, and respectively taking the nucleotide sequences shown in SEQ ID NO: 13 and SEQ id no: 14 Cis-F/R, SEQ ID NO: 11 and SEQ ID NO: pFGC5941-ThCOL-Cis-F/R shown in FIG. 12, SEQ ID NO: 15 and SEQ ID NO: and Anti-F/R and pFGC5941-ThCOL-Anti-F/R shown in 16 are used as primers to carry out bacteria liquid PCR detection on positive clones.

Detecting by using 1% agarose gel electrophoresis, and if the target band is specific and has correct size, storing the pFGC5941-ThCOL agrobacterium strain for later use.

Example 6: transient transformation of Tamarix hispida ThCOL Gene

In this example, transient transformation technology was used to transfer the overexpression vector pROKII-ThCOL (OE) constructed in example 4 and the repression expression vector pFGC5941-ThCOL (SE) constructed in comparative example 1 into Tamarix hispida to transiently overexpress or repress the ThCOL gene, respectively. Meanwhile, empty pROKII vector was transferred into Tamarix hispida as a Control (CON).

1. Preparation of culture Medium

Preparing a staining solution: 270mM mannitol +40mM CaCl₂+ 120. mu.M AS + 2% sucrose +2mM MES/KOH + 20. mu.M 5-Azacytidine +200mg/L DTT +0.5mg/L NAA +2 mg/L6 BA + 0.02% Tween (pH 5.6)

Preparation of a washing solution: 40mM CaCl₂+ 120. mu.M AS + 3% sucrose +0.5mg/L NAA +2 mg/L6 BA +200mg/L DTT

Wherein AS, DTT, NAA, 6BA and Tween can not be sterilized at high temperature, and can be added after high temperature sterilization.

Co-culture of solid medium: MS +0.5mg/L NAA +2 mg/L6 BA + 150. mu.M AS +200mg/L DTT +7g/L agar + 1% sucrose

Stress medium: MS +150mM NaCl

2. Preparation of infection engineering bacteria

(1) The pROKII-ThCOL (OE), pROKII (CON), pFGC5941-ThCOL (RNAi) Agrobacterium species were streaked onto LB solid medium containing 50mg/L Rif and 50mg/L Kan, respectively, and cultured at 28 ℃ for two days;

(2) picking single colony to inoculate in a small amount of LB liquid culture medium containing 50mg/L Rif and 50mg/L Kan, and culturing at 28 ℃ overnight at 200rpm until OD is 0.8;

(3) taking 1mL of shake culture liquid to carry out secondary activation in 50mL of liquid LB culture medium (containing 50mg/L of Rif, 50mg/L of Kan, 5mM SPD, 20 mu M of 5-Azacytidine, 120 mu M of AS and 150mg/L of DTT), and carrying out shake culture at 28 ℃ and 200rpm until OD of the culture liquid is obtained₆₀₀Is 0.7;

(4) transferring the bacterial liquid to a 50mL sterilized centrifuge tube, placing the sterilized centrifuge tube into a low-temperature high-speed large-capacity centrifuge for centrifugation at 3000rpm for 10min, and collecting thalli;

(5) the cells were resuspended in the corresponding volume of the staining solution.

3. Instantaneous transformation of tamarix chinensis

(1) Dividing the tamarix chinensis seedlings into three parts uniformly, and respectively and rapidly transferring the three parts to an infection liquid added with strains pROKII-ThCOL, pROKII or pFGC 5941-ThCOL;

(2) placing into a constant temperature oscillator at 25 ℃, and infecting for 1h at 90 rpm;

(3) adding 1/2 volume of fresh infection solution (sterile fresh solution), placing in a constant temperature oscillator at 25 deg.C, and infecting at 90rpm for 1.5 h;

(4) and (3) taking seedlings, quickly washing the seedlings for 1 minute by using a washing solution to rehydrate the plants for less than two minutes, sucking the water by using sterile filter paper, inserting the plants into a co-culture solid culture medium, carrying out co-culture for 24 hours, 36 hours, 48 hours and 72 hours respectively, then directly and quickly freezing the plants by using liquid nitrogen, and storing the plants at the temperature of minus 80 ℃ for quantitatively analyzing whether the instantaneous overexpression and the suppression expression tamarix chinensis seedlings are successfully obtained.

In order to further analyze the expression condition of the ThCOL gene in transient overexpression and inhibition expression of Tamarix Briggrashii, total RNA transiently infecting Tamarix Briggi after 24h, 36h, 48h and 72h of co-culture is extracted and is reversely transcribed into cDNA, and the expression quantity of the ThCOL gene is analyzed by utilizing qRT-PCR, and the result is shown in FIG. 3, compared with CON (control), the expression quantity of ThCOL in OE is obviously increased, and the expression quantity of ThCOL in RNAi inhibition expression strains is obviously reduced, which indicates that the example successfully obtains the ThCOL gene transient transformation Tamarix Briggi.

Example 7 histochemical staining analysis of transient transgenic Tamarix Briggrassis seedlings under NaCl stress

This example analyzes NBT, DAB and Evans blue staining of Tamarix hispida after transient infection in example 5 after 150mM NaCl stress for 0h and 2h, to compare the content of active oxygen and damage of cell membrane in 3 transgenic plants after adversity stress.

Nitroblue Tetrazolium (NBT) reduction method can study intracellular superoxide ion level, and the shade of blue material reflects intracellular O₂ ^-How much. The specific preparation method of the NBT staining solution with the concentration of 1mg/mL in the embodiment comprises the following steps: 50mg of NBT powder was weighed out and dissolved in 50mL of phosphate buffer (0.1M, pH 7.0).

Diaminobenzidine (DAB) staining reflects intracellular H by shade of color₂O₂The content of the compound is small. The specific preparation method of the 1mg/mL DAB staining solution in the embodiment comprises the following steps: 50mg of DAB powder was weighed out and dissolved in 50mL of phosphate buffer (0.1M, pH 7.0).

Evans Blue (Evans Blue) staining can be used for judging whether plant cell membranes are intact or not according to the staining depth. Normal living cells have complete cell membrane structure, and can reject evans blue staining solution, so that the evans blue staining solution cannot enter cells. And the cell with lost activity or incomplete cell membrane has increased permeability and can be dyed blue by Evans blue. And the greater the number of cells with lost activity or incomplete cell membranes, the deeper the Evans blue staining results. The specific preparation method of the 1mg/mL Evans blue dyeing solution in the embodiment is as follows: 50mg of Evans blue was weighed out and dissolved in 50mL of distilled water.

The transgenic plants stained in this example were Tamarix hispida plants transiently transformed with the overexpression vector pROKII-ThCOL (OE), Tamarix hispida plants transiently transformed with the suppression expression vector pFGC5941-ThCOL (RNAi), and blank (CON) control Tamarix hispida plants transiently transformed with empty pROKII vector.

The dyeing method of the present example is: and (3) placing the three transgenic tamarix setifera varieties subjected to stress of 150mM NaCl for 0h and 2h in 10mL centrifuge tubes, respectively adding different staining solutions to immerse all the leaves in the staining solutions, standing at room temperature for a proper time, and decolorizing with a decolorizing solution (glacial acetic acid: alcohol: 1:3) after a staining result is obvious.

The staining results are shown in FIG. 5, and the degree of staining was substantially the same for the three transient expression lines when unstressed. After 2h of stress, 3 transgenesThe coloring of the strain is deepened. However, the IE strain was most intensely stained and the OE strain was least intensely stained in NBT staining, indicating that overexpression of ThCOL was effective in eliminating O in cells₂ ^-In the opposite direction, inhibition of expression results in intracellular O₂ ^-Increased accumulation of; likewise, in DAB staining, OE strain staining was also the lightest, IE strain staining was darker than CON. Indicating OE Strain H after stress₂O₂Minimal content, IE strain H₂O₂The content is the largest. Further Evans blue staining results also show that the cell membrane damage condition after NaCl stress can be obviously improved by the overexpression of the ThCOL gene. Taken together, the results show that the overexpression of the ThCOL gene can improve the ROS scavenging capability of plants after salt stress, thereby relieving the damage of the stress to cells.

Example 8 analysis of physiological and biochemical indicators of transient transgenic Tamarix Briggrashii under NaCl stress

In this embodiment, after placing the tamarix setifera subjected to the transient infection in 150mM NaCl and stressing for 12 and 24 hours, respectively, the physiological indexes of the tamarix setifera were measured, and H of 3 transgenic tamarix setifera were analyzed and compared₂O₂Content, Malondialdehyde (MDA) content, conductivity.

Example H₂O₂The content and MDA content are measured by adopting H produced by Nanjing institute of bioengineering₂O₂Assay kit for content, MDA content;

the specific method for measuring the relative conductivity is as follows: 1) preparation of 50ml glass Erlenmeyer flasks: cleaning with deionized water, sterilizing, oven drying, balancing with sterilized deionized water for 24 hr, and oven drying in oven for use; 2) washing the plant material with tap water to remove dust on the surface, washing with double distilled water and ultrapure water for 3 times, and adsorbing water on the surface with clean filter paper. Respectively placing the blades with the same area into a beaker, adding 50ml of ultrapure water, vacuumizing for 15min by using a vacuumizing instrument, measuring the conductivity value by using a conductivity meter, and recording S1; 3) then putting the mixture into a water bath with the temperature of 90 ℃ for 20min, cooling the mixture to room temperature, measuring the electric conductivity of the mixture, and recording S2; 4) calculating the formula: relative conductivity is S1/S2.

H₂O₂Is an intracellular oxidative metabolite, the worse the plant is able to resist adverse stress, the more severely the cell is damaged, H₂O₂The higher the content. FIG. 6 shows the H of three transgenic Tamarix hispida species after 150mM NaCl stress for 0H, 12H and 24H, respectively₂O₂The results of the content determination show that the H of the OE line after 12H and 24H stress is increased under 150mM NaCl stress₂O₂The content was kept low, in particular H of the over-expressed lines OE of ThCOL at 24H of stress₂O₂The content is 0.83 times of CON and 0.66 times of RNAi.

Under stress conditions, cells undergo membrane lipid peroxidation and produce Malondialdehyde (MDA). MDA is generally used as an index of lipid peroxidation, and indicates the degree of lipid peroxidation of cell membranes and the strength of plant response to stress conditions. Fig. 7 shows MDA content determination results of three transgenic tamarix setifera lines after stress of 150mM NaCl for 0h, 12h and 24h, respectively, and the results show that the MDA content of the 3 transgenic tamarix setifera lines after stress is increased to different degrees compared to the MDA content of 0h, and the MDA content of RNAi is highest at each stress time point, and the MDA content of OE is lowest at CON times. From this, it was found that the RNAi strain had a high degree of cell damage and a large number of deaths, and that the OE strain had a low degree of cell damage and a small number of deaths.

Relative conductivity is also a physiological indicator of cell membrane damage, which leads to increased electrolyte extravasation. FIG. 8 shows the relative conductivities of three transgenic Tamarix hispida plants after stress of 150mM NaCl for 0h, 12h and 24h, respectively, and the results show that the relative conductivity of the overexpression lines OE of the ThCOL gene is lower than that of the CON and RNAi lines, indicating that the salt tolerance of the OE plants is higher than that of the CON and RNAi lines.

In conclusion, the salt tolerance function of the Tamarix hispida ThCOL gene is analyzed by a transient transformation method, and the result shows that the Tamarix hispida ThCOL gene improves the salt tolerance of transgenic plants and is an excellent gene capable of improving the salt tolerance of the plants, so that the gene has very important application prospect in preparing the transgenic plants, particularly transgenic forest trees.

SEQUENCE LISTING

<110> northeast university of forestry

<120> Tamarix hispida COL transcription factor coding gene and application thereof

<130>1

<160>18

<170>PatentIn version 3.3

<210>1

<211>1296

<212>DNA

<213> Tamarix Brisson

<400>1

atgacaatcg agtctccttc acacaatata gaaatcaccc acaaccaacc ctctaccccg 60

ggaaagaaga ataggaaacc agagacgagc gaaatgttga aggaagaatt atcagacggt 120

ggcagacatg atggaggtaa taattgggcccgtgtctgtg acacatgtcg ttcggcaccc 180

tgcaccgtct actgccaggc cgattcagca tacttgtgca cagactgcga tgctcgtatt 240

catgctgcca cccaaacagc atccacgcac gagcgtgttt tggtgtgcga ggcatgtgaa 300

cgcatgccgg cagcatttct gtgcaaggcg gatgcagcat cactctgtgt tagttgtgac 360

gccgatatcc actccgctaa ccctttagcc aatcgccacc accgggttcc catccacccc 420

atcgtcggcg gcatctatgg acaaccgggc accgacggag ctggtaggct gccagagcag 480

atgggatatg gtacggacag cttcttggcc ccgaaaggcg atgaatgttt cagtaaggaa 540

gatgaggatg aagcggcttc atggctgctg cttaacccct cggtgaaaaa cagtaacaat 600

catcataaca gtaatgtcaa tatgttcggt ggtgatgtgg atgactacct ggacctggac 660

gagtacaatt caggtataga ttcccaattc tctgagcaac acagccaaca acagcagtat 720

gctatgccac ataagagtta tggaggggac gatgacagcg cggtgccagt tcaaagcgca 780

gaaacaaagt atcaggtgca gcagcagcaa caacaaccgc acaattttcg gatcgggatg 840

ggctaccaaa caaacgctgc atacagctac attgcatcaa ttagccgaag cgaatccgtc 900

tcatccccgg atgttagtct tgtacaagaa tctacgacga gtgacatcaa aatgccgcat 960

tcgagaaccc caaacggaac agttgatttc ttttcgagtc ctcctcttca aactccaact 1020

cagctcgctc cagtggatag ggaggctaga gttctgagat acagagaaaa gaaaaagtcg 1080

agaaagtttg agaagaaaat ccgttatgcc tcaagaaaag cttatgcaga gaccaggcca 1140

aggattaaag gcagatttgc aaagagatca gatgtggaag ttgaggtgga acagaggttg 1200

cccaataatc tcatagggga aggtggatat ggcggcattg tgccttccga gtgctggaag 1260

tgtaacgaag attcagtcat cacgtgtcag aagtaa 1296

<210>2

<211>431

<212>PRT

<213> Tamarix Brisson

<400>2

Met Thr Ile Glu Ser Pro Ser His Asn Ile Glu Ile Thr His Asn Gln

1 5 10 15

Pro Ser Thr Pro Gly Lys Lys Asn Arg Lys Pro Glu Thr Ser Glu Met

20 25 30

Leu Lys Glu Glu Leu Ser Asp Gly Gly Arg His Asp Gly Gly Asn Asn

35 40 45

Trp Ala Arg Val Cys Asp Thr Cys Arg Ser Ala Pro Cys Thr Val Tyr

50 55 60

Cys Gln Ala Asp Ser Ala Tyr Leu Cys Thr Asp Cys Asp Ala Arg Ile

65 70 75 80

His Ala Ala Thr Gln Thr Ala Ser Thr His Glu Arg Val Leu Val Cys

85 90 95

Glu Ala Cys Glu Arg Met Pro Ala Ala Phe Leu Cys Lys Ala Asp Ala

100 105 110

Ala Ser Leu Cys Val Ser Cys Asp Ala Asp Ile His Ser Ala Asn Pro

115 120 125

Leu Ala Asn Arg His His Arg Val Pro Ile His Pro Ile Val Gly Gly

130 135 140

Ile Tyr Gly Gln Pro Gly Thr Asp Gly Ala Gly Arg Leu Pro Glu Gln

145 150 155 160

Met Gly Tyr Gly Thr Asp Ser Phe Leu Ala Pro Lys Gly Asp Glu Cys

165 170 175

Phe Ser Lys Glu Asp Glu Asp Glu Ala Ala Ser Trp Leu Leu Leu Asn

180 185 190

Pro Ser Val Lys Asn Ser Asn Asn His His Asn Ser Asn Val Asn Met

195 200 205

Phe Gly Gly Asp Val Asp Asp Tyr Leu Asp Leu Asp Glu Tyr Asn Ser

210 215 220

Gly Ile Asp Ser Gln Phe Ser Glu Gln His Ser Gln Gln Gln Gln Tyr

225 230 235 240

Ala Met Pro His Lys Ser Tyr Gly Gly Asp Asp Asp Ser Ala Val Pro

245 250 255

Val Gln Ser Ala Glu Thr Lys Tyr Gln Val Gln Gln Gln Gln Gln Gln

260 265 270

Pro His Asn Phe Arg Ile Gly Met Gly Tyr Gln Thr Asn Ala Ala Tyr

275 280 285

Ser Tyr Ile Ala Ser Ile Ser Arg Ser Glu Ser Val Ser Ser Pro Asp

290 295 300

Val Ser Leu Val Gln Glu Ser Thr Thr Ser Asp Ile Lys Met Pro His

305 310 315 320

Ser Arg Thr Pro Asn Gly Thr Val Asp Phe Phe Ser Ser Pro Pro Leu

325 330 335

Gln Thr Pro Thr Gln Leu Ala Pro Val Asp Arg Glu Ala Arg Val Leu

340 345 350

Arg Tyr Arg Glu Lys Lys Lys Ser Arg Lys Phe Glu Lys Lys Ile Arg

355 360 365

Tyr Ala Ser Arg Lys Ala Tyr Ala Glu Thr Arg Pro Arg Ile Lys Gly

370 375 380

Arg Phe Ala Lys Arg Ser Asp Val Glu Val Glu Val Glu Gln Arg Leu

385 390 395 400

Pro Asn Asn Leu Ile Gly Glu Gly Gly Tyr Gly Gly Ile Val Pro Ser

405 410 415

Glu Cys Trp Lys Cys Asn Glu Asp Ser Val Ile Thr Cys Gln Lys

420 425 430

<210>3

<211>30

<212>DNA

<213> Artificial sequence

<400>3

gctctagaat gacaatcgag tctccttcac 30

<210>4

<211>31

<212>DNA

<213> Artificial sequence

<400>4

cggggtacct tacttctgac acgtgatgac t 31

<210>5

<211>24

<212>DNA

<213> Artificial sequence

<400>5

agcggataac aatttcacac agga 24

<210>6

<211>24

<212>DNA

<213> Artificial sequence

<400>6

cgccagggtt ttcccagtca cgac 24

<210>7

<211>29

<212>DNA

<213> Artificial sequence

<400>7

cgcggatcca tgacaatcga gtctccttc 29

<210>8

<211>31

<212>DNA

<213> Artificial sequence

<400>8

cggggtacct tacttctgac acgtgatgac t 31

<210>9

<211>20

<212>DNA

<213> Artificial sequence

<400>9

ggcgaacgtg gcgagaaagg 20

<210>10

<211>22

<212>DNA

<213> Artificial sequence

<400>10

acaggtttcc cgactggaaa gc 22

<210>11

<211>32

<212>DNA

<213> Artificial sequence

<400>11

catgccatgg cttcttggcc ccgaaaggcg at 32

<210>12

<211>32

<212>DNA

<213> Artificial sequence

<400>12

ttggcgcgcc atgagacgga ttcgcttcgg ct 32

<210>13

<211>22

<212>DNA

<213> Artificial sequence

<400>13

ataaggaagt tcatttcatt tg 22

<210>14

<211>20

<212>DNA

<213> Artificial sequence

<400>14

caatcaaatg aagagccaat 20

<210>15

<211>30

<212>DNA

<213> Artificial sequence

<400>15

gctctagact tcttggcccc gaaaggcgat 30

<210>16

<211>30

<212>DNA

<213> Artificial sequence

<400>16

cgggatccat gagacggatt cgcttcggct 30

<210>17

<211>22

<212>DNA

<213> Artificial sequence

<400>17

cttacttaca cttgccttgg ag 22

<210>18

<211>21

<212>DNA

<213> Artificial sequence

<400>18

atctgagcta cacatgctca g 21

Claims

1. The Tamarix hispida COL transcription factor coding gene is Tamarix hispida ThCOL gene, and is characterized in that the cDNA sequence of the Tamarix hispida ThCOL gene is shown as SEQ ID No: 1 is shown.

2. The tamarix British ThCOL gene of claim 1, wherein the cDNA sequence encodes an amino acid sequence set forth in SEQ ID NO: 2, respectively.

3. A plant overexpression vector comprising the tamarix British ThCOL gene of claim 1.

4. A recombinant genetically engineered bacterium comprising the plant overexpression vector of claim 3.

5. The recombinant genetically engineered bacterium of claim 4, wherein the plant overexpression vector containing Tamarix hispanicus ThCOL gene is introduced into a host bacterium, and the host bacterium is Escherichia coli or Agrobacterium.

6. Use of the tamarix British ThCOL gene of claim 1 for increasing salt tolerance in a plant or for breeding salt tolerant transgenic plants.

7. The use of the tamarix British ThCOL gene according to claim 6, comprising constructing a plant overexpression vector comprising the tamarix British ThCOL gene, transforming the constructed plant overexpression vector into a woody plant, and growing the salt-tolerant transgenic woody plant.

8. The use of the Tamarix hispida ThCOL gene of claim 7, wherein said woody plant is a poplar or a birch.