CN110951635A

CN110951635A - Method for regulating saccharomyces cerevisiae cell membrane phospholipid to resist salt stress

Info

Publication number: CN110951635A
Application number: CN201911302597.4A
Authority: CN
Inventors: 刘立明; 殷楠楠; 陈修来; 刘佳; 罗秋玲
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2019-12-17
Filing date: 2019-12-17
Publication date: 2020-04-03

Abstract

The invention discloses a method for regulating saccharomyces cerevisiae cell membrane phospholipid to resist salt stress, and belongs to the technical field of bioengineering. Through modular assembly of CDS1 and CHO1, a salt-tolerant engineering strain is constructed, so that the salt stress resistance of the yeast strain is increased. Results show that compared with an original strain, the biomass of the modular assembled strain is improved by 14.2%, the survival rate is increased by 39.2%, the half-inhibitory concentration is improved by 17.82%, and the integrity of cell membranes is improved by 51.34% in the modular assembled CDS1 and CHO1 genes of saccharomyces cerevisiae under the condition of salt stress.

Description

Method for regulating saccharomyces cerevisiae cell membrane phospholipid to resist salt stress

Technical Field

The invention relates to a method for regulating saccharomyces cerevisiae cell membrane phospholipid to resist salt stress, and belongs to the technical field of bioengineering.

Background

Microorganisms are susceptible to various environmental disturbances during fermentation and growth, including both exogenous and endogenous environments. Microbial cell factories provide an economical and environmentally friendly way to produce high-value chemicals, including biofuels, bulk chemicals, and renewable raw material pharmaceuticals. The efficiency of microbial cell factories depends on their productivity, growth state and stress resistance. The establishment of a cell factory, saccharomyces cerevisiae, as an industrial model strain, has made it widely used for the production of alcohol, organic acids, proteins, etc. However, adverse environmental factors often make it difficult for saccharomyces cerevisiae to maintain high-strength fermentative production.

In order to increase the tolerance of industrial microorganisms to environmental stresses, a series of coping strategies have been developed, including adaptive evolution, mutation breeding, transporter engineering, and the like. Although these tolerance strategies can improve the environmental tolerance of microorganisms, they all take a lot of time to implement, whereas the membrane engineering strategies only require simple molecular biological manipulations to improve the tolerance of microorganisms. In addition, these tolerance strategies can only be engineered for a particular stress, whereas membrane engineering can be effective against multiple stresses.

At present, the methods for increasing the tolerance of industrial strains by using a membrane engineering strategy are mainly divided into three methods: modifying cell membrane components, modifying cell membrane functions, and modifying cell membrane morphology. For example, tolerance to organic solvents is improved in yarrowia lipolytica by altering expression of the sterol pathway enzymes ERG3, ERG4, ERG6, ERG 12; the transcription factor CgRDS2 in Torulopsis glabrata resists salt stress environment by improving the integrity of cell membranes; the tolerance of hydrophobic compounds is improved in E.coli by extending the surface area of the cell membrane by over-expression of the membrane-associated protein. However, these methods, although improving the tolerance of microorganisms, still have a low strain tolerance compared to conventional strain engineering methods. In addition, these studies are only modifications to membrane components, and do not take into account membrane function, morphological changes, etc., which may also be critical to their tolerance. At present, no method for improving microbial tolerance by combining metabolic engineering and membrane engineering strategies and comprehensively considering factors such as membrane components, membrane functions, membrane morphology and the like exists.

Disclosure of Invention

The technical problem is as follows: the invention effectively solves the problem of low salt stress resistance of the saccharomyces cerevisiae, improves the viability of the saccharomyces cerevisiae strain under the condition of salt stress, and provides a potential strategy for improving the performance of producing a large amount of chemicals by saccharomyces cerevisiae fermentation.

The technical scheme is as follows: in order to solve the above problems, the present invention provides a method for modulating salt stress resistance of Saccharomyces cerevisiae by modulating expression of genes CDS1 and CHO1 encoding phospholipid pathway enzymes.

In one embodiment of the invention, the method enhances salt stress resistance of saccharomyces cerevisiae by modularly assembling CDS1 and CHO1 genes; the modular assembly is as follows: plasmids co-expressing the CDS1 gene and the CHO1 gene were transferred into Saccharomyces cerevisiae to obtain strains co-expressing the CDS1 and CHO1 genes.

In one embodiment of the invention, the CDS1 gene is expressed using the weak promoter ADH1 and the CHO1 gene is expressed using the strong promoter TEF 1.

In one embodiment of the invention, the nucleotide sequence of the CDS1 gene is shown as the nucleotide sequence of gene ID:852317 at NCBI.

In one embodiment of the present invention, the nucleotide sequence of the CHO1 gene is shown as the nucleotide sequence of gene ID:856748 at NCBI.

In one embodiment of the invention, the Saccharomyces cerevisiae is Saccharomyces cerevisiae BY4741 (see https:// www.yeastgenome.org/strain/S000203456). The genotype is MATa his3 delta 1leu2 delta 0met15 delta 0ura3 delta 0.

In one embodiment of the invention, the plasmid co-expressing the CDS1 gene and CHO1 gene is PY17- (ADH1) -CDS1- (TEF1) -CHO 1.

The invention also provides a method for changing the integrity of the cell membrane of the saccharomyces cerevisiae, which changes the distribution of the phospholipid component of the cell membrane after the CDS1 and CHO1 genes are assembled in a modularized way; the modular assembly is as follows: plasmids co-expressing CDS1 gene and CHO1 gene were transferred into Saccharomyces cerevisiae to obtain strains co-expressing CDS1 and CHO1 gene, and the distribution of cell membrane phospholipid components was changed.

The invention also claims the application of the method in the industrial production of bulk chemicals.

In one embodiment of the invention, the commodity chemical includes, but is not limited to, organic acids, amino acids, or sugars.

Has the advantages that: according to the invention, the salt stress tolerance of the saccharomyces cerevisiae is enhanced by modularly assembling genes CDS1 and CHO1 of phospholipid pathway enzymes, so that the pressure resistance of the strain in the industrial fermentation process is enhanced, and the yield of fermentation products is increased. The result shows that after CDS1 and CHO1 are co-expressed, compared with the original strain, the biomass of the modular assembly strain is improved by 14.2 percent, the survival rate is increased by 39.2 percent, the half-inhibitory concentration is improved by 17.82 percent, and the integrity of cell membranes is improved by 51.34 percent under the condition of salt stress.

Drawings

FIG. 1: construction of modular assembly strains: a is screening of promoters with different strengths; b is a modular assembly CDS1 and CHO1 gene.

FIG. 2: plate growth experiments under normal conditions and 1.2M NaCl conditions were performed for each strain.

FIG. 3: growth curves of strain Y03 under normal conditions and 1.2M NaCl conditions; a: growth curve of strain Y03 under normal conditions; b: growth curve of strain Y03 under 1.2M NaCl.

FIG. 4: the survival rate of the strain Y03 under 0M, 0.4M, 0.8M and 1.2M NaCl.

FIG. 5: IC of strain Y03 under different NaCl concentrations₅₀The measurement of (1).

FIG. 6: the cell membrane integrity of strain Y03 was determined under normal conditions and 1.2M NaCl, with live cells on the left and dead cells on the right.

FIG. 7: pY15 plasmid map.

FIG. 8: PY17- (ADH1) -CDS1- (TEF1) -CHO1 plasmid map.

Detailed Description

Example 1: construction of modularly assembled strains

Metabonomics data analysis is carried out on a salt-tolerant strain, and a phospholipid metabolic pathway is found to be a key pathway influencing the salt stress tolerance of the strain. Using the salt tolerant strain as a template, the transcript levels of 13 genes related to phospholipid metabolic pathways were analyzed, and the expression levels of 7 genes CDS1(NCBI gene ID:852317), CHO1(NCBI gene ID:856748), PIS1(NCBI gene ID:856229), PSD1(NCBI gene ID:855552), PSD2(NCBI gene ID:853080), CHO2(NCBI gene ID:853061) and OPI3(NCBI gene ID:853536) were found to be significantly increased under the conditions of 0M NaCl and 1.2M NaCl. The 7 genes are respectively overexpressed, and the overexpression of CDS1 and CHO1 is screened by a flat clock, so that the strain tolerance is obviously improved, and CDS1 and CHO1 are selected as key genes for researching salt stress tolerance.

A wild saccharomyces cerevisiae genome is taken as a template, and P1/P2, P3/P4, P5/P6, P7/P8 and P9/P10 are respectively taken as primers (the sequences are shown in Table 1), so that different promoters CHO1 (the nucleotide sequence is shown in SEQ ID NO. 1), TEF2 (the nucleotide sequence is shown in SEQ ID NO. 2), TEF1 (the nucleotide sequence is shown in SEQ ID NO. 3), GPD (the nucleotide sequence is shown in SEQ ID NO. 4) and ADH1 (the nucleotide sequence is shown in SEQ ID NO. 5) are respectively amplified. Different promoters are respectively homologously recombined onto a PY17 plasmid, and are respectively introduced into a starting strain Saccharomyces cerevisiae BY4741 BY a chemical transformation method, and positive transformants are screened BY utilizing a leucine marker gene. EGFP (NCBI gene ID:20473140) reporter gene was linked to promoters, which were divided into three levels according to gene expression intensity: TEF1 promoter was high, GPD promoter was medium, ADH1 promoter was low (FIG. 1A).

And modularly assembling the phospholipid pathway enzyme CDS1 and CHO1 genes (shown in figure 1B) by using promoters with different strengths to obtain the strain Y01-Y09 to be tested.

Taking strain Y03 as an example, the method for modularly assembling phospholipid pathway enzyme CDS1 and CHO1 genes comprises the following steps: on the basis of a commercial plasmid PY15 (a plasmid map is shown in figure 7), a TEF1 promoter is replaced by an ADH1 promoter by utilizing a method of enzyme digestion and homologous recombination, the ADH1 promoter is positioned at the upstream of a CYC1 terminator, and a TEF1 promoter is added at the downstream of a CYC1 terminator by utilizing a method of enzyme digestion and homologous recombination; connecting a CDS1 gene to the downstream of a promoter ADH1 by utilizing a method of enzyme digestion and homologous recombination, and expressing a CDS1 gene by using a weak promoter ADH 1; by utilizing a method of enzyme digestion and homologous recombination, a CHO1 gene is connected to the downstream of a promoter TEF1, a strong promoter TEF1 is used for expressing the CHO1 gene to obtain a recombinant plasmid PY17- (ADH1) -CDS1- (TEF1) -CHO1 (the plasmid map is shown in figure 8), then the recombinant plasmid is transformed into yeast, a positive transformant is screened by utilizing the LEU2 gene on the recombinant plasmid, and finally, the strain Y03 is obtained by extracting and verifying the plasmid.

Other test strains were constructed as described above.

TABLE 1 primers

Primer name	Sequence (5 '-3')
		P1	CGAGCTCTCAGCAGCATCTGGCT
P2	GCTCTAGATTTTTAATATATAGTTTTATTTTTG
		P3	CGAGCTCGGGCGCCATAACCAAGG
P4	GCTCTAGAGTTTAGTTAATTATAGTTCG
		P5	CGAGCTCATAGCTTCAAAATGTTTCTACTCC
P6	GCTCTAGAAAACTTAGATTAGATTGCTATGCTT
		P7	CGAGCTCGTTTATCATTATCAATACTCGCCAT
P8	GCTCTAGATCCGTCGAAACTAAGTTCTGGT
		P9	CGAGCTCGGGTGTACAATATGGACTTC
P10	GCTCTAGATGTATATGAGATAGTTGATTGT

Example 2: determination of growth Performance of Each Strain

(1) Plate growth experiment: inoculating a single colony of a strain to be detected into 25mL YNB (0.67% Yeast Nitrogen Base without Amino Acids, 2% Glucose) liquid culture medium for overnight activation, inoculating the strain into the YNB culture medium for culture to logarithmic phase, treating the strain with 1.2M NaCl for 4h, measuring the thallus concentration and adjusting the suspension to OD₆₀₀With this concentration as the initial concentration, 5 times of 10-fold gradient dilution was performed, and 4. mu.L of each of the bacterial solutions was inoculated in the corresponding solid YNB medium in this order, cultured at 30 ℃ for 2 to 3 days, and the growth of the cells was observed and photographed (FIG. 2).

Under normal conditions, modular assembly of CDS1 and CHO1 did not affect the growth of the strain; modular assembly of CDS1 and CHO1 enhanced the growth of the strain at a concentration of 1.2M NaCl. The phospholipid pathway enzyme genes CDS1 and CHO1 were shown to be able to modulate the cell's tolerance to salt environments.

(2) Growth curve measurement: inoculating a single colony of a strain to be detected in 25mL YNB (0.67% Yeast Nitrogen Base without Amino Acids, 2% Glucose) liquid culture medium for overnight activation, respectively transferring the single colony into a normal YNB liquid culture medium and a YNB liquid culture medium containing 1.2M NaCl, and controlling initial OD₆₀₀Culturing at 30 deg.C and 200rpm under 0.1 deg.C, sampling every 4 hr to determine OD value, and plottingLong curve (fig. 3).

Under normal conditions, modular assembly of CDS1 and CHO1 did not affect the growth of the strain; OD of strain Y03 after 56h of cultivation in 1.2M NaCl₆₀₀The value was 3.238, which is 14.2% higher than the wild strain.

Example 3: determination of cell viability for Each Strain

Inoculating the strain BY4741 and a single colony of a strain to be detected in YNB liquid medium for overnight culture, transferring into 100mL YNB liquid medium, and controlling initial OD₆₀₀Shaking culture at 30 deg.C and 200rpm for logarithmic phase at 0.1 deg.C, controlling NaCl concentration of culture medium at 0M, 0.4M, 0.8M, 1.2M, culturing at 30 deg.C and 200rpm for 4 hr, centrifuging, collecting thallus, washing thallus with sterile water for 2 times, resuspending and diluting thallus. And (3) coating the same amount of bacterial liquid under different conditions on an YNB plate, culturing at 30 ℃ for 2-4 days, observing the growth state of each strain and counting. Defining the cell survival rate under normal condition as 100%, then under stress condition, the cell survival rate is equal to the number of colonies on the stress plate/the number of colonies on the normal plate x 100%, and finally drawing a cell survival line graph.

As shown in FIG. 4, the cell viability of the strain Y03 was increased by 39.2% compared to the starting strain (cell viability: 40.3%) under 1.2M NaCl. The above results indicate that the phospholipid pathway enzyme genes CDS1 and CHO1 are favorable for Saccharomyces cerevisiae growth under 1.2M NaCl conditions.

Example 4: determination of the half inhibitory concentration of each Strain

Inoculating the strain BY4741 and a single colony of a strain to be detected in YNB liquid medium for overnight culture, transferring into 100mL YNB liquid medium, and controlling initial OD₆₀₀Shaking culture at 30 deg.C and 200rpm for logarithmic phase at 0.1, adding NaCl of different concentrations to adjust osmotic pressure of culture medium, culturing at 30 deg.C and 200rpm for 4 hr, centrifuging, collecting thallus, washing thallus with sterile water for 2 times, resuspending and diluting thallus. And (3) coating the same amount of bacterial liquid under different conditions on an YNB plate, culturing at 30 ℃ for 2-4 days, observing the growth state of each strain and counting. Drawing a survival rate curve by nonlinear fitting the cell survival rates of the strains to be detected under different NaCl conditions, and defining the half inhibition concentration IC₅₀The NaCl concentration at 50% survival rate.

As shown in FIG. 5, the half inhibitory concentration of strain Y03 was increased by 17.82% as compared with the starting strain (half inhibitory concentration of 1.01M NaCl). The above results indicate that the phospholipid pathway enzyme genes CDS1 and CHO1 are favorable for Saccharomyces cerevisiae growth under salt stress.

Example 5: determination of the integrity of the cell membranes of the respective strains

Inoculating the strain BY4741 and a single colony of a strain to be detected in YNB liquid medium for overnight culture, transferring into 100mL YNB liquid medium, and controlling initial OD₆₀₀Shaking at 200rpm at 0.1 deg.C and 30 deg.C until logarithmic phase, treating for 4 hr under stress-free or 1.2M NaCl stress, centrifuging at 4 deg.C and 6000rpm to collect thallus, and centrifuging the bacterial sludge with PBS (NaCl8.0g/L, KH)₂PO₄0.2g/L，Na₂HPO₄·H₂O2.9 g/L, KCl 0.2g/L) buffer solution, and then the suspension is resuspended and diluted to a proper concentration. Taking 1mL of diluted sample, evenly dividing the sample into two parts, adding 5 mu L of SYTOX into one part, immediately reacting for 10min in a dark place, collecting bacteria, cleaning, and then resuspending cells by using 0.5mL of PBS; the other part was not treated. The fluorescence spectrophotometer was calibrated with PBS buffer and the fluorescence values in unstained and stained cells were subsequently detected at an excitation wavelength of 488nm and an emission wavelength of 512 nm.

As shown in fig. 6, there was no significant difference in cell membrane integrity (viable cell ratio) between the two strains under non-stressed conditions; under the condition of 1.2M NaCl, compared with the original strain (the integrity of the cell membrane is 63.1 percent), the integrity of the cell membrane in the strain Y03 is improved by 51.34 percent. These results indicate that the phospholipid pathway enzyme genes CDS1 and CHO1 contribute to the improvement of cell membrane integrity under salt stress.

Comparative example 1

CDS1 and CHO1 are assembled in a modularized mode, a GPD promoter is used for expressing CDS1, a TEF1 promoter is used for expressing CHO1, and the results of plate dibbling experiments show that the growth capacity of the Y06 strain is similar to that of a wild strain under the condition of 0M NaCl; the growth capacity of this strain was not improved under 1.2M NaCl conditions (FIG. 2).

Comparative example 2

CDS1 and CHO1 are assembled in a modularized mode, a GPD promoter is adopted to express CDS1, a GPD promoter is adopted to express CHO1, and the results of plate dibbling experiments show that the growth capacity of the Y05 strain is similar to that of a wild strain under the condition of 0M NaCl; the growth capacity of this strain was improved but not significantly compared to the wild type strain under 1.2M NaCl conditions (FIG. 2).

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> a method for regulating saccharomyces cerevisiae cell membrane phospholipid to resist salt stress

<160>15

<170>PatentIn version 3.3

<210>1

<211>1000

<212>DNA

<213> Artificial sequence

<400>1

tcagcagcat ctggctgaaa aaaaagcgaa tcatgtagat gatagcaaat tgagtaagag 60

acctatgagc gctcgctcga gaatcgcatt ggagatagaa aaggaaccag atgacatggg 120

cgatggttac actcgttttc acgatgagac ccccgctaaa cctaatttag agtacactca 180

agatatacct gctgtgttca ccgacccaaa tgtaatggaa caatattatt tgacacttga 240

tcagcagcaa aataatcacc aaaatatggc ctggttgact cctccacaac tgccacctca 300

tttagaaaac gtcattttga atagttactc aaacgcgcaa actgataata cgtctggcgc 360

ccttcccatt ccgaaccatg ttatattgaa ccatctggcg acaagcagta ttaagcataa 420

tacattatgt gtcgcatcca ttgttaggta taaacaaaaa tacgtgaccc aaatactgta 480

tacaccattg caatagatat gattatagag cttatagcta catcttttta gataaaagcg 540

aagatgtttc tgcgattttt ccattatagc tctccatgat actaaatatc aaggtctaca 600

tgtaagtatt tgtatatatg ggttggaatg tatatacgta tatacgtacg tacgtacgta 660

tatgcacata attgttacgg gatgtatata taaattagta gcattataga agatatccct 720

aacatcaatc cccactcctt ctcaatgtgt gcagacttct gtgccagaca ctgaatatat 780

atcagtaatt ggtcaaaatc actttgaacg ttcacacggc accctcacgc ctttgagctt 840

tcacatggac ccatctaaag atgaagatcc gtattttata ggaaacatta taaataagga 900

aagagagata cacctatttt tttcattttg tgggtgattg tcatttttag ttgtctattt 960

gattcaatca aaaaacaaaa ataaaactat atattaaaaa 1000

<210>2

<211>504

<212>DNA

<213> Artificial sequence

<400>2

gggcgccata accaaggtat ctatagaccg ccaatcagca aactacctcc raragtacat 60

tcatgttgca cccacacatt tatacaccca gaccgcgaca aattacccat aaggttgttt 120

gtgacggcgt cgtacaagag aacgtgggaa ctttttaggc tcaccaaaaa agaaagaaaa 180

aatacgagtt gctgacagaa gcctcaagaa aaaaaaaatt cttcttcgac tatgctggag 240

gcagagatga tcgagccggt agttaactat atatagctaa attggttcca tcaccttctt 300

ttctggtgtc gctccttcta gtgctatttc tggcttttcc tatttttttt tttccatttt 360

tctttctctc tttctaatat ataaattctc ttgcattttc tatttttctc tctatctatt 420

ctacttgttt attcccttca aggttttttt ttaaggagta cttgttttta gaatatacgg 480

tcaacgaact ataattaact aaac 504

<210>3

<211>401

<212>DNA

<213> Artificial sequence

<400>3

atagcttcaa aatgtttcta ctcctttttt actcttccag attttctcgg actccgcgca 60

tcgccgtacc acttcaaaac acccaagcac agcatactaa atttcccctc tttcttcctc 120

tagggtgtcg ttaattaccc gtactaaagg tttggaaaag aaaaaagaga ccgcctcgtt 180

tctttttctt cgtcgaaaaa ggcaataaaa atttttatca cgtttctttt tcttgaaaat 240

tttttttttg atttttttct ctttcgatga cctcccattg atatttaagt taataaacgg 300

tcttcaattt ctcaagtttc agtttcattt ttcttgttct attacaactt tttttacttc 360

ttgctcatta gaaagaaagc atagcaatct aatctaagtt t 401

<210>4

<211>654

<212>DNA

<213> Artificial sequence

<400>4

gtttatcatt atcaatactc gccatttcaa agaatacgta aataattaat agtagtgatt 60

ttcctaactt tatttagtca aaaaattagc cttttaattc tgctgtaacc cgtacatgcc 120

caaaataggg ggcgggttac acagaatata taacatcgta ggtgtctggg tgaacagttt 180

attcctggca tccactaaat ataatggagc ccgcttttta agctggcatc cagaaaaaaa 240

aagaatccca gcaccaaaat attgttttct tcaccaacca tcagttcata ggtccattct 300

cttagcgcaa ctacagagaa caggggcaca aacaggcaaa aaacgggcac aacctcaatg 360

gagtgatgca acctgcctgg agtaaatgat gacacaaggc aattgaccca cgcatgtatc 420

tatctcattt tcttacacct tctattacct tctgctctct ctgatttgga aaaagctgaa 480

aaaaaaggtt gaaaccagtt ccctgaaatt attcccctac ttgactaata agtatataaa 540

gacggtaggt attgattgta attctgtaaa tctatttctt aaacttctta aattctactt 600

ttatagttag tctttttttt agttttaaaa caccagaact tagtttcgac ggat 654

<210>5

<211>700

<212>DNA

<213> Artificial sequence

<400>5

gggtgtacaa tatggacttc ctcttttctg gcaaccaaac ccatacatcg ggattcctat 60

aataccttcg ttggtctccc taacatgtag gtggcggagg ggagatatac aatagaacag 120

ataccagaca agacataatg ggctaaacaa gactacacca attacactgc ctcattgatg 180

gtggtacata acgaactaat actgtagccc tagacttgat agccatcatc atatcgaagt 240

ttcactaccc tttttccatt tgccatctat tgaagtaata ataggcgcat gcaacttctt 300

ttcttttttt ttcttttctc tctcccccgt tgttgtctca ccatatccgc aatgacaaaa 360

aaatgatgga agacactaaa ggaaaaaatt aacgacaaag acagcaccaa cagatgtcgt 420

tgttccagag ctgatgaggg gtatctcgaa gcacacgaaa ctttttcctt ccttcattca 480

cgcacactac tctctaatga gcaacggtat acggccttcc ttccagttac ttgaatttga 540

aataaaaaaa agtttgctgt cttgctatca agtataaata gacctgcaat tattaatctt 600

ttgtttcctc gtcattgttc tcgttccctt tcttccttgt ttctttttct gcacaatatt 660

tcaagctata ccaagcatac aatcaactat ctcatataca 700

<210>6

<211>23

<212>DNA

<213> Artificial sequence

<400>6

cgagctctca gcagcatctg gct 23

<210>7

<211>33

<212>DNA

<213> Artificial sequence

<400>7

gctctagatt tttaatatat agttttattt ttg 33

<210>8

<211>24

<212>DNA

<213> Artificial sequence

<400>8

cgagctcggg cgccataacc aagg 24

<210>9

<211>28

<212>DNA

<213> Artificial sequence

<400>9

gctctagagt ttagttaatt atagttcg 28

<210>10

<211>31

<212>DNA

<213> Artificial sequence

<400>10

cgagctcata gcttcaaaat gtttctactc c 31

<210>11

<211>33

<212>DNA

<213> Artificial sequence

<400>11

gctctagaaa acttagatta gattgctatg ctt 33

<210>12

<211>32

<212>DNA

<213> Artificial sequence

<400>12

cgagctcgtt tatcattatc aatactcgcc at 32

<210>13

<211>30

<212>DNA

<213> Artificial sequence

<400>13

gctctagatc cgtcgaaact aagttctggt 30

<210>14

<211>27

<212>DNA

<213> Artificial sequence

<400>14

cgagctcggg tgtacaatat ggacttc 27

<210>15

<211>30

<212>DNA

<213> Artificial sequence

<400>15

gctctagatg tatatgagat agttgattgt 30

Claims

1. A method for modulating salt stress resistance of saccharomyces cerevisiae by modulating expression of genes CDS1 and CHO1 encoding phospholipid pathway enzymes.

2. The method of claim 1, wherein the method enhances salt stress resistance of saccharomyces cerevisiae by modular assembly of the CDS1 and CHO1 genes; the modular assembly is as follows: plasmids co-expressing the CDS1 gene and the CHO1 gene were transferred into Saccharomyces cerevisiae to obtain strains co-expressing the CDS1 and CHO1 genes.

3. The method as claimed in claim 2, characterized in that the CDS1 gene is expressed with the weak promoter ADH1 and the CHO1 gene is expressed with the strong promoter TEF 1.

4. The method of claim 2 wherein the nucleotide sequence of the CDS1 gene is as set forth in the nucleotide sequence of gene ID:852317 at NCBI.

5. The method of claim 2, wherein the nucleotide sequence of the CHO1 gene is as shown in the nucleotide sequence of gene ID 856748 at NCBI.

6. The method of claim 2, wherein the plasmid co-expressing the CDS1 gene and the CHO1 gene is PY17- (ADH1) -CDS1- (TEF1) -CHO 1.

7. The method of any one of claims 1 to 6, wherein the Saccharomyces cerevisiae is Saccharomyces cerevisiae BY 4741.

8. A method for changing the integrity of cell membranes of Saccharomyces cerevisiae is characterized in that after CDS1 and CHO1 genes are assembled in a modularized manner, the distribution of phospholipid components of the cell membranes is changed; the modular assembly is as follows: plasmids co-expressing CDS1 gene and CHO1 gene were transferred into Saccharomyces cerevisiae to obtain strains co-expressing CDS1 and CHO1 gene, and the distribution of cell membrane phospholipid components was changed.

9. Use of the method of any one of claims 1 to 8 for the industrial production of bulk chemicals.

10. The method of claim 9, wherein the commodity chemical includes, but is not limited to, organic acids, amino acids, or sugars.