CN110950942A - Gene related to luffa stem growth and application thereof - Google Patents

Abstract

The invention discloses a gene Lac05g019500 related to the luffa stem length, the nucleotide sequence of which is shown in SEQ ID NO.1, and the mutant nucleotide sequence of which shows length polymorphism due to the insertion fragment. The Lac05g019500 gene can be used as a molecular marker of the tendril length character of the towel gourd and can be used for identifying or assisting in identifying the tendril length character of the towel gourd. In addition, the short-vine luffa can be produced by mutating Lac05g019500 gene.

Description

Gene related to luffa stem growth and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a gene related to the growth of luffa tendril and application thereof.

Background

Luffa cylindrica is an important multifunctional vegetable. The towel gourd fruit is rich in vitamins, amino acids, microelements and antioxidant substances, has the effects of clearing away summer heat, stopping bleeding and diminishing inflammation, and is a multifunctional vegetable used as medicine and food. In recent years, with the importance of people on nutrition and health, the sowing area of the towel gourd is increased year by year, and especially for south China, the towel gourd becomes an important daily consumption vegetable in Guangdong, Guangxi, Hainan and Hongkong and Australia areas.

In the loofah planting practice, the short-vine loofah plants are compact in shape, ventilated and transparent, pruning is not needed, meanwhile, the short-vine plants are strong in lodging resistance, cultivation density can be improved, manpower and material resources are saved, and cultivation is simplified, so that the short-vine characters are often used as ideal plant types in breeding, and become important targets for breeding of various excellent varieties of crops. However, the molecular biology research on the short-vine luffa is very few, and no relevant research is published at present. Therefore, deep excavation and utilization of the genes and molecular markers related to the short tendrils of the towel gourd have important significance for the development of the towel gourd industry.

Disclosure of Invention

In view of the defects in the prior art, the present invention aims to provide a gene related to the tendentious shape of luffa tendrils.

The invention also aims to provide application of the gene in identification or auxiliary identification of the tendril-like shape of the towel gourd.

The invention also aims to provide application of the gene in producing short-vine luffa.

The technical scheme adopted by the invention is as follows:

the amino acid sequence of the protein related to the luffa tendril is shown in SEQ ID NO. 2.

The gene related to the luffa tendril (named Lac05g019500) has a nucleotide sequence shown in SEQ ID NO.1, and a mutant nucleotide sequence shows length polymorphism due to the fact that an insertion fragment exists, and a coding sequence is changed.

Furthermore, the mutant form of the gene has an insert at the 488bp position of SEQ ID NO. 1.

The primer pair for amplifying the genes is characterized in that an upstream primer is designed at the position of 1 bp-488 bp of SEQ ID NO.1, and a downstream primer is designed at the position of 489 bp-1219 bp.

As one preferred embodiment, the sequences of the primer pairs are shown as follows:

SV-F:GCCTTCCACATAGACTCTTCAT(SEQ ID NO.3)；

SV-R:CCTCCTTCTTCCCTAAACACAT(SEQ ID NO.4)。

a kit for identifying or assisting in identifying the tendril growth trait of towel gourds comprises a primer pair of an amplification gene Lac05g 019500.

The molecular marker, the primer pair and the kit are applied to identification or auxiliary identification of the growth state of the luffa tendril.

A method for identifying the growth character of luffa tendril comprises the following steps:

(1) detecting a gene Lac05g019500 in a towel gourd sample;

(2) judging the tendril growth property of the sample according to the detection result: if the sample has the sequence shown in SEQ ID NO.1 and is homozygous at the gene locus, the sample shows normal tendril; if the sample has a mutant of the sequence shown in SEQ ID NO.1 and is homozygous at the locus, the sample appears to be short tendrils; if the sample has the sequence shown in SEQ ID NO.1 and is heterozygous at the gene locus, the sample appears to be normal vine.

A method for identifying the growth character of luffa tendril comprises the following steps:

(1) carrying out PCR amplification on the towel gourd sample genome by using SV primer pairs;

(2) judging the tendril growth property of the sample according to the amplification result: if the amplification result only has a 4.2kb fragment, the sample is a short vine, and if the amplification result only has a 245bp fragment, the sample is a normal vine; if the amplified result has fragments of 4.2kb and 245bp, the sample is a normal vine.

A production method of short-vine towel gourd comprises mutating Lac05g019500 gene of towel gourd to construct a short-vine towel gourd variety, wherein the Lac05g019500 gene is shown in SEQ ID NO. 1. The mutation refers to a mutation which can cause the change of the coding sequence of the Lac05g019500 gene.

The invention has the beneficial effects that:

the invention determines that the gene related to the tendril growth of the towel gourd is Lac05g019500 gene through experiments. The SV marker is used for detecting the F2 population, and the amplified bands of all the short-vine lines are found to be 4.2 kb; the amplified band from normal vine material is 245bp, or 245bp and 4.2 kb. Therefore, the Lac05g019500 gene can be used as a molecular marker of the tendril length trait of the towel gourd and can be used for identifying or assisting in identifying the tendril length trait of the towel gourd. In addition, the short-vine luffa can be produced by mutating Lac05g019500 gene.

Drawings

Fig. 1 is an appearance picture of normal vine WT and short vine DM.

Figure 2 shows WT and DM propagation data.

FIG. 3 shows the mapping of genes of Brachymenium longituba: the upper half part is a BSA-Seq positioning result, and the lower half part is a molecular marker fine positioning result.

FIG. 4 shows the sequencing data analysis of Lac05g 019500.

FIG. 5 shows the amplification of WT, DM and fraction F2 by the molecular marker SV. Marker in lane 1, WT and DM in lanes 2 and 3, respectively, and F in lanes 4-23₂Wherein 5 th, 8 th, 12 th, 14 th, 18 th and 22 th tendrils are short tendrils, and 4 th, 6 th, 7 th, 9 th, 10 th, 11 th, 15 th, 16 th, 17 th, 19 th, 20 th, 21 th and 23 th tendrils are normal tendrils.

Detailed Description

In order to clearly understand the technical contents of the present invention, the following embodiments are described in detail with reference to the accompanying drawings. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

Positioning of genes related to tendril growth of towel gourd

1 materials of the experiment

Normal luffa WT originates from: a luffa inbred line bred by vegetable research institute of agricultural academy of Guangdong province.

The short-vine towel gourd DM is derived from: the natural mutant variety bred in the production practice of vegetable research of Guangdong province academy of agricultural sciences.

The tendril shapes of the normal-vine luffa WT and the short-vine luffa DM are shown in fig. 1 and 2.

2 Experimental procedures

2.1 crossing normal vine WT and short-vine towel gourd DM, crossing to obtain F1, selfing to obtain F2, planting 323 plants F2 in field, observing and counting vine length after 15d, finding 235 plants as normal vine and 88 plants as short vine, finding that the separation ratio is in accordance with 3:1 (chi 2 is 0.87, P is 0.352) by chi square test, and explaining the short vine of towel gourd as single-gene recessive inheritance according to Mendel's genetic law.

2.2 respectively and randomly selecting 50 strains of normal vines and short vines by using an F2 population, extracting DNA by using a CTAB method, mixing the DNA into a normal vine pool and a short vine pool in an equimolar amount, performing DNA library construction on the normal vines and the short vine pool by using TruSeq DNA LT Sample Prep Kit (Illumina), and sequencing by using Illumina HiSeq 2000. The raw data obtained extracted polymorphic SNPs using an autonomously developed Perl script and the SNP index (SNP-index) was calculated. The difference between the two pool SNP-indices (i.e., deltaSNP-index) was further calculated and plotted (FIG. 3). Finally, the target gene is positioned in the 49.72-55.35Mb interval of chromosome 5. DNA sequence variation of the two material genomes was analyzed to develop InDel markers, and the recombinant individuals in the target segment were analyzed to finally locate the target gene between M5315 and M5330 (FIG. 3).

2.3 based on the reference genome, 16 coding genes were found (Table 1), of which Lac05g019500 was the key enzyme GA3ox1 in the GA synthesis pathway, and in combination with the above results, Lac05g019500 was identified as a candidate gene, the nucleotide sequence of which is shown in SEQ ID NO.1 and the amino acid sequence of which is shown in SEQ ID NO. 2.

Table 1: genes encoded within the localization segment

2.4 analysis of sequencing data from the short and normal vine pools revealed an insertion in the first exon of Lac05g019500 (FIG. 4).

Primers were designed near the insert:

SV-F:GCCTTCCACATAGACTCTTCAT(SEQ ID NO.3)；

SV-R:CCTCCTTCTTCCCTAAACACAT(SEQ ID NO.4)。

the SV primer pair can amplify a 245bp band in normal vine material WT, and amplify a 4.2Kb band in short vine material DM (figure 5), the F2 population is detected by the SV marker, all the short vine lines are detected to amplify a 4.2Kb band, the normal vine material amplifies a 245bp band or 245bp and 4.2Kb bands (figure 5), and the target gene is determined to be Lac05g 019500. Comprehensive analysis shows that, in the short vine material, the gene Lac05g019500 of the key enzyme GA3ox1 of the GA synthesis pathway is inserted, which indicates that the variation of Lac05g019500 influences the GA synthesis and hinders the development of cells, thereby forming the short vine.

Second, application of Lac05g019500 gene as molecular marker of luffa tendril growth character

The Lac05g019500 gene can be used as a template, and a detection primer is designed for identifying or assisting in identifying the tendril growth character of the towel gourd.

The upstream primer is designed at the upstream of the first exon of the Lac05g019500 gene, namely the 1 bp-488 bp position of SEQ ID NO.1, and the downstream primer is designed at the downstream of the first exon of the Lac05g019500 gene, namely the 489 bp-1219 bp position of SEQ ID NO. 1.

Judging the tendril growth property of the sample according to the PCR amplification result: if the sequence obtained by sample amplification is a fragment of the Lac05g019500 gene (SEQ ID NO.1), marked as an A sequence and homozygous at the molecular marker locus, the sample shows a normal vine; if the sequence obtained by sample amplification is about 4kb longer than the sequence A, marked as a sequence B and homozygous at the molecular marker site, the sample is represented as a short tendril; if the sample has two amplified sequences, one is A sequence and the other is B sequence, the sample is heterozygous at the molecular marker locus and shows normal tendrils.

The experimental results show that the Lac05g019500 gene can be used as a molecular marker of the tendril growth character of the towel gourd and can be used for identifying or assisting in identifying the tendril growth character of the towel gourd. In addition, the technical personnel in the field can also produce the short-vine luffa by mutating Lac05g019500 gene.

Those skilled in the art will understand that: equivalent modifications and substitutions to those embodiments can be made without departing from the spirit and scope of the invention as defined by the appended claims.

SEQUENCE LISTING

<110> vegetable research institute of academy of agricultural sciences of Guangdong province

<120> gene related to luffa stem growth and application thereof

<130>

<160>4

<170>PatentIn version 3.5

<210>1

<211>1219

<212>DNA

<213>Lac05g019500

<400>1

atggcctcca aattagtcga ggctttcaaa tcccacccgc ttcacctccc catccccgcc 60

aaagacctcg acttcgactc cctcaaagaa ctccccgatt cctatgcttg gattcaaccc 120

gactccttcc cctcccccaa cgattccatt tccctctccg agtccatccc cttgatcgac 180

ctttccctcc ccaacgcccc ccacctcatc gccaacgccc tacgaacctg gggcgcattc 240

cagctcatca accatgccct ccccatctcc ctccttcact cccttgagtc ctgcgccgat 300

accctcttct ccctcccccc tcctcacaag ctcaaggtcg ctcgctcccc cgacggcatc 360

tccggctacg gcatcgttcg tatctcctcc ttcttcccta aacacatgtg gtccgaaggt 420

ttcaccatcg tcggctcccc tcgagaccat ttccgccaac tttggcctca cgactacgcc 480

aaatactggt acttaccacc atattaattt aattatacta ttgcattcaa atattcaaat 540

attcaaatat tcaaatattc aaatattcaa atgtttttgt agtgatataa tggaggaata 600

tgaccgagag atgaagagtc tatgtggaag gctgatctgg atggcgttgg gtgaattggg 660

cataacccga gaagacgtca aatgggcggg tccgaatggg gatttcaaga ccagtcatgc 720

agccacccag ttgaactcct acccgatttg tccggatccg gatcgggcca tggggctcgg 780

gccccacacc gacaccagcc tcttgaccat cgtctaccag aacaacacca gaggcttaca 840

ggttttgcga gagggaaaca agtgggtcac ggtggagccg gtagccggtg gactggtggt 900

ccaggtcgga gacctgctcc acattatgac caacgggttg ttcaagcctt cgcttcatca 960

agcggtggtg aaccggaccc gacaacgcat ctcggtggct taccttttcg ggccacctga 1020

caacgtggaa atttcaccgg ttaagaaact tttgagccca actcagccgc cgatttaccg 1080

tccggtaact tggacggagt acctcggtaa aaaagccgag catttcaaca acgcattgtc 1140

gtctgttcgt ctttgtgctc ctctcactgg aggactcttg gaagtcaacg atcacaataa 1200

tcaagtcaaa gtaggctaa 1219

<210>2

<211>374

<212>PRT

<213>Lac05g019500

<400>2

Met Ala Ser Lys Leu Val Glu Ala Phe Lys Ser His Pro Leu His Leu

1 5 10 15

Pro Ile Pro Ala Lys Asp Leu Asp Phe Asp Ser Leu Lys Glu Leu Pro

20 25 30

Asp Ser Tyr Ala Trp Ile Gln Pro Asp Ser Phe Pro Ser Pro Asn Asp

35 40 45

Ser Ile Ser Leu Ser Glu Ser Ile Pro Leu Ile Asp Leu Ser Leu Pro

50 55 60

Asn Ala Pro His Leu Ile Ala Asn Ala Leu Arg Thr Trp Gly Ala Phe

65 70 75 80

Gln Leu Ile Asn His Ala Leu Pro Ile Ser Leu Leu His Ser Leu Glu

85 90 95

Ser Cys Ala Asp Thr Leu Phe Ser Leu Pro Pro Pro His Lys Leu Lys

100 105 110

Val Ala Arg Ser Pro Asp Gly Ile Ser Gly Tyr Gly Ile Val Arg Ile

115 120 125

Ser Ser Phe Phe Pro Lys His Met Trp Ser Glu Gly Phe Thr Ile Val

130 135 140

Gly Ser Pro Arg Asp His Phe Arg Gln Leu Trp Pro His Asp Tyr Ala

145 150 155 160

Lys Tyr Cys Asp Ile Met Glu Glu Tyr Asp Arg Glu Met Lys Ser Leu

165 170 175

Cys Gly Arg Leu Ile Trp Met Ala Leu Gly Glu Leu Gly Ile Thr Arg

180 185 190

Glu Asp Val Lys Trp Ala Gly Pro Asn Gly Asp Phe Lys Thr Ser His

195 200 205

Ala Ala Thr Gln Leu Asn Ser Tyr Pro Ile Cys Pro Asp Pro Asp Arg

210 215 220

Ala Met Gly Leu Gly Pro His Thr Asp Thr Ser Leu Leu Thr Ile Val

225 230 235 240

Tyr Gln Asn Asn Thr Arg Gly Leu Gln Val Leu Arg Glu Gly Asn Lys

245 250 255

Trp Val Thr Val Glu Pro Val Ala Gly Gly Leu Val Val Gln Val Gly

260 265 270

Asp Leu Leu His Ile Met Thr Asn Gly Leu Phe Lys Pro Ser Leu His

275 280 285

Gln Ala Val Val Asn Arg Thr Arg Gln Arg Ile Ser Val Ala Tyr Leu

290 295 300

Phe Gly Pro Pro Asp Asn Val Glu Ile Ser Pro Val Lys Lys Leu Leu

305 310 315 320

Ser Pro Thr Gln Pro Pro Ile Tyr Arg Pro Val Thr Trp Thr Glu Tyr

325 330 335

Leu Gly Lys Lys Ala Glu His Phe Asn Asn Ala Leu Ser Ser Val Arg

340 345 350

Leu Cys Ala Pro Leu Thr Gly Gly Leu Leu Glu Val Asn Asp His Asn

355 360 365

Asn Gln Val Lys Val Gly

370

<210>3

<211>22

<212>DNA

<213> Artificial sequence

<400>3

gccttccaca tagactcttc at 22

<210>4

<211>22

<212>DNA

<213> Artificial sequence

<400>4

cctccttctt ccctaaacac at 22

Claims (10)

1. The amino acid sequence of the protein related to the luffa tendril is shown in SEQ ID NO. 2.

2. The nucleotide sequence of the gene related to the luffa tendril is shown in SEQ ID NO.1, and the mutant nucleotide sequence shows length polymorphism due to the change of the coding sequence caused by the insertion fragment.

3. The gene of claim 2 wherein the mutant form of the gene has an insert at the 488bp position of SEQ ID No. 1.

4. The primer pair for amplifying the gene of claim 2 or 3, wherein the upstream primer is designed at the position of 1bp to 488bp of SEQ ID NO.1, and the downstream primer is designed at the position of 489bp to 1219 bp.

5. The primer pair according to claim 4, wherein the sequence of the primer pair is as follows:

SV-F:GCCTTCCACATAGACTCTTCAT；

SV-R:CCTCCTTCTTCCCTAAACACAT。

6. a kit for identifying or assisting in identifying a luffa tendril length trait, comprising the primer pair of claim 4 or 5.

7. Use of the protein of claim 1, the gene of claim 2 or 3, the primer pair of claim 4 or 5, or the kit of claim 6 for identifying or assisting in identifying the tendril-like shape of luffa.

8. A method for identifying the growth character of luffa tendril comprises the following steps:

(1) detecting a gene Lac05g019500 in a towel gourd sample, wherein the nucleotide sequence of the gene is shown in SEQ ID NO. 1;

(2) judging the tendril growth property of the sample according to the detection result: if the sample has the sequence shown in SEQ ID NO.1 and is homozygous at the gene locus, the sample shows normal tendril; if the sample has a mutant of the sequence shown in SEQ ID NO.1 and is homozygous at the locus, the sample appears to be short tendrils; if the sample has the sequence shown in SEQ ID NO.1 and is heterozygous at the gene locus, the sample appears to be normal vine.

9. A method for identifying the growth character of luffa tendril comprises the following steps:

(1) performing PCR amplification on the genome of the towel gourd sample by using the primer pair of claim 5;

(2) judging the tendril growth property of the sample according to the amplification result: if the amplification result only has a 4.2kb fragment, the sample is a short vine, and if the amplification result only has a 245bp fragment, the sample is a normal vine; if the amplified result has fragments of 4.2kb and 245bp, the sample is a normal vine.

10. A production method of short-vine towel gourd comprises mutating Lac05g019500 gene of towel gourd to construct short-vine towel gourd variety, wherein Lac05g019500 gene is shown in SEQ ID NO. 1; the mutation refers to a mutation which can cause the change of the coding sequence of the Lac05g019500 gene.

Images