CN110938611B

CN110938611B - DNA polymerase and preparation method and application thereof

Info

Publication number: CN110938611B
Application number: CN201911416152.9A
Authority: CN
Inventors: 张坤晓; 程槐旭; 胡梦竹; 燕东平; 聂尚海
Original assignee: Mona Wuhan Biotechnology Co ltd
Current assignee: Mona Wuhan Biotechnology Co ltd
Priority date: 2019-12-31
Filing date: 2019-12-31
Publication date: 2021-05-04
Anticipated expiration: 2039-12-31
Also published as: CN110938611A

Abstract

The invention provides a DNA polymerase and a preparation method and application thereof, wherein the DNA polymerase has any one of amino acid sequences shown in (I), (II) or (III): (I) 1, SEQ ID NO; (II) a polypeptide having homology of 98% or more with the amino acid sequence shown in SEQ ID NO: 1; (III) the amino acid sequence shown in SEQ ID NO. 1 is obtained by substituting, deleting or adding 1-20 amino acid residues, and the obtained amino acid sequence has the activity of DNA polymerase. The Deep Sea DNA polymerase removes part of 3'→ 5' exonuclease proofreading activity of wild type DNA polymerase, has 5 times higher fidelity than Taq enzyme, has good stability and high activity, is suitable for amplification of a difficult template containing a high GC sequence and a circulating sequence, and can be used as a tool enzyme for third-generation sequencing and library building.

Description

DNA polymerase and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a DNA polymerase, and a preparation method and application thereof.

Background

DNA polymerases, a class of DNA-dependent enzymes that catalyze the polymerization of substrate dNTP molecules to form progeny DNA using parental DNA as a template, were first discovered in escherichia coli by the american scientist Arthur Komberg in 1957, after which a number of DNA polymerases were subsequently discovered in other prokaryotes and eukaryotes. Since DNA polymerases have a variety of types and functions, researchers usually need to select the type of DNA polymerase appropriately according to practical applications, and with the development of genomics, thermostable DNA polymerases having 5'→ 3' amplification activity are widely used in the molecular field.

In 1992, a Thermococcus GB-D strain capable of growing in 104 ℃ environment was found in 2010 m in Deep-Sea volcanic entrance of gulf of California, and high-fidelity heat-resistant wild-type Deep Sea DNA polymerase was isolated and purified from the product of the strain. The wild type Deep Sea DNA polymerase gene has total length of about 2295 basic groups, 765 amino acids are coded, the molecular weight is about 89kDa, the wild type Deep Sea DNA polymerase gene has 3'→ 5' exonuclease proofreading activity, the thermostability is strong, the half-life period at 100 ℃ is 8 hours, and the half-life period at 95 ℃ is 23 hours.

The common DNA polymerase in the market at present generally has the problems of poor thermal stability, low fidelity and low purity, has poor amplification effect on difficult templates and cannot meet the requirements of third-generation sequencing.

CN 101255435A discloses the application of heat-resistant DNA polymerase (Bcady-pol) gene and its coded protein, and adopts Ni ion column to make purification, and the purity of obtained protein still can not meet the requirements of third-generation sequencing.

CN 104560908A discloses a purification method of recombinant Escherichia coli Taq DNA polymerase, which comprises the following steps: (1) breaking the bacteria; (2) heat treatment; (3) salting out; (4) carrying out Ni ion metal chelating affinity chromatography; (5) dialyzing; (6) and (5) subpackaging the preparation. However, the thermal stability of Taq DNA polymerase obtained by the method is poor.

CN 108265039A discloses a mutant Taq DNA polymerase and its purification method, which comprises mutating native Taq DNA polymerase, removing its 5 '-3' exonuclease activity, and introducing mutations of E507R, E742A and A743H (amino acid positions are determined according to wild type Taq DNA polymerase). However, the thermal stability of the Taq DNA polymerase is poor.

Therefore, it is necessary to provide a DNA polymerase with good thermal stability, high purity and good fidelity and an expression purification method thereof, which are applied to the technical field of sequencing.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides the DNA polymerase and the preparation method and the application thereof, and the DNA polymerase has good thermal stability and high purity and can be applied to third-generation sequencing.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a DNA polymerase having any one of the amino acid sequences shown in (I), (II) or (III):

(I) 1, SEQ ID NO;

(II) a polypeptide having homology of 98% or more with the amino acid sequence shown in SEQ ID NO: 1;

(III) the amino acid sequence shown in SEQ ID NO. 1 is obtained by substituting, deleting or adding 1-20 amino acid residues, and the obtained amino acid sequence has the activity of DNA polymerase;

the amino acid sequence of SEQ ID NO. 1 is:

GSSHHHHHHSSGILDTDYITENGKPVIRVFKKENGEFKIEYDRTFEPYFYALLKDDSAIEDVKKVTAKRHGTVVKVKRAEKVQKKFLGRPIEVWKLYFNHPQDVPAIRDRIRAHPAVVDIYEYDIPFAKRYLIDKGLIPMEGDEELTMLAFAIATLYHEGEEFGTGPILMISYADGSEARVITWKKIDLPYVDVVSTEKEMIKRFLRVVREKDPDVLITYNGDNFDFAYLKKRCEELGIKFTLGRDGSEPKIQRMGDRFAVEVKGRIHFDLYPVIRRTINLPTYTLEAVYEAVFGKPKEKVYAEEIAQAWESGEGLERVARYSMEDAKVTYELGREFFPMEAQLSRLIGQSLWDVSRSSTGNLVEWFLLRKAYKRNELAPNKPDERELARRRGGYAGGYVKEPERGLWDNIVYLDFRSLYPSIIITHNVSPDTLNREGCKEYDVAPEVGHKFCKDFPGFIPSLLGDLLEERQKIKRKMKATVDPLEKKLLDYRQRAIKILANSFYGYYGYAKARWYCKECAESVTAWGREYIEMVIRELEEKFGFKVLYADTDGLHATIPGADAETVKKKAKEFLKYINPKLPGLLELEYEGFYVRGFFVTKKKYAVIDEEGKITTRGLEIVRRDWSEIAKETQARVLEAILKHGDVEEAVRIVKEVTEKLSKYEVPPEKLVIHEQITRDLRDYKATGPHVAVAKRLAARGVKIRPGTVISYIVLKGSGRIGDRAIPADEFDPTKHRYDAEYYIENQVLPAVERILKAFGYRKEDLRYQKTK.

in the invention, the Deep Sea DNA polymerase obtained by mutating multi-site amino acids of the wild type DNA polymerase removes part of 3'→ 5' exonuclease reading activity of the wild type DNA polymerase, but still has 5 times higher fidelity than Taq enzyme, good stability and high activity, is suitable for amplification of a difficult template containing a high GC sequence and a circulating sequence, and can be used as a tool enzyme for third-generation sequencing and library building.

In a second aspect, the present invention provides a nucleotide sequence encoding the DNA polymerase according to the first aspect, preferably the nucleotide sequence shown as SEQ ID NO. 2;

the nucleotide sequence of SEQ ID NO. 2 is:

ggcagcagccatcatcatcatcatcacagcagcggcattctggataccgattacattaccgaaaacggcaaaccggtgattcgtgtgttcaaaaaagaaaacggcgaattcaaaatcgaatacgatcgtacctttgaaccgtatttttacgcgctgctgaaagatgatagcgcgatcgaagatgtgaaaaaagtgaccgcgaaacgtcatggcaccgtggtgaaagtgaaacgtgcggaaaaagtgcagaaaaaatttctgggccgtccgattgaagtgtggaaactgtatttcaaccatccgcaggatgtgccggcgattcgtgatcgtattcgtgcgcatccggcggtggtggatatttatgaatatgatatcccgttcgcgaaacgttatctgattgataaaggcctgattccgatggaaggcgatgaagaactgaccatgctggcctttgcgattgcgaccctgtatcacgaaggcgaagaatttggcaccggcccgattctgatgattagctatgcggatggcagcgaagcgcgtgtgattacctggaaaaaaatcgatctgccgtatgtggatgtggtgagcaccgaaaaagaaatgatcaaacgctttctgcgtgtggtgcgtgaaaaagatccggatgtgctgattacctataacggcgataactttgatttcgcgtatctgaaaaaacgttgcgaagaactgggcatcaaatttaccctgggccgtgatggtagcgaaccgaaaattcagcgtatgggcgatcgttttgcggtggaagtgaaaggccgtattcattttgatctgtatccggtgattcgccgtaccattaacctgccgacctataccctggaagcggtgtatgaagcggtgtttggcaaaccgaaagaaaaagtgtacgcggaagaaattgcgcaggcgtgggaaagcggcgaaggcctggaacgtgtggcgcgttatagcatggaagatgcgaaagtgacctatgaactgggccgtgaatttttcccgatggaagcgcagctgtctcgtctgattggccagagcctgtgggatgtgagccgtagcagcaccggcaacctggtggaatggtttctgctgcgtaaagcgtataaacgtaacgaactggccccgaacaaaccggatgaacgtgaactggcccgtcgtcgtggcggttatgcgggcggttatgtgaaagaaccggaacgtggcctgtgggataacattgtgtatctggattttcgtagcctgtatccgagcattattatcacccataacgtgagcccggataccctgaaccgtgaaggctgcaaagaatatgatgtggcgccggaagtgggccataaattctgcaaagatttcccgggctttattccgagcctgctgggcgatctgctggaagaacgccagaaaatcaaacgcaaaatgaaagcgaccgttgatccgctggaaaaaaaactgctggattatcgtcagcgcgcgattaaaattctggccaacagcttctatggctattatggttatgcgaaagcgcgttggtattgcaaagaatgcgcggaaagcgtgaccgcgtggggccgtgaatatatcgaaatggtgatccgcgaactggaagaaaaattcggcttcaaagtgctgtatgcggataccgatggcctgcatgcgaccattccgggtgcggatgcggaaaccgtgaaaaaaaaagcgaaagaattcctgaaatacatcaatccgaaactgccgggcctgctggaactggaatatgaaggcttttatgtgcgtggctttttcgtgaccaaaaaaaaatacgcggtgatcgatgaagaaggcaaaattaccacccgtggcctggaaattgtgcgtcgtgattggagcgaaattgcgaaagaaacccaggcgcgtgtgctggaagcgattctgaaacatggcgatgtggaagaagcggtgcgtattgttaaagaagtgaccgaaaaactgagcaaatatgaagttccgccggaaaaactggtgattcatgaacaaattacccgtgatctgcgtgattataaagcgaccggtccgcatgtggcggtggcaaaacgtctggcagcgcgtggcgtgaaaattcgtccgggcaccgtgattagctatattgtgctgaaaggcagcggccgtattggcgatcgtgcgattccggcggatgaatttgatccgaccaaacatcgttatgatgcggaatattatatcgaaaaccaggtgctgccggcggtggaacgtattctgaaagcgtttggctatcgtaaagaagatctgcgctatcagaaaaccaaaca.

in the present invention, the polynucleotide having homology of 98% or more with the nucleotide sequence shown in SEQ ID NO. 2, or the nucleotide sequence obtained by substitution, deletion or addition of 1 to 20 bases to the nucleotide sequence shown in SEQ ID NO. 2, can also encode the DNA polymerase described in the first aspect.

In a third aspect, the present invention provides an expression vector comprising a nucleotide sequence as described in the second aspect.

Preferably, the expression vector carries a histidine tag.

Preferably, the expression vector is pBAD.

In a fourth aspect, the present invention provides a host cell comprising an expression vector according to the third aspect.

In the invention, the expression vector is obtained by inserting the nucleotide sequence shown in SEQ ID NO. 2 into pBAD for recombination.

Preferably, the host cell is a prokaryotic cell, preferably E.coli.

In the present invention, the host cell is preferably Escherichia coli BL21(DE3) pLysS (Shanghai unique organism).

In a fifth aspect, the present invention provides a method for constructing a host cell that secretes DNA polymerase, the method comprising the steps of:

(1) constructing an expression vector according to the third aspect;

(2) transforming the expression vector in the step (1) into a host cell to obtain the host cell secreting the DNA polymerase.

In a sixth aspect, the present invention provides a method for preparing the DNA polymerase according to the first aspect, the method comprising the steps of:

(1') constructing a host cell according to the fourth aspect, and subjecting the host cell to induction culture;

(2') collecting host cells after induction culture, and performing lysis and centrifugation to obtain a supernatant;

(3') purifying the supernatant to obtain the DNA polymerase.

Preferably, the induction culture of step (1') is performed using an inducer.

Preferably, the inducer comprises arabinose.

Preferably, the final concentration of the inducer is between 0.1% and 0.3%, and may be, for example, 0.1%, 0.2% or 0.3%.

Preferably, the temperature for the induction culture in step (1') is 20 to 30 ℃, and may be, for example, 20 ℃, 21 ℃, 22 ℃, 23 ℃, 24 ℃, 25 ℃, 26 ℃, 27 ℃, 28 ℃, 29 ℃ or 30 ℃.

Preferably, the time for the induction culture in step (1') is 12-16 h, for example, 12h, 13h, 14h, 15h or 16 h.

Preferably, the lysis in step (2') comprises resuspending the host cells with a lysis solution, disrupting the resuspended solution with a cell disruptor, and performing water bath at 70-80 ℃ for 10-20 min.

In the invention, the lysis solution contains 10-20 mM Tris, 50-100 mM KCl, 5-15 mM imidazole and 5-15% glycerol at final concentration.

Preferably, the mass ratio of the lysis solution to the host cell is (2-10: 1), and may be, for example, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10: 1.

Preferably, the purification of step (3') comprises any one of or a combination of at least two of Ni affinity chromatography, heparin affinity chromatography or cation exchange chromatography, preferably a combination of Ni affinity chromatography, heparin affinity chromatography and cation exchange chromatography.

Preferably, the Ni affinity chromatography comprises: and adding the mixture of the Ni chromatographic medium and the supernatant into a Ni affinity column, washing by adopting an imidazole solution, and collecting Ni affinity eluent.

Preferably, the imidazole solution has a concentration of 30 to 400mM, and may be, for example, 30mM, 50mM, 100mM, 150mM, 200mM, 250mM, 300mM, 350mM, or 400 mM.

Preferably, the heparin affinity chromatography comprises: and adding the mixed solution of the Ni affinity eluent and the buffer solution into a heparin affinity column, washing by adopting a KCl solution, and collecting the heparin affinity eluent.

Preferably, the volume ratio of the Ni affinity eluent to the buffer is 1 (3-5), and may be, for example, 1:3, 1:4 or 1: 5.

Preferably, the cation exchange chromatography comprises: adding the mixed solution of the heparin affinity eluent and the buffer solution into a cation exchange column, washing by adopting a KCl solution, and collecting the cation exchange eluent.

In the invention, the buffer solution used in the heparin affinity chromatography and the cation exchange chromatography contains 10-20 mM Tris, 0.1-0.2 mM EDTA, 1-2 mM DTT and 5-15% glycerol at the final concentration.

In the invention, the medium of the cation exchange column is Unigel 30 CM.

Preferably, the volume ratio of the heparin affinity eluent to the buffer is 1 (2-5), and may be, for example, 1:2, 1:3, 1:4 or 1: 5.

Preferably, the concentration of the KCl solution is 100 mM-1M, and may be, for example, 100mM, 200mM, 300mM, 400mM, 500mM, 600mM, 700mM, 800mM, 900mM, or 1M.

Preferably, the cation exchange chromatography is followed by a step of subjecting the cation exchange eluate to dialysis.

In the invention, the cation exchange eluent is added into a dialysis buffer solution for dialysis, wherein the dialysis buffer solution contains 10-20 mM Tris, 100-200 mM KCl, 0.1-0.2 mM EDTA, 1-2 mM DTT and 50% glycerol at final concentration.

As a preferred embodiment, the present invention provides a method for preparing a DNA polymerase according to the first aspect, comprising the steps of:

(1') constructing the host cell according to the fourth aspect, and performing induction culture on the host cell for 12-16 h at 20-30 ℃ by using 0.1-0.3% of arabinose;

(2') collecting host cells after induction culture, carrying out heavy suspension by using a lysate, wherein the mass ratio of the lysate to the host cells is (2-10): 1, crushing the heavy suspension by using a cell crusher, carrying out water bath for 10-20 min at 70-80 ℃, centrifuging and collecting a supernatant;

(3') sequentially carrying out Ni affinity chromatography, heparin affinity chromatography and cation exchange chromatography on the supernatant, specifically:

(1') adding a mixture of the Ni chromatography medium and the supernatant into a Ni affinity column, washing by adopting an imidazole solution with a concentration gradient of 30-400 mM, and collecting Ni affinity eluate;

(2') mixing the Ni affinity eluent with a buffer solution according to the volume ratio of 1 (3-5), adding a heparin affinity column, washing by adopting a KCl solution with the concentration gradient of 50 mM-1M, and collecting the heparin affinity eluent;

(3') mixing the heparin affinity eluent with a buffer solution according to the volume ratio of 1 (2-5), adding the mixture into a cation exchange column, washing the cation exchange column by adopting a KCl solution with the concentration gradient of 50 mM-1M, and collecting the cation exchange eluent;

(4') adding the cation exchange eluate to a dialysis buffer solution for dialysis to obtain the purified DNA polymerase.

In a seventh aspect, the invention provides an enzyme preparation comprising a DNA polymerase as described in the first aspect.

Preferably, the enzyme preparation further comprises an enzyme buffer.

In an eighth aspect, the present invention provides a use of a DNA polymerase according to the first aspect, a nucleotide sequence of a DNA polymerase according to the second aspect, an expression vector according to the third aspect, a host cell according to the fourth aspect, or an enzyme preparation according to the seventh aspect, in the preparation of a molecular assay kit.

Compared with the prior art, the invention has the following beneficial effects:

(1) the Deep Sea DNA polymerase obtained by mutating multi-site amino acids of the wild type DNA polymerase has good stability, high activity and high fidelity, and is suitable for amplification of difficult templates containing high GC sequences and the like;

(2) the invention obtains the Deep Sea DNA polymerase with the purity of 95 percent by carrying out induction culture on the recombinant engineering bacteria containing the Deep Sea DNA polymerase nucleic acid sequence, cracking the bacteria to obtain a crude product, and adopting a purification method combining Ni affinity chromatography, heparin affinity chromatography, cation exchange chromatography and dialysis to meet the purity requirement of third-generation sequencing on the DNA polymerase.

Drawings

FIG. 1 is a vector map of pBAD-R.deep Sea;

FIG. 2 is a flow chart of a method for purifying DNA polymerase;

FIG. 3 is a SDS-PAGE comparison of the prepared Deep Sea DNA polymerase with NEB control enzyme (Deep Vent exo-);

FIG. 4(A) is an agarose gel electrophoresis chart for detection of the activity of prepared Deep Sea DNA polymerase, and FIG. 4(B) is an agarose gel electrophoresis chart for detection of the activity of NEB control enzyme (Deep Vent exo-);

FIG. 5 is a photograph showing a comparison of the prepared Deep Sea DNA polymerase and the DNase contamination detection of NEB control enzyme (Deep Vent exo-);

FIG. 6 is a diagram showing PCR amplification of the prepared Deep Sea DNA polymerase on a high GC content template, wherein the primers in lanes 1-2 are Homo-1-A-NKRD9(F1+ R1) -GC-75.2%, and the primers in lanes 3-4 are Homo-86-Q95GK3(F1+ R1) -GC-55.2%.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Example 1 construction of recombinant engineering bacteria

By adopting a genetic engineering technology, the nucleotide sequence shown in SEQ ID NO. 2 is cloned into NcoI and HindIII restriction sites of a pBAD vector with a His label, as shown in figure 1, an expression vector containing a Deep Sea DNA polymerase gene is constructed, after a sequencing result is correct, a recombinant vector is transformed into escherichia coli BL21(DE3) pLysS to obtain recombinant engineering bacteria, and the recombinant engineering bacteria are preserved in 30% glycerol at the temperature of-20 ℃.

Example 2 Induction culture of recombinant engineered bacteria

(1) Carrying out three-zone streaking on the recombinant engineering bacteria constructed in the example 1 on an LB plate of ampicillin sodium and chloramphenicol resistance, and carrying out activation culture at 37 ℃ for 16 h;

(2) selecting 25 single colonies, inoculating the single colonies into 25mL LB liquid culture medium added with corresponding resistance, performing activation culture at 37 ℃ for 4-5 h, and obtaining an activation solution when the bacterial liquid grows to an OD600 value of 0.3-0.6;

(3) adding 10mL of activating solution into 500mL of LB liquid culture medium with corresponding resistance, performing amplification culture at 37 ℃ for 4-5 h, and obtaining an amplification solution when the bacterial liquid grows to an OD600 value of 0.6-0.8;

(4) adding arabinose with the final concentration of 0.2 percent into the amplification solution as an inducer, inducing the expression of Deep Sea DNA polymerase overnight at 25 ℃, and collecting bacterial cells after 16 h;

(5) and centrifuging the bacterial liquid at 7500g and 4 ℃ for 5min, and precipitating to obtain the thallus after expression.

EXAMPLE 3 crude extraction of Deep Sea DNA polymerase

Collecting 1L of thallus, resuspending the thallus with 100mL of lysate in ice bath (10mM Tris, 50mM KCl, 5mM imidazole, 5% glycerol, pH 7.4), crushing the suspension with a cell high pressure crusher at 800bar for 2.5min to obtain lysate, bathing the lysate in water at 75 ℃ for 20min, centrifuging the lysate at 35000g at 4 ℃ for 30min, and collecting the supernatant to obtain a crude product.

Example 4 purification of Deep Sea DNA polymerase

(1) Ni affinity chromatography

Adding a Ni chromatography medium into the crude product, stirring and combining for 2 hours at 4 ℃ to obtain a mixture, and adding the mixture into a chromatography hollow column for solid-liquid separation to obtain a Ni affinity column; pre-washing the Ni affinity column by using 30mM imidazole solution, eluting the Ni affinity column by using 400mM imidazole, collecting eluent in different tubes, and collecting eluent containing Deep Sea DNA polymerase after SDS-PAGE gel electrophoresis analysis to obtain Ni affinity eluent;

(2) heparin affinity chromatography

Dissolving the obtained Ni affinity eluent in a low-salt buffer solution (10mM Tris, 0.1mM EDTA, 1mM DTT, 5% glycerol, pH 7.4) and adding the solution to a heparin affinity column, wherein the volume ratio of the low-salt buffer solution to the Ni affinity eluent is 3: 1; pre-washing the heparin affinity column by using 50mM KCl solution, then performing gradient elution on the heparin affinity column by using 50 mM-1M KCl solution, eluting 5 column volumes, collecting eluent in different tubes, performing SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) analysis, and collecting eluent containing Deep Sea DNA polymerase to obtain heparin affinity eluent;

(3) cation exchange chromatography

Dissolving heparin affinity eluent in the low-salt buffer solution, and adding the solution into a cation exchange column (with a medium of Unigel 80CM), wherein the volume ratio of the low-salt buffer solution to the heparin eluent is 2: 1; pre-washing a cation exchange column by using a 100mM KCl solution, then carrying out gradient elution on the cation exchange column by using a 100 mM-1M KCl solution, eluting for 5 column volumes, collecting eluent in different tubes, and collecting eluent containing Deep Sea DNA polymerase after SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) analysis to obtain cation exchange eluent;

(4) dialysis

And (2) dialyzing the cation exchange eluent in a dialysis buffer (10mM Tris, 100mM KCl, 0.1mM EDTA, 1mM DTT and 50% glycerol), wherein the size of a used dialysis bag is 10kDa, the volume ratio of the cation exchange eluent to the dialysis buffer is 1:100, dialyzing for 16h at 200rpm under the dialysis condition of 4 ℃, supplementing 0.1% TritonX-100 to obtain purified Deep Sea DNA polymerase, and storing at-20 ℃.

According to the scheme of the DNA polymerase purification method shown in FIG. 2, a purified Deep Sea DNA polymerase was obtained.

FIG. 3 is a SDS-PAGE contrast of prepared Deep Sea DNA polymerase and NEB control enzyme (Deep Vent exo-), showing that no impurity band exists in the PAGE gel image of the prepared Deep Sea DNA polymerase, the protein purity is as high as more than 95%, the size of the band is substantially the same as that of the NEB control enzyme, and the protein concentration is higher than that of the Deep Vent DNA polymerase; FIGS. 4(A) and 4(B) are agarose gel electrophoresis results of activity detection of prepared Deep Sea DNA polymerase and NEB control enzyme (Deep Vent exo-), and it can be seen that the amplification effect of the prepared Deep Sea DNA polymerase is better than that of the NEB control enzyme under the same unit volume enzyme activity and the same amplification system and conditions; FIG. 5 is a comparative graph showing the detection of DNase contamination between the prepared Deep Sea DNA polymerase and NEB control enzyme (Deep Vent exo-), and it can be seen that the prepared Deep Sea DNA polymerase did not degrade DNA in the system and had no DNase contamination, while the NEB control enzyme had DNase contamination; FIG. 6 is a PCR amplification graph of the prepared Deep Sea DNA polymerase on a template with high GC content, and it can be seen that the prepared Deep Sea DNA polymerase has obvious amplification on primer Homo-1-ANKRD9(F1+ R1) -GC-75.2% and weak amplification on primer Homo-86-Q96GK3(F1+ R1) -GC-55.2%.

In conclusion, the invention obtains the Deep Sea DNA polymerase with the purity of 95 percent by carrying out induction culture on the recombinant engineering bacteria containing the Deep Sea DNA polymerase nucleic acid sequence, cracking the bacteria to obtain a crude product and adopting a purification method combining Ni affinity chromatography, heparin affinity chromatography, cation exchange chromatography and dialysis, thereby meeting the purity requirement of third-generation sequencing on the DNA polymerase.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> Moner Biotechnology Ltd

<120> DNA polymerase, preparation method and application thereof

<130> OISZ18012

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 772

<212> PRT

<213> Amino acid

<220>

<221> MOD_RES

<222> (1)..(772)

<400> 1

Gly Ser Ser His His His His His His Ser Ser Gly Ile Leu Asp Thr

1 5 10 15

Asp Tyr Ile Thr Glu Asn Gly Lys Pro Val Ile Arg Val Phe Lys Lys

20 25 30

Glu Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg Thr Phe Glu Pro Tyr

35 40 45

Phe Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile Glu Asp Val Lys Lys

50 55 60

Val Thr Ala Lys Arg His Gly Thr Val Val Lys Val Lys Arg Ala Glu

65 70 75 80

Lys Val Gln Lys Lys Phe Leu Gly Arg Pro Ile Glu Val Trp Lys Leu

85 90 95

Tyr Phe Asn His Pro Gln Asp Val Pro Ala Ile Arg Asp Arg Ile Arg

100 105 110

Ala His Pro Ala Val Val Asp Ile Tyr Glu Tyr Asp Ile Pro Phe Ala

115 120 125

Lys Arg Tyr Leu Ile Asp Lys Gly Leu Ile Pro Met Glu Gly Asp Glu

130 135 140

Glu Leu Thr Met Leu Ala Phe Ala Ile Ala Thr Leu Tyr His Glu Gly

145 150 155 160

Glu Glu Phe Gly Thr Gly Pro Ile Leu Met Ile Ser Tyr Ala Asp Gly

165 170 175

Ser Glu Ala Arg Val Ile Thr Trp Lys Lys Ile Asp Leu Pro Tyr Val

180 185 190

Asp Val Val Ser Thr Glu Lys Glu Met Ile Lys Arg Phe Leu Arg Val

195 200 205

Val Arg Glu Lys Asp Pro Asp Val Leu Ile Thr Tyr Asn Gly Asp Asn

210 215 220

Phe Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu Glu Leu Gly Ile Lys

225 230 235 240

Phe Thr Leu Gly Arg Asp Gly Ser Glu Pro Lys Ile Gln Arg Met Gly

245 250 255

Asp Arg Phe Ala Val Glu Val Lys Gly Arg Ile His Phe Asp Leu Tyr

260 265 270

Pro Val Ile Arg Arg Thr Ile Asn Leu Pro Thr Tyr Thr Leu Glu Ala

275 280 285

Val Tyr Glu Ala Val Phe Gly Lys Pro Lys Glu Lys Val Tyr Ala Glu

290 295 300

Glu Ile Ala Gln Ala Trp Glu Ser Gly Glu Gly Leu Glu Arg Val Ala

305 310 315 320

Arg Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr Glu Leu Gly Arg Glu

325 330 335

Phe Phe Pro Met Glu Ala Gln Leu Ser Arg Leu Ile Gly Gln Ser Leu

340 345 350

Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu Val Glu Trp Phe Leu

355 360 365

Leu Arg Lys Ala Tyr Lys Arg Asn Glu Leu Ala Pro Asn Lys Pro Asp

370 375 380

Glu Arg Glu Leu Ala Arg Arg Arg Gly Gly Tyr Ala Gly Gly Tyr Val

385 390 395 400

Lys Glu Pro Glu Arg Gly Leu Trp Asp Asn Ile Val Tyr Leu Asp Phe

405 410 415

Arg Ser Leu Tyr Pro Ser Ile Ile Ile Thr His Asn Val Ser Pro Asp

420 425 430

Thr Leu Asn Arg Glu Gly Cys Lys Glu Tyr Asp Val Ala Pro Glu Val

435 440 445

Gly His Lys Phe Cys Lys Asp Phe Pro Gly Phe Ile Pro Ser Leu Leu

450 455 460

Gly Asp Leu Leu Glu Glu Arg Gln Lys Ile Lys Arg Lys Met Lys Ala

465 470 475 480

Thr Val Asp Pro Leu Glu Lys Lys Leu Leu Asp Tyr Arg Gln Arg Ala

485 490 495

Ile Lys Ile Leu Ala Asn Ser Phe Tyr Gly Tyr Tyr Gly Tyr Ala Lys

500 505 510

Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu Ser Val Thr Ala Trp Gly

515 520 525

Arg Glu Tyr Ile Glu Met Val Ile Arg Glu Leu Glu Glu Lys Phe Gly

530 535 540

Phe Lys Val Leu Tyr Ala Asp Thr Asp Gly Leu His Ala Thr Ile Pro

545 550 555 560

Gly Ala Asp Ala Glu Thr Val Lys Lys Lys Ala Lys Glu Phe Leu Lys

565 570 575

Tyr Ile Asn Pro Lys Leu Pro Gly Leu Leu Glu Leu Glu Tyr Glu Gly

580 585 590

Phe Tyr Val Arg Gly Phe Phe Val Thr Lys Lys Lys Tyr Ala Val Ile

595 600 605

Asp Glu Glu Gly Lys Ile Thr Thr Arg Gly Leu Glu Ile Val Arg Arg

610 615 620

Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln Ala Arg Val Leu Glu Ala

625 630 635 640

Ile Leu Lys His Gly Asp Val Glu Glu Ala Val Arg Ile Val Lys Glu

645 650 655

Val Thr Glu Lys Leu Ser Lys Tyr Glu Val Pro Pro Glu Lys Leu Val

660 665 670

Ile His Glu Gln Ile Thr Arg Asp Leu Arg Asp Tyr Lys Ala Thr Gly

675 680 685

Pro His Val Ala Val Ala Lys Arg Leu Ala Ala Arg Gly Val Lys Ile

690 695 700

Arg Pro Gly Thr Val Ile Ser Tyr Ile Val Leu Lys Gly Ser Gly Arg

705 710 715 720

Ile Gly Asp Arg Ala Ile Pro Ala Asp Glu Phe Asp Pro Thr Lys His

725 730 735

Arg Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn Gln Val Leu Pro Ala Val

740 745 750

Glu Arg Ile Leu Lys Ala Phe Gly Tyr Arg Lys Glu Asp Leu Arg Tyr

755 760 765

Gln Lys Thr Lys

770

<210> 2

<211> 2318

<212> DNA

<213> Nucleotide

<220>

<221> misc_feature

<222> (1)..(2318)

<400> 2

ggcagcagcc atcatcatca tcatcacagc agcggcattc tggataccga ttacattacc 60

gaaaacggca aaccggtgat tcgtgtgttc aaaaaagaaa acggcgaatt caaaatcgaa 120

tacgatcgta cctttgaacc gtatttttac gcgctgctga aagatgatag cgcgatcgaa 180

gatgtgaaaa aagtgaccgc gaaacgtcat ggcaccgtgg tgaaagtgaa acgtgcggaa 240

aaagtgcaga aaaaatttct gggccgtccg attgaagtgt ggaaactgta tttcaaccat 300

ccgcaggatg tgccggcgat tcgtgatcgt attcgtgcgc atccggcggt ggtggatatt 360

tatgaatatg atatcccgtt cgcgaaacgt tatctgattg ataaaggcct gattccgatg 420

gaaggcgatg aagaactgac catgctggcc tttgcgattg cgaccctgta tcacgaaggc 480

gaagaatttg gcaccggccc gattctgatg attagctatg cggatggcag cgaagcgcgt 540

gtgattacct ggaaaaaaat cgatctgccg tatgtggatg tggtgagcac cgaaaaagaa 600

atgatcaaac gctttctgcg tgtggtgcgt gaaaaagatc cggatgtgct gattacctat 660

aacggcgata actttgattt cgcgtatctg aaaaaacgtt gcgaagaact gggcatcaaa 720

tttaccctgg gccgtgatgg tagcgaaccg aaaattcagc gtatgggcga tcgttttgcg 780

gtggaagtga aaggccgtat tcattttgat ctgtatccgg tgattcgccg taccattaac 840

ctgccgacct ataccctgga agcggtgtat gaagcggtgt ttggcaaacc gaaagaaaaa 900

gtgtacgcgg aagaaattgc gcaggcgtgg gaaagcggcg aaggcctgga acgtgtggcg 960

cgttatagca tggaagatgc gaaagtgacc tatgaactgg gccgtgaatt tttcccgatg 1020

gaagcgcagc tgtctcgtct gattggccag agcctgtggg atgtgagccg tagcagcacc 1080

ggcaacctgg tggaatggtt tctgctgcgt aaagcgtata aacgtaacga actggccccg 1140

aacaaaccgg atgaacgtga actggcccgt cgtcgtggcg gttatgcggg cggttatgtg 1200

aaagaaccgg aacgtggcct gtgggataac attgtgtatc tggattttcg tagcctgtat 1260

ccgagcatta ttatcaccca taacgtgagc ccggataccc tgaaccgtga aggctgcaaa 1320

gaatatgatg tggcgccgga agtgggccat aaattctgca aagatttccc gggctttatt 1380

ccgagcctgc tgggcgatct gctggaagaa cgccagaaaa tcaaacgcaa aatgaaagcg 1440

accgttgatc cgctggaaaa aaaactgctg gattatcgtc agcgcgcgat taaaattctg 1500

gccaacagct tctatggcta ttatggttat gcgaaagcgc gttggtattg caaagaatgc 1560

gcggaaagcg tgaccgcgtg gggccgtgaa tatatcgaaa tggtgatccg cgaactggaa 1620

gaaaaattcg gcttcaaagt gctgtatgcg gataccgatg gcctgcatgc gaccattccg 1680

ggtgcggatg cggaaaccgt gaaaaaaaaa gcgaaagaat tcctgaaata catcaatccg 1740

aaactgccgg gcctgctgga actggaatat gaaggctttt atgtgcgtgg ctttttcgtg 1800

accaaaaaaa aatacgcggt gatcgatgaa gaaggcaaaa ttaccacccg tggcctggaa 1860

attgtgcgtc gtgattggag cgaaattgcg aaagaaaccc aggcgcgtgt gctggaagcg 1920

attctgaaac atggcgatgt ggaagaagcg gtgcgtattg ttaaagaagt gaccgaaaaa 1980

ctgagcaaat atgaagttcc gccggaaaaa ctggtgattc atgaacaaat tacccgtgat 2040

ctgcgtgatt ataaagcgac cggtccgcat gtggcggtgg caaaacgtct ggcagcgcgt 2100

ggcgtgaaaa ttcgtccggg caccgtgatt agctatattg tgctgaaagg cagcggccgt 2160

attggcgatc gtgcgattcc ggcggatgaa tttgatccga ccaaacatcg ttatgatgcg 2220

gaatattata tcgaaaacca ggtgctgccg gcggtggaac gtattctgaa agcgtttggc 2280

tatcgtaaag aagatctgcg ctatcagaaa accaaaca 2318

Claims

1. A DNA polymerase characterized by the amino acid sequence shown in SEQ ID NO. 1.

2. The gene encoding the DNA polymerase of claim 1 having the nucleotide sequence set forth in SEQ ID NO. 2.

3. An expression vector comprising the gene of claim 2;

the expression vector carries a histidine tag;

the expression vector is pBAD.

4. A host cell comprising the expression vector of claim 3.

5. The host cell of claim 4, wherein the host cell is E.coli.

6. A method of constructing a host cell that secretes a DNA polymerase, comprising the steps of:

(1) constructing the expression vector of claim 3;

7. A method for preparing the DNA polymerase of claim 1, comprising the steps of:

(1') constructing the host cell according to claim 4, and subjecting the host cell to induction culture;

(3') purifying the supernatant to obtain the DNA polymerase.

8. The method of producing a DNA polymerase according to claim 7, wherein the induction culture in the step (1') is carried out using an inducer;

the inducer is arabinose;

the final concentration of the inducer is 0.1% -0.3%;

the temperature of the induction culture in the step (1') is 20-30 ℃;

the induction culture time in the step (1') is 12-16 h;

the cracking in the step (2') comprises the steps of resuspending host cells by using a lysate, crushing the resuspended cells by using a cell crusher, and carrying out water bath for 10-20 min at 70-80 ℃;

the mass ratio of the lysis solution to the host cell is (2-10): 1.

9. The method for preparing a DNA polymerase according to claim 7, comprising the steps of:

(1') constructing the host cell of claim 4, and performing induced culture on the host cell with 0.1% -0.3% of arabinose at 20-30 ℃ for 12-16 h;

(1 '') adding the mixture of the Ni chromatography medium and the supernatant into a Ni affinity column, washing by adopting an imidazole solution with the concentration gradient of 30-400 mM, and collecting Ni affinity eluent;

(2') mixing the Ni affinity eluent and the buffer solution according to the volume ratio of 1 (3-5), adding a heparin affinity column, washing by adopting a KCl solution with the concentration gradient of 50 mM-1M, and collecting the heparin affinity eluent;

(4 '') adding the cation exchange eluate to a dialysis buffer for dialysis to obtain the purified DNA polymerase.

10. An enzyme preparation comprising the DNA polymerase of claim 1;

the enzyme preparation further comprises an enzyme buffer.

11. Use of a DNA polymerase according to claim 1, an expression vector according to claim 3, a host cell according to claim 4 or an enzyme preparation according to claim 10 in the preparation of a molecular assay kit.