CN110923308A - Idiopathic pulmonary fibrosis diagnosis marker and application thereof in preparing diagnosis or prognosis tool - Google Patents
Idiopathic pulmonary fibrosis diagnosis marker and application thereof in preparing diagnosis or prognosis tool Download PDFInfo
- Publication number
- CN110923308A CN110923308A CN201911277110.1A CN201911277110A CN110923308A CN 110923308 A CN110923308 A CN 110923308A CN 201911277110 A CN201911277110 A CN 201911277110A CN 110923308 A CN110923308 A CN 110923308A
- Authority
- CN
- China
- Prior art keywords
- cox5b
- gene
- protein
- pulmonary fibrosis
- idiopathic pulmonary
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54306—Solid-phase reaction mechanisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6884—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from lung
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/12—Pulmonary diseases
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Urology & Nephrology (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Wood Science & Technology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a diagnostic marker for idiopathic pulmonary fibrosis and application thereof in preparing a diagnostic or prognostic tool. The present invention relates to the novel discovery that cytochrome C oxidase subunit 5B (COX 5B) is a serum marker in patients with idiopathic fibrosis (IPF). COX5B is one of the constituents of respiratory chain complex III on the inner membrane of mitochondria, and its COX5B content is increased in the serum of IPF patients, indicating that mitochondria damage is severe in IPF patients, COX5B is released into the serum, and COX5B content in the serum of IPF patients is negatively correlated with Survival (overal Survival), and COX5B content in the serum of IPF patients with poor Survival is higher. The research result of the invention provides a noninvasive method for clinically diagnosing idiopathic pulmonary fibrosis, and is suitable for clinical popularization.
Description
Technical Field
The invention belongs to the technical field of medical diagnosis, and particularly relates to a diagnostic marker for idiopathic pulmonary fibrosis and application thereof in preparing a diagnostic or prognostic tool.
Background
Idiopathic Pulmonary Fibrosis (IPF) is a chronic, progressively fatal disease characterized pathologically by destruction of the lung parenchyma, marked changes in the alveolar epithelial cell phenotype, deposition of extracellular matrix, and abnormal proliferation and accumulation of fibroblasts. It is now known that more than 200 causes may cause idiopathic pulmonary fibrosis, such as genetic diseases, autoimmune diseases, exposure to toxic substances in the environment, drugs and radiation, etc. There is a growing body of evidence that not only inter-heterogeneity and intra-heterogeneity of tissue cells in an individual but also dynamic changes of the individual at various levels, such as cells and molecules, are widespread during the development of pulmonary fibrosis. Current pathogenesis studies of pulmonary fibrosis find close association with mitochondrial dysfunction. The proteomics technology can be used for better and comprehensively analyzing the mechanism of complex diseases, screening disease markers, researching drug action targets, screening special functional proteins and the like. The existing omics research finds that the abnormal expression of CCNA2, PBMC, CD28 and the like in the serum of patients with pulmonary fibrosis, the protein modification is mainly embodied in methylation of CDKN2B, CAR10, MGMT and the like and hypermethylation of CASZ1 and the like, and the metabonomic result shows that obvious changes occur in an adenosine triphosphate degradation pathway, a glycolysis pathway, a glutathione biosynthesis pathway and an ornithine aminotransferase pathway. According to statistics, about 500 million patients with idiopathic pulmonary fibrosis are newly increased in the world every year, the prognosis is poor, and the median survival time after diagnosis is 2-3 years. The etiology of the idiopathic pulmonary fibrosis is unclear, diagnosis is easy to confuse, and the like, and the means for clinically diagnosing the idiopathic pulmonary fibrosis is often lack of specificity, so that a more efficient and stable means for early warning or judging the idiopathic pulmonary fibrosis is urgently needed. Therefore, it is an urgent problem to develop a method for accurately diagnosing IPF.
Cytochrome C Oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that transfers electrons from cytochrome C to molecular oxygen and promotes the electrochemical gradient of protons across the inner mitochondrial membrane. The complex consists of 13 mitochondrial and nuclear-encoded subunits. The mitochondria-encoded subunits perform electron transfer and proton pump activities. The function of the core-encoded subunits may play a role in the regulation and assembly of the complex. The gene (COX 5B) encodes the nuclear-encoded subunit Vb of the human mitochondrial respiratory chain enzyme. In normal mitochondria, the protein is located on the inner membrane of mitochondria, when the mitochondria are damaged, the potential of the mitochondrial membrane is depolarized, the inner and outer membranes are damaged, the respiratory chain complex III located on the inner membrane of mitochondria is disintegrated, and COX5B protein is released into blood serum.
Disclosure of Invention
The invention aims to provide a diagnostic marker for idiopathic pulmonary fibrosis and application thereof in preparing a diagnostic or prognostic tool, wherein COX5B is detected to be higher in blood of patients with idiopathic pulmonary fibrosis than in normal people by a DIA method of LC-MS/MS mass spectrum. The COX5B protein is one of the components of the respiratory chain complex III on the inner mitochondrial membrane, the COX5B protein level in the serum of patients with idiopathic pulmonary fibrosis is high, which indicates that the mitochondria of the patients with IPF are seriously damaged, the COX5B protein is released into the serum, the COX5B protein level is negatively related to the survival OS of the patients with IPF, and the COX5B protein level in the serum of the patients with poor survival IPF is high, so that a tool for diagnosing the idiopathic pulmonary fibrosis can be further developed.
The invention adopts the following technical scheme to realize the purpose, and the diagnostic marker for the idiopathic pulmonary fibrosis is characterized in that the diagnostic marker is a COX5B gene expression product, and a coding sequence of the COX5B gene comprises any one of the following DNA sequences:
(1) a DNA sequence shown as SEQ ID NO.2 in the sequence table;
(2) a DNA sequence which hybridizes with the DNA sequence defined in (1) under strict conditions and codes the same functional protein;
(3) and (3) a DNA sequence which has more than 70% of homology with the DNA sequence defined in (1) or (2) and encodes the same functional protein.
Preferably, the COX5B gene expression product comprises a COX5B protein, a functional equivalent of the COX5B protein, and a partial peptide of the COX5B protein, wherein the partial peptide of the COX5B protein comprises a functional domain associated with idiopathic pulmonary fibrosis; functional equivalents of the COX5B protein include the protein encoded by the conservative variant of the COX5B protein, or an active fragment or derivative thereof, an allelic variant, a natural mutant, an induced mutant, DNA which hybridizes under high or low stringency conditions with the DNA of COX 5B.
Preferably, the COX5B protein is a protein having the following amino acid sequence:
(1) a protein consisting of an amino acid sequence shown by SEQ ID NO.1 in a sequence table;
(2) a protein derived from the amino acid sequence shown in SEQ ID No.1, which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No.1, and has the same function as the amino acid sequence shown in SEQ ID No.1, wherein the number of the substituted, deleted or added amino acids is usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10;
(3) and polypeptides consisting of amino acid sequences with at least 80 percent of homology with the amino acid sequence shown in SEQ ID NO.1, also called polypeptides with sequence identity.
Preferably, the sources of said COX5B gene and its expression product include, but are not limited to, blood, interstitial fluid, urine, saliva, lung tissue, bronchoalveolar lavage samples or exhaled breath condensate or spinal fluid.
The invention discloses an application of an idiopathic pulmonary fibrosis diagnosis marker in preparing a diagnosis or prognosis tool, which is characterized in that: the expression level of COX5B gene is detected by RT-PCR, real-time quantitative PCR, immunodetection, in-situ hybridization, a chip or a high-throughput sequencing platform to diagnose the idiopathic pulmonary fibrosis, the COX5B content in the serum of the IPF patient is higher, which indicates that the mitochondria of the IPF patient is seriously damaged, the COX5B is released into the serum, the COX5B content is negatively related to the survival OS of the IPF patient, and the COX5B content in the serum of the IPF patient with poor survival is higher.
Preferably, the product for diagnosing idiopathic pulmonary fibrosis by RT-PCR at least comprises a pair of primers for specifically amplifying COX5B gene; the product for diagnosing idiopathic pulmonary fibrosis by using real-time quantitative PCR at least comprises a pair of primers for specifically amplifying COX5B gene; products for diagnosing idiopathic pulmonary fibrosis using an immunoassay include an antibody that specifically binds to an expression product of COX5B gene; products for diagnosing idiopathic pulmonary fibrosis using in situ hybridization include a probe that hybridizes to a nucleic acid sequence of a COX5B gene; the product for diagnosing idiopathic pulmonary fibrosis by using the chip comprises a protein chip and a gene chip; the protein chip comprises an antibody which is specifically combined with COX5B protein, and the gene chip comprises a probe which is hybridized with a nucleic acid sequence of COX5B gene.
Preferably, the product for diagnosing idiopathic pulmonary fibrosis by real-time quantitative PCR at least comprises a pair of primers for specifically amplifying COX5B gene, the sequences of the primers are shown in SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, and SEQ ID NO.11 and SEQ ID NO. 12.
Preferably, the tool is used for diagnosing idiopathic pulmonary fibrosis by detecting the expression of COX5B gene in a sample, and the tool comprises a chip, a kit, a test paper or a high-throughput sequencing platform.
Preferably, the chip comprises a gene chip or a protein chip, the gene chip comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, the oligonucleotide probe comprises an oligonucleotide probe aiming at COX5B gene for detecting the transcription level of COX5B gene, and the protein chip comprises a solid phase carrier and an antibody specific to COX5B protein fixed on the solid phase carrier; the kit comprises a gene detection kit or a protein immunodetection kit, wherein the gene detection kit comprises a reagent for detecting the transcription level of COX5B gene, and the protein immunodetection kit comprises a specific antibody of COX5B protein; the test paper comprises a reagent for detecting the transcription level of COX5B gene; the high throughput sequencing platform included reagents for detecting COX5B gene transcript levels.
Preferably, the reagent for detecting the transcription level of COX5B gene comprises a primer and/or a probe for COX5B gene.
The invention relates to a new discovery that cytochrome C oxidase subunit 5B is used as an IPF serum marker of idiopathic fibrosis, COX5B is one of the components of a respiratory chain complex III on an inner mitochondrial membrane, and the content of COX5B in the serum of an IPF patient is higher, which indicates that the mitochondrial damage of the IPF patient is serious, COX5B is released into the serum, and the content of COX5B is negatively related to the survival OS of the IPF patient, and the content of COX5B in the serum of a poor-survival IPF patient is higher. The research result of the invention provides a noninvasive method for clinically diagnosing idiopathic pulmonary fibrosis, and is suitable for clinical popularization.
Drawings
FIG. 1 is a graph of the differential expression of COX5B gene using QPCR in the detection of Idiopathic Pulmonary Fibrosis (IPF) compared to normal human (N);
FIG. 2 is an ELISA assay for differential expression of COX5B protein compared to Idiopathic Pulmonary Fibrosis (IPF) and normal human (N);
FIG. 3 is a graph showing LC-MS/MS detection of differential expression of COX5B protein compared to Idiopathic Pulmonary Fibrosis (IPF) and normal human (N).
Detailed Description
The present invention is described in further detail below with reference to examples, but it should not be construed that the scope of the above subject matter of the present invention is limited to the following examples, and that all the technologies realized based on the above subject matter of the present invention belong to the scope of the present invention.
The invention detects that the expression level of COX5B protein in the blood of idiopathic pulmonary fibrosis patients is higher than that of normal people through a DIA method of LC-MS/MS mass spectrum. COX5B is one of the components of the respiratory chain complex III on the inner mitochondrial membrane, the content of COX5B protein in the serum of patients with idiopathic pulmonary fibrosis is high, which indicates that the mitochondria of patients with IPF are seriously damaged, the COX5B gene expression product is released into the serum, the content of COX5B protein is negatively related to the survival OS of patients with IPF, and the content of COX5B protein in the serum of patients with poor survival IPF is high, so that a tool for diagnosing idiopathic pulmonary fibrosis can be further developed.
According to one aspect of the present invention, the present invention provides the use of a product for detecting the expression product of COX5B gene for the preparation of a tool for diagnosing idiopathic pulmonary fibrosis.
Further, the above-mentioned test products include: products for diagnosing idiopathic pulmonary fibrosis are detected by RT-PCR, real-time quantitative PCR, immunodetection, in-situ hybridization, a chip or high-throughput sequencing platform and LC-MS/MS mass spectrum to detect the expression level of COX5B gene.
Further, the product for diagnosing idiopathic pulmonary fibrosis by RT-PCR at least comprises a pair of primers (three pairs of primers SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO. 8) for specifically amplifying COX5B gene; the product for diagnosing the idiopathic pulmonary fibrosis by using the real-time quantitative PCR at least comprises a pair of primers (2 pairs of primers, namely SEQ ID NO.9 and SEQ ID NO.10, and SEQ ID NO.11 and SEQ ID NO. 12) for specifically amplifying COX5B genes; the product for diagnosing idiopathic pulmonary fibrosis by immunoassay comprises an antibody specifically binding to an expression product of COX5B gene; the product for diagnosing idiopathic pulmonary fibrosis by in situ hybridization comprises a probe hybridized with a nucleic acid sequence of a COX5B gene; the product for diagnosing idiopathic pulmonary fibrosis by using the chip comprises: protein chips and gene chips; the protein chip comprises an antibody which is specifically combined with COX5B protein, and the gene chip comprises a probe which is hybridized with a nucleic acid sequence of COX5B gene.
In a specific embodiment of the invention, the product for diagnosing idiopathic pulmonary fibrosis by real-time quantitative PCR at least comprises a pair of primers for specifically amplifying COX5B gene, the sequences of which are shown in sequence tables SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, and SEQ ID NO.11 and SEQ ID NO. 12.
Preferably, the diagnostic tool comprises a chip, a kit, a test strip or a high-throughput sequencing platform, and LC-MS/MS mass spectrometry detection. The high-throughput sequencing and LC-MS/MS mass spectrometry sequencing platform is a special diagnostic tool, and a product for detecting COX5B gene expression can be applied to the platform to realize the detection of the expression condition of COX5B gene. With the development of high-throughput sequencing/mass spectrometry sequencing technology, the construction of a gene expression profile of a person becomes very convenient work. By comparing the gene expression profiles of patients with diseases and normal people, the abnormality of which gene is related to the disease can be easily analyzed. Therefore, the finding that the abnormality of COX5B gene is associated with idiopathic pulmonary fibrosis in high throughput sequencing/mass spectrometry sequencing is also included in the use of COX5B gene, and is also within the scope of the present invention.
According to another aspect of the present invention, the present invention also provides a tool for diagnosing idiopathic pulmonary fibrosis, wherein the product comprises a chip, a kit, a test strip or a high throughput sequencing/mass spectrometry platform.
Wherein, the chip comprises a gene chip and a protein chip; the gene chip comprises a solid phase carrier and oligonucleotide probes fixed on the solid phase carrier, wherein the oligonucleotide probes comprise oligonucleotide probes for detecting the transcription level of COX5B gene and aiming at COX5B gene; the protein chip comprises a solid phase carrier and a specific antibody of COX5B protein fixed on the solid phase carrier; the gene chip can be used for detecting the expression level of a plurality of genes including COX5B gene (such as a plurality of genes related to idiopathic pulmonary fibrosis). The protein chip can be used for detecting the expression level of a plurality of proteins including COX5B protein (such as a plurality of proteins related to idiopathic pulmonary fibrosis). By simultaneously detecting a plurality of markers with the idiopathic pulmonary fibrosis, the accuracy of diagnosing the idiopathic pulmonary fibrosis can be greatly improved. Wherein the kit comprises a gene detection kit and a protein immunodetection kit; the gene detection kit comprises a reagent for detecting the transcription level of COX5B gene; the protein immunoassay kit comprises a specific antibody of COX5B protein. Further, the reagents include reagents required in the process of detecting the expression level of COX5B gene using RT-PCR, real-time quantitative PCR, immunoassay, in situ hybridization, or a chip method. Preferably, the reagent comprises a primer and/or probe for the COX5B gene. Primers and probes that can be used to detect the expression level of the COX5B gene are easily designed based on the nucleotide sequence information of the COX5B gene.
The high throughput sequencing platform comprises a reagent for detecting the expression level of COX5B gene. The test paper comprises a test paper carrier and an oligonucleotide fixed on the test paper carrier, wherein the oligonucleotide can detect the transcription level of COX5B gene. The probe that hybridizes to the nucleic acid sequence of the COX5B gene may be DNA, RNA, a DNA-RNA chimera, PNA, or other derivative. The length of the probe is not limited, and any length may be used as long as specific hybridization and specific binding to the target nucleotide sequence are achieved. The length of the probe may be as short as 25, 20, 15, 13 or 10 bases in length. Also, the length of the probe can be as long as 60, 80, 100, 150, 300 base pairs or more, even for the entire gene. Since different probe lengths have different effects on hybridization efficiency and signal specificity, the length of the probe is usually at least 14 base pairs, and at most, usually not more than 30 base pairs, and the length complementary to the nucleotide sequence of interest is optimally 15 to 25 base pairs. The probe self-complementary sequence is preferably less than 4 base pairs so as not to affect hybridization efficiency.
Further, the antibody specific to COX5B protein includes monoclonal antibodies and polyclonal antibodies. Antibodies specific for the COX5B protein include intact antibody molecules, any fragment or modification of an antibody. So long as the fragment retains the ability to bind to COX5B protein. The preparation of antibodies for use at the protein level is well known to those skilled in the art and any method may be used in the present invention to prepare such antibodies.
In a specific embodiment of the invention, the primer sequence aiming at COX5B gene is shown in sequence table SEQ ID NO.3 and SEQ ID NO. 4.
The sources of COX5B gene and its expression product for diagnosing idiopathic pulmonary fibrosis include, but are not limited to, blood, interstitial fluid, urine, saliva, lung tissue, bronchoalveolar lavage samples or exhaled breath condensate, spinal fluid, and other body fluids. In a specific embodiment of the present invention, the source of COX5B gene and its expression product for diagnosing idiopathic pulmonary fibrosis is blood. In a particular embodiment of the invention, the blood is peripheral blood taken from patients with idiopathic pulmonary fibrosis and from normal persons.
The specific sequence of COX5B gene (NM-001862.3) of the present invention can be found in GeneBank, the International public database of nucleic acids.
The coding sequence of COX5B gene of the invention comprises any one of the following DNA molecules:
(1) a DNA sequence shown as SEQ ID NO.2 in the sequence table;
(2) a DNA sequence which hybridizes with the DNA sequence defined in (1) under strict conditions and codes the same functional protein;
(3) a DNA sequence having 70%, preferably 90% or more homology with the DNA sequence defined in (1) or (2) and encoding the same functional protein.
In a specific embodiment of the invention, the coding sequence of the COX5B gene is the DNA sequence shown in SEQ ID NO. 2.
In the context of the present invention, the COX5B gene expression product includes the COX5B protein and a partial peptide of the COX5B protein. The partial peptide of the COX5B protein contains a functional domain associated with idiopathic pulmonary fibrosis.
The COX5B protein includes the COX5B protein and any functional equivalent of the COX5B protein. The functional equivalents comprise a COX5B protein conservative variant protein, or an active fragment or an active derivative thereof, an allelic variant, a natural mutant, an induced mutant, a protein encoded by DNA that hybridizes under high or low stringency conditions with the DNA of COX 5B.
Further, COX5B protein is a protein having the following amino acid sequence:
(1) a protein consisting of an amino acid sequence shown by SEQ ID NO.1 in a sequence table;
(2) a protein which is derived from the amino acid sequence shown in SEQ ID NO.1, has the same function with the amino acid sequence shown in SEQ ID NO.1 and is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 1. The number of substituted, deleted or added amino acids is usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10;
(3) a polypeptide consisting of an amino acid sequence having at least 80% homology (also referred to as sequence identity) with the amino acid sequence shown in SEQ ID NO.1, more preferably at least about 90% to 95% homology, often 96%, 97%, 98%, 99% homology with the amino acid sequence shown in SEQ ID NO. 1.
In a specific embodiment of the present invention, the COX5B protein is a protein having the amino acid sequence shown in SEQ ID No. 1.
In general, it is known that modification of one or more amino acids in a protein does not affect the function of the protein.
One skilled in the art will recognize that individual amino acid changes or small percentage amino acids or individual additions, deletions, insertions, substitutions to an amino acid sequence are conservative modifications, wherein a change in a protein results in a protein with a similar function. Conservative substitution tables providing functionally similar amino acids are well known in the art.
An example of a protein modified by the addition of an amino acid or amino acid residues is a fusion protein of the COX5B protein. There is no limitation on the peptide or protein fused with the COX5B protein, so long as the resulting fusion protein retains the biological activity of the COX5B protein.
The COX5B protein of the invention also comprises non-conservative modifications of the amino acid sequence shown in SEQ ID NO.1, as long as the modified protein still retains the biological activity of the COX5B protein. The number of amino acids mutated in such modified proteins is typically 10 or less, such as 6 or less, such as 3 or less.
In the context of the present invention, diagnosing idiopathic pulmonary fibrosis includes both determining whether a subject has suffered from idiopathic pulmonary fibrosis and determining whether a subject is at risk of suffering from idiopathic pulmonary fibrosis, and predicting the prognosis of a subject with idiopathic pulmonary fibrosis.
Experimental methods without specific conditions noted in the examples, molecular cloning is generally performed according to conventional conditions: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations.
Example 1
Screening for genes differentially expressed in idiopathic pulmonary fibrosis patients and in normal humans
1. Clinical study subjects:
30 patients with idiopathic pulmonary fibrosis are selected, wherein 21 men and 9 women have age in the range of 30-83 years, and the diagnosis standard meets interstitial lung disease of Chinese respiratory society and national thoracic society (ATS) revised 'idiopathic pulmonary fibrosis diagnosis and treatment standard'.
Exclusion criteria: (1) patients with other lung diseases such as bronchial asthma, pulmonary interstitial fibrosis, and lung cancer; (2) those with other site infections; (3) patients with serious cardiovascular and cerebrovascular diseases, diabetes, blood system diseases, malignant tumor, organ failure, and hepatitis; (4) those suffering from immune system diseases or who have recently used immunosuppressive agents.
Normal control: the method comprises selecting healthy people for physical examination 30, wherein the healthy people comprise 18 males and 12 females, and the age range is 32-70.
And (3) inclusion standard: no history of chronic cough, expectoration, asthma, etc.; there is no history of upper respiratory tract infection and lung infection recently; those without other systemic infections; those without other lung diseases; those who have not recently used immunosuppressive agents or who have no systemic immune system; patients without organ failure or severe cardiovascular and cerebrovascular diseases and tumors; those without allergic diseases. The selected subjects were excluded from the lung function test and compared with the idiopathic pulmonary fibrosis group, and the differences in gender and age were not statistically significant and comparable. All subjects signed informed consent.
2. Sample collection
In the early morning on an empty stomach, 10mL of peripheral venous blood was collected and anticoagulated with EDTA.
Study subjects:
30 patients with idiopathic pulmonary fibrosis, 30 normal patients were selected according to the method of example 1.
3. Blood sample total RNA extraction
Example 2
Validating genes differentially expressed in idiopathic pulmonary fibrosis patients and normal humans
4. ELISA detection of COX5B
Example 2 demonstrates the differential expression of COX5B in patients with idiopathic pulmonary fibrosis and in normal persons.
5. Extracting blood total peptide, detecting by mass spectrum
The LC-MS/MS mass spectrometry example 2 was used to verify the COX5B levels in blood of patients with idiopathic pulmonary fibrosis and normal humans.
The results are shown in fig. 1-3, and compared with normal people, the blood of idiopathic pulmonary fibrosis patients has significantly increased mRNA level of COX5B gene, the difference is statistically significant (P < 0.05), and the results are the same as ELISA and proteomic detection results.
The foregoing embodiments illustrate the principles, principal features and advantages of the invention, and it will be understood by those skilled in the art that the invention is not limited to the foregoing embodiments, which are merely illustrative of the principles of the invention, and that various changes and modifications may be made therein without departing from the scope of the principles of the invention.
SEQUENCE LISTING
<110> university of south Henan university
<120> idiopathic pulmonary fibrosis disease diagnosis marker and application thereof in preparing diagnosis or prognosis tool
<130>2019
<160>12
<170>PatentIn version 3.3
<210>1
<211>129
<212>PRT
<213> Artificial sequence (artificial sequence)
<400>1
PYNVLAPKGASGTREDPNLV 80
PSISNKRIVGCICEEDNTSV 100
VWFWLHKGEAQRCPRCGAHY 120
KLVPQQLAH 129
<210>2
<211>690
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>2
agttttgctg ctagtcgcgg acgcaatggc ttcaaggtta cttcgcggag ctggaacgct 60
ggccgcgcag gccctgaggg ctcgcggccc cagtggcgcg gccgcgatgc gctccatggc 120
atctggaggt ggtgttccca ctgatgaaga gcaggcgact gggttggaga gggagatcat 180
gctggctgca aagaagggac tggacccata caatgtactg gccccaaagg gagcttcagg 240
caccagggaa gaccctaatt tagtcccctc catctccaac aagagaatag taggctgcat 300
ctgtgaagag gacaatacca gcgtcgtctg gttttggctg cacaaaggcg aggcccagcg 360
atgcccccgc tgtggagccc attacaagct ggtgccccag cagctggcac actgagcacc 420
tgcactaaat tactcaaaat gtgctgtaaa gtttcttctt tccagtaaag actagccatt 480
gcattggctc cttctcccat agatggctgg tcttatttct tacccgtatt ctttggtagg 540
catggaatat gcttattttg ggaaaagctg tctgttaatg ctagcttgcc atccacttac 600
tgaaagtgta taaccagtgt atagtgctta gattaataat aagaatagat cgacaacccg 660
taatgcaatg aatgggacca cctggtatga 690
<210>3
<211>20
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>3
<210>4
<211>21
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>4
tgcattacgg gttgtcgatc t 21
<210>5
<211>20
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>5
<210>6
<211>20
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>6
<210>7
<211>21
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>7
tgggttggag agggagatca t 21
<210>8
<211>21
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>8
ttcagtaagt ggatggcaag c 21
<210>9
<211>21
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>9
atggcttcaa ggttacttcg c 21
<210>10
<211>20
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>10
<210>11
<211>22
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>11
tgtgaagagg acaataccag cg 22
<210>12
<211>21
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>12
ccagcttgta atgggctcca c 21
Sequence listing
<110> university of south Henan university
<120> idiopathic pulmonary fibrosis disease diagnosis marker and application thereof in preparing diagnosis or prognosis tool
<130>2019
<141>2019-12-12
<160>12
<170>SIPOSequenceListing 1.0
<210>1
<211>129
<212>PRT
<213> Artificial sequence (artificial sequence)
<400>1
Met Ala Ser Arg Leu Leu Arg Gly Ala Gly Thr Leu Ala Ala Gln Ala
1 5 10 15
Leu Arg Ala Arg Gly Pro Ser Gly Ala Ala Ala Met Arg Ser Met Ala
20 25 30
Ser Gly Gly Gly Val Pro Thr Asp Glu Glu Gln Ala Thr Gly Leu Glu
35 40 45
Arg Glu Ile Met Leu Ala Ala Lys Lys Gly Leu Asp Pro Tyr Asn Val
50 55 60
Leu Ala Pro Lys Gly Ala Ser Gly Thr Arg Glu Asp Pro Asn Leu Val
65 70 75 80
Pro Ser Ile Ser Asn Lys Arg Ile Val Gly Cys Ile Cys Glu Glu Asp
85 90 95
Asn Thr Ser Val Val Trp Phe Trp Leu His Lys Gly Glu Ala Gln Arg
100 105 110
Cys Pro Arg Cys Gly Ala His Tyr Lys Leu Val Pro Gln Gln Leu Ala
115 120 125
His
<210>2
<211>690
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>2
agttttgctg ctagtcgcgg acgcaatggc ttcaaggtta cttcgcggag ctggaacgct 60
ggccgcgcag gccctgaggg ctcgcggccc cagtggcgcggccgcgatgc gctccatggc 120
atctggaggt ggtgttccca ctgatgaaga gcaggcgact gggttggaga gggagatcat 180
gctggctgca aagaagggac tggacccata caatgtactg gccccaaagg gagcttcagg 240
caccagggaa gaccctaatt tagtcccctc catctccaac aagagaatag taggctgcat 300
ctgtgaagag gacaatacca gcgtcgtctg gttttggctg cacaaaggcg aggcccagcg 360
atgcccccgc tgtggagccc attacaagct ggtgccccag cagctggcac actgagcacc 420
tgcactaaat tactcaaaat gtgctgtaaa gtttcttctt tccagtaaag actagccatt 480
gcattggctc cttctcccat agatggctgg tcttatttct tacccgtatt ctttggtagg 540
catggaatat gcttattttg ggaaaagctg tctgttaatg ctagcttgcc atccacttac 600
tgaaagtgta taaccagtgt atagtgctta gattaataat aagaatagat cgacaacccg 660
taatgcaatg aatgggacca cctggtatga 690
<210>3
<211>20
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>3
<210>4
<211>21
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>4
tgcattacgg gttgtcgatc t 21
<210>5
<211>20
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>5
<210>6
<211>20
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>6
<210>7
<211>21
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>7
tgggttggag agggagatca t 21
<210>8
<211>21
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>8
ttcagtaagt ggatggcaag c 21
<210>9
<211>21
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>9
atggcttcaa ggttacttcg c 21
<210>10
<211>20
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>10
<210>11
<211>22
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>11
tgtgaagagg acaataccag cg 22
<210>12
<211>21
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>12
ccagcttgta atgggctcca c 21
Claims (10)
1. The diagnostic marker for the idiopathic pulmonary fibrosis is characterized in that the diagnostic marker is an expression product of COX5B gene, and a coding sequence of the COX5B gene comprises any one of the following DNA sequences:
(1) a DNA sequence shown as SEQ ID NO.2 in the sequence table;
(2) a DNA sequence which hybridizes with the DNA sequence defined in (1) under strict conditions and codes the same functional protein;
(3) and (3) a DNA sequence which has more than 70% of homology with the DNA sequence defined in (1) or (2) and encodes the same functional protein.
2. The diagnostic marker for idiopathic pulmonary fibrosis disease of claim 1, wherein: the COX5B gene expression product comprises COX5B protein, a functional equivalent of COX5B protein and a partial peptide of COX5B protein, wherein the partial peptide of COX5B protein comprises a functional domain associated with idiopathic pulmonary fibrosis; functional equivalents of the COX5B protein include the protein encoded by the conservative variant of the COX5B protein, or an active fragment or derivative thereof, an allelic variant, a natural mutant, an induced mutant, DNA which hybridizes under high or low stringency conditions with the DNA of COX 5B.
3. The diagnostic marker for idiopathic pulmonary fibrosis disease of claim 2, wherein: the COX5B protein is a protein having the following amino acid sequence:
(1) a protein consisting of an amino acid sequence shown by SEQ ID NO.1 in a sequence table;
(2) a protein which is derived from the amino acid sequence shown in SEQ ID NO.1 and has the same function with the amino acid sequence shown in SEQ ID NO.1 after the substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence shown in SEQ ID NO.1, wherein the number of the substituted, deleted or added amino acids is usually 1-50;
(3) and polypeptides consisting of amino acid sequences with at least 80 percent of homology with the amino acid sequence shown in SEQ ID NO.1, also called polypeptides with sequence identity.
4. The diagnostic marker for idiopathic pulmonary fibrosis disease of claim 1, wherein: sources of the COX5B gene and its expression product include, but are not limited to, blood, interstitial fluid, urine, saliva, lung tissue, bronchoalveolar lavage samples, or exhaled breath condensate or spinal fluid.
5. Use of the idiopathic pulmonary fibrosis diagnostic marker of any one of claims 1-4 in the preparation of a diagnostic or prognostic tool, characterized in that: the expression level of COX5B gene is detected by RT-PCR, real-time quantitative PCR, immunodetection, in-situ hybridization, a chip or a high-throughput sequencing platform to diagnose the idiopathic pulmonary fibrosis, the expression level of COX5B gene in the serum of the IPF patient is higher, which indicates that the mitochondria of the IPF patient are seriously damaged, the expression product of COX5B gene is released into the serum, the expression level of COX5B gene is negatively related to the survival OS of the IPF patient, and the expression level of COX5B gene in the serum of the IPF patient with poor survival is higher.
6. Use according to claim 5, characterized in that: the product for diagnosing idiopathic pulmonary fibrosis by RT-PCR at least comprises a pair of primers for specifically amplifying COX5B gene; the product for diagnosing idiopathic pulmonary fibrosis by using real-time quantitative PCR at least comprises a pair of primers for specifically amplifying COX5B gene; products for diagnosing idiopathic pulmonary fibrosis using an immunoassay include an antibody that specifically binds to an expression product of COX5B gene; products for diagnosing idiopathic pulmonary fibrosis using in situ hybridization include a probe that hybridizes to a nucleic acid sequence of a COX5B gene; the product for diagnosing idiopathic pulmonary fibrosis by using the chip comprises a protein chip and a gene chip; the protein chip comprises an antibody which is specifically combined with COX5B protein, and the gene chip comprises a probe which is hybridized with a nucleic acid sequence of COX5B gene.
7. Use according to claim 5, characterized in that: the product for diagnosing idiopathic pulmonary fibrosis by using real-time quantitative PCR at least comprises a pair of primers for specifically amplifying COX5B genes, wherein the sequences of the primers are shown as SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, and SEQ ID NO.11 and SEQ ID NO. 12.
8. Use according to claim 5, characterized in that: the tool is used for diagnosing idiopathic pulmonary fibrosis by detecting the expression of COX5B gene in a sample, and comprises a chip, a kit, test paper or a high-throughput sequencing platform.
9. Use according to claim 8, characterized in that: the chip comprises a gene chip or a protein chip, wherein the gene chip comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, the oligonucleotide probe comprises an oligonucleotide probe aiming at COX5B gene and used for detecting the transcription level of the COX5B gene, and the protein chip comprises a solid phase carrier and an antibody specific to the COX5B protein fixed on the solid phase carrier; the kit comprises a gene detection kit or a protein immunodetection kit, wherein the gene detection kit comprises a reagent for detecting the transcription level of COX5B gene, and the protein immunodetection kit comprises a specific antibody of COX5B protein; the test paper comprises a reagent for detecting the transcription level of COX5B gene; the high throughput sequencing platform included reagents for detecting COX5B gene transcript levels.
10. Use according to claim 9, characterized in that: the reagent for detecting the COX5B gene transcription level comprises a primer and/or a probe aiming at the COX5B gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911277110.1A CN110923308A (en) | 2019-12-12 | 2019-12-12 | Idiopathic pulmonary fibrosis diagnosis marker and application thereof in preparing diagnosis or prognosis tool |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911277110.1A CN110923308A (en) | 2019-12-12 | 2019-12-12 | Idiopathic pulmonary fibrosis diagnosis marker and application thereof in preparing diagnosis or prognosis tool |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110923308A true CN110923308A (en) | 2020-03-27 |
Family
ID=69859431
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911277110.1A Pending CN110923308A (en) | 2019-12-12 | 2019-12-12 | Idiopathic pulmonary fibrosis diagnosis marker and application thereof in preparing diagnosis or prognosis tool |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110923308A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113450874A (en) * | 2021-07-19 | 2021-09-28 | 中日友好医院(中日友好临床医学研究所) | 8 gene model for predicting prognosis of IPF patient and application |
| CN113514643A (en) * | 2020-07-09 | 2021-10-19 | 上海交通大学医学院附属瑞金医院 | Splicing related protein 130 for diagnosis of idiopathic pulmonary interstitial fibrosis and disease severity assessment |
| WO2023027186A1 (en) * | 2021-08-26 | 2023-03-02 | 国立大学法人大阪大学 | Pulmonary fibrosis biomarker |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104736160A (en) * | 2012-05-14 | 2015-06-24 | 德普伊新特斯产品有限责任公司 | hUTC modulation of pro-inflammatory mediators of lung and pulmonary diseases and disorders |
| WO2017203008A1 (en) * | 2016-05-25 | 2017-11-30 | Curevac Ag | Novel biomarkers |
| CN108384847A (en) * | 2018-04-03 | 2018-08-10 | 中日友好医院 | Diagnosis marker of the RNF182 genes as Chronic Obstructive Pulmonary Disease |
-
2019
- 2019-12-12 CN CN201911277110.1A patent/CN110923308A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104736160A (en) * | 2012-05-14 | 2015-06-24 | 德普伊新特斯产品有限责任公司 | hUTC modulation of pro-inflammatory mediators of lung and pulmonary diseases and disorders |
| WO2017203008A1 (en) * | 2016-05-25 | 2017-11-30 | Curevac Ag | Novel biomarkers |
| CN108384847A (en) * | 2018-04-03 | 2018-08-10 | 中日友好医院 | Diagnosis marker of the RNF182 genes as Chronic Obstructive Pulmonary Disease |
Non-Patent Citations (3)
| Title |
|---|
| KUEI-PIN CHUNG ET AL.: ""Mitofusins regulate lipid metabolism to mediate the development of lung fibrosis"", 《NATURE COMMUNICATIONS》 * |
| SAMHAN-ARIAS AK ET AL.: ""Homo sapiens cytochrome c oxidase subunit 5B (COX5B), mRNA"", 《GENBANK》 * |
| 刘杰: ""特发性肺纤维化差异表达基因的信号通路分析和关键基因的鉴定"", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113514643A (en) * | 2020-07-09 | 2021-10-19 | 上海交通大学医学院附属瑞金医院 | Splicing related protein 130 for diagnosis of idiopathic pulmonary interstitial fibrosis and disease severity assessment |
| CN113514643B (en) * | 2020-07-09 | 2023-06-20 | 上海交通大学医学院附属瑞金医院 | Splice related protein 130 for diagnosis of idiopathic pulmonary interstitial fibrosis and assessment of disease severity |
| CN113450874A (en) * | 2021-07-19 | 2021-09-28 | 中日友好医院(中日友好临床医学研究所) | 8 gene model for predicting prognosis of IPF patient and application |
| WO2023027186A1 (en) * | 2021-08-26 | 2023-03-02 | 国立大学法人大阪大学 | Pulmonary fibrosis biomarker |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110923308A (en) | Idiopathic pulmonary fibrosis diagnosis marker and application thereof in preparing diagnosis or prognosis tool | |
| EP2867375B1 (en) | Use of markers in the diagnosis and treatment of prostate cancer | |
| JP4185862B2 (en) | Bronchial asthma testing method | |
| CN109517898B (en) | Esophageal cancer detection, diagnosis or prognosis evaluation preparation, esophageal cancer treatment drug and application of RND2 gene | |
| CN113278695B (en) | Application of LINC00969 in liver cancer diagnosis biomarkers and treatment targets | |
| CN105238872B (en) | Application of product for detecting CALN1 gene expression in diagnosis and treatment of bile duct cancer | |
| KR20100059897A (en) | Use of clec1b for the determination of cardiovascular and thrombotic risk | |
| CN114574589B (en) | Application of marker ZNF207 in preparation of lung adenocarcinoma diagnostic reagent and diagnostic kit | |
| DK2931920T3 (en) | BIOMARKERS FOR INFLAMMATORY ASTMPHENotypes AND TREATMENT RESPONSE | |
| JP2004187620A (en) | Disorder marker for kidney disease and utilization thereof | |
| CN112143720A (en) | Idiopathic pulmonary fibrosis disease blood diagnosis marker CBR1 and application thereof in preparation of diagnosis or prognosis tool | |
| KR101786309B1 (en) | DIAGNOSIS FOR THYROID CANCER USING CYCLIN D1 b | |
| TWI704349B (en) | Use of protein biomarker for diagnosing kawasaki disease | |
| CN110468201B (en) | Targeted sequencing of ESCC frequent mutant genes and application of targeted sequencing in obtaining biomarker for judging ESCC prognosis | |
| KR102232200B1 (en) | Alzheimer’s disease diagnostic biomarker | |
| WO2020198990A1 (en) | Use of tuberculosis markers in tuberculosis diagnosis and efficacy evaluation | |
| KR102026252B1 (en) | The biomarker for lung Squamous cell carcinoma and Diagnosis method for lung Squamous cell carcinoma using thereof | |
| CN111440859A (en) | Biomarker for human respiratory syncytial virus infection and application | |
| KR20210103212A (en) | Multiple Biomarkers for Lung Cancer Diagnosis and Uses thereof | |
| CN108431029B (en) | Marker for pancreatic cancer and intraductal papillary mucinous tumors | |
| CN106702003B (en) | Application of HSDL1 in diagnosis and treatment of osteosarcoma | |
| KR102387354B1 (en) | Marker for diagnosing Charcot-Marie-Tooth disease and use thereof | |
| US20070298022A1 (en) | Identification of Phospholipase A2 as Target in Cancer Treatment, with Special Emphasis on Colorectal Cancer and Its Mechanism of Action | |
| CN112226506A (en) | Idiopathic pulmonary fibrosis diagnosis marker CCT6A and application thereof in preparation of diagnosis or prognosis tool | |
| EP4317458A1 (en) | Follicular thyroid cancer-specific marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |