CN114574589B - Application of marker ZNF207 in preparation of lung adenocarcinoma diagnostic reagent and diagnostic kit - Google Patents

Abstract

The invention belongs to the field of diagnosis, and particularly relates to application of a marker ZNF207 in preparation of a lung adenocarcinoma diagnostic reagent and a diagnostic kit. In the application, the marker is mRNA or protein expressed by gene ZNF207, so that a new idea can be provided for preparing a lung adenocarcinoma diagnostic reagent, and another index can be provided for the lung adenocarcinoma diagnostic reagent.

Description

Application of marker ZNF207 in preparation of lung adenocarcinoma diagnostic reagent and diagnostic kit

Technical Field

The invention belongs to the field of diagnosis, and particularly relates to application of a marker ZNF207 in preparation of a lung adenocarcinoma diagnostic reagent and a diagnostic kit.

Background

Lung cancer is a clinically common malignancy and is the leading cause of cancer-related death. Lung cancer is divided into Small Cell Lung Cancer (SCLC) and non-small cell lung cancer (NSCLC), with lung adenocarcinoma being the most common subtype of NSCLC. Despite advances in lung cancer treatment, the 5-year survival rate of lung adenocarcinoma is only 14.6%, and there is a need for increased research in lung cancer diagnosis and treatment. Early symptoms of lung adenocarcinoma are not obvious and are easy to ignore, and the symptoms of lung adenocarcinoma are in an advanced stage when the symptoms of lung adenocarcinoma are obvious. The advanced treatment means comprises radiotherapy, chemotherapy, immune checkpoint gene inhibitor treatment, molecular targeted treatment and the like, wherein the molecular targeted treatment is an important treatment means for advanced lung adenocarcinoma. Molecularly targeted drugs have all developed varying degrees of resistance in adenocarcinoma patients. This is due to the heterogeneity of tumors, and even the same tumor may have very different biological properties under different spatial and temporal conditions.

In the prior art, keratin 16 can be used as a marker for the occurrence, development and prognosis of lung adenocarcinoma; vimentin is a substance essential for fibroblast activity leading to tumor cell invasion, and is involved in lung adenocarcinoma metastasis through tumor cell-fibroblast interaction. These have not been able to fully satisfy the needs of current diagnosis and treatment, and based on this, there is a need to develop more molecular targeted drugs for diagnosis of different subtypes of lung adenocarcinoma.

Disclosure of Invention

The application provides an application of a marker ZNF207 in preparation of a lung adenocarcinoma diagnostic reagent and a diagnostic kit, and provides an application of the marker ZNF207 in preparation of the lung adenocarcinoma diagnostic reagent and the diagnostic kit.

In a first aspect, the application provides a use of a marker ZNF207 in preparing a reagent for diagnosing lung adenocarcinoma, wherein the marker is mRNA or protein expressed by a gene ZNF 207.

Optionally, the level of expressed mRNA or protein of ZNF207 gene is positively correlated with the grade of lung adenocarcinoma.

Optionally, the mRNA nucleotide sequence expressed by the gene ZNF207 is shown as SEQ ID No.1, and/or the amino acid sequence of the protein expressed by the gene ZNF207 is shown as SEQ ID No. 2.

Optionally, the mRNA detection means includes high-throughput RNA sequencing, RNA-in situ hybridization, and fluorescent quantitative PCR.

Optionally, the detection means of the protein comprises immunohistochemistry, western blotting and enzyme-linked immunosorbent assay.

Alternatively, the expression level of the mRNA or protein of the gene ZNF207 is inversely related to the survival time and/or survival rate of the lung adenocarcinoma patient.

In a second aspect, the present application provides a diagnostic kit for detecting lung adenocarcinoma, comprising: a primer or a probe for detecting mRNA or protein expressed by the gene ZNF 207; the mRNA nucleotide sequence expressed by the gene ZNF207 is shown as SEQID NO. 1; the amino acid sequence of the protein expressed by the gene ZNF207 is shown as SEQID NO. 2.

Alternatively, the RNA-in situ hybridization probe sequence of the gene ZNF207 is shown as SEQ ID NO. 3.

Optionally, the base sequence of the fluorescent quantitative PCR primer sequence group for detecting the gene ZNF207 is shown as SEQ ID NO. 4-11.

Compared with the prior art, the technical scheme provided by the embodiment of the application has the following advantages:

in the application of the marker ZNF207 in the preparation of the lung adenocarcinoma diagnostic reagent, the lung adenocarcinoma diagnostic marker is mRNA or protein expressed by gene ZNF207, and the mRNA level or protein level expressed by ZNF207 is detected by the diagnostic reagent, so that a new idea can be provided for preparing the lung adenocarcinoma diagnostic reagent, and a further index can be provided for the lung adenocarcinoma diagnostic reagent.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and together with the description, serve to explain the principles of the invention.

In order to more clearly illustrate the embodiments or technical solutions in the prior art of the present invention, the drawings used in the description of the embodiments or prior art will be briefly described below, and it is obvious for those skilled in the art to obtain other drawings without inventive exercise.

FIG. 1 is a schematic flow chart illustrating a method for predicting survival rate after healing according to an embodiment of the present disclosure;

FIG. 2 is a graph showing the expression amount of mRNA of ZNF207 in lung adenocarcinoma cells and normal cells as provided in the examples of the present application;

FIG. 3 is a graph of the mRNA expression levels of ZNF207 cells in four stages of lung adenocarcinoma as provided in the examples herein;

FIG. 4 is a graph of survival for a group A of patients with lung adenocarcinoma provided by the examples of the present application;

FIG. 5 is a graph of survival for group B patients with lung adenocarcinoma, as provided in the examples herein;

FIG. 6 is a graph of survival for group C patients with lung adenocarcinoma, as provided in the examples herein;

FIG. 7 is a graph of the mean survival of group D patients with lung adenocarcinoma, as provided in the examples of the present application;

FIG. 8 is a graph of protein expression of gene ZNF207 in lung adenocarcinoma cells and normal cells;

FIG. 9 is a schematic representation of the relationship between nucleolar genes associated with the gene ZNF207 provided in the examples herein;

FIG. 10 is a schematic diagram of the correlation between non-coding RNA metabolic modification pathway class genes related to a gene ZNF207 provided by the embodiment of the application;

FIG. 11 is a graph showing the expression level of a gene belonging to a non-coding RNA metabolic modification pathway provided in the examples of the present application.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application, and it is obvious that the described embodiments are some embodiments of the present application, but not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application.

Throughout the specification, unless otherwise specifically noted, terms used herein should be understood as having meanings as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a conflict, the present specification will control. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention. For example, the room temperature may be a temperature within a range of 10 to 35 ℃.

Unless otherwise specifically indicated, various raw materials, reagents, instruments, equipment and the like used in the present invention may be commercially available or may be prepared by existing methods.

In order to solve the technical problems, the general idea of the embodiment of the application is as follows:

according to an exemplary embodiment of the present invention, there is provided a use of a marker ZNF207 in the preparation of a reagent for diagnosing lung adenocarcinoma, wherein the marker is mRNA or protein expressed by gene ZNF 207.

Specifically, the lung adenocarcinoma diagnostic agent includes, but is not limited to: a diagnostic reagent for diagnosing whether the patient to be tested has lung adenocarcinoma or not, or a diagnostic reagent for diagnosing the degree of the lung adenocarcinoma or the grade of the lung adenocarcinoma of the patient to be tested; when the lung adenocarcinoma diagnostic reagent is prepared, the reagent for detecting mRNA or protein expressed by the gene ZNF207 is prepared, and the expression level of the gene ZNF207 is detected, so that the grade of the lung adenocarcinoma can be judged, a group of new diagnostic markers are provided for the diagnosis of the lung adenocarcinoma, the reference amount during detection is enriched, and the effect of early detection and early treatment can be realized. The level of mRNA or protein expressed by the gene ZNF207 is increased, so that a new idea can be provided for preparing a lung adenocarcinoma diagnostic reagent, and a further index can be provided for the lung adenocarcinoma diagnostic reagent.

Specifically, ZNF207 mRNA expression data in lung adenocarcinoma cells and normal lung tissue, as shown in fig. 2, collected mRNA expression levels of ZNF207 in 482 patients with lung adenocarcinoma and 347 healthy persons, with the ordinate being the mRNA expression level of ZNF207, and lung adenocarcinoma mixed with the normalized value TPM ranging from 5 to 8, with the average value being about 6.6; in normal tissues, the value of a standardized value TPM is between 5.5 and 7, and the average value is about 6.1; the amount was significantly higher in lung adenocarcinoma (LUAD tumor) than in common tissue (tumor normal) (P < 0.05).

Conventionally, the expression levels of ZNF207 genes of different individuals have certain difference in the expression levels of common lung tissues and lung adenocarcinoma cells, but certain intervals exist in the common lung tissues and the lung adenocarcinoma cells; when judging whether the ZNF207 gene can be used as a lung cancer diagnosis index, the ZNF207 gene expression quantity is compared with the suspected diseased part of a lung adenocarcinoma patient and the normal lung tissue around the patient.

Through clinical practice, the amount of protein expressed by ZNF207 gene is compared between the suspected diseased part of a lung adenocarcinoma patient and the normal lung tissue around the suspected diseased part of the lung adenocarcinoma patient, the detection value of the protein is far higher than that of the normal tissue, and the suspected diseased part is judged to be the lung adenocarcinoma tissue actually through analysis of other detection indexes, as shown in fig. 8, the suspected diseased part is an immunohistochemical picture, wherein the black part in the picture is hematoxylin-stained cell nucleus, the original picture is purple, and the brown part in the original picture is a protein signal. The left graph is lung adenocarcinoma tissue of a diseased part, the detection value of protein is high, the dark black part is more and is far higher than the normal value of the same tissue, and the right graph is normal lung tissue, and the detection value of protein is normal.

In some embodiments, the level of expressed mRNA or protein of the gene ZNF207 is positively correlated with the level of lung adenocarcinoma.

Specifically, the expression level of the gene ZNF207 is higher and higher, the lung adenocarcinoma level is improved, and the gene ZNF207 and the lung adenocarcinoma level have positive correlation; of the four stages of lung adenocarcinoma, stage 1 is the initial stage of lung adenocarcinoma, stage 4 is the most severe stage of lung adenocarcinoma, and the later stage, the higher the expression level of ZNF207, as shown in fig. 3, the abscissa indicates the first stage, the second stage, the third stage and the fourth stage of lung adenocarcinoma from left to right, and the ordinate indicates the relative expression level of ZNF 207. An F-test was performed on four groups of data, with an F value of 3.38 and greater than 1, and Pr (> F) =0.0181 and less than 0.05, indicating that there was a statistically significant difference between each group in the four stages of lung adenocarcinoma progression, and that there was a statistical difference in ZNF207 expression level between the four groups as lung adenocarcinoma progression increased.

In some embodiments, the mRNA nucleotide sequence expressed by the gene ZNF207 is shown as SEQ ID No.1, and/or the amino acid sequence of the protein expressed by the gene ZNF207 is shown as SEQ ID No. 2.

In some embodiments, the mRNA detection means includes high-throughput RNA sequencing, RNA-in situ hybridization, and fluorescent quantitative PCR.

In some embodiments, the detection format for the protein includes immunohistochemistry, western blotting, and enzyme-linked immunosorbent assay.

Specifically, the protein expression amount of ZNF207 in lung adenocarcinoma cells and normal cells is shown in fig. 8, the left graph is the protein amount of ZNF207 expressed in lung adenocarcinoma cells, and the right graph is the protein amount of ZNF207 expressed in normal cells, and it can be seen from the right graph that cancer cells in lung adenocarcinoma tissues express ZNF207 at a high level in the left graph, and normal lung tissues ZNF207 are significantly weaker than cancer tissues in the right graph, indicating that the expression amount of ZNF207 is increased in the process of lung adenocarcinoma occurrence.

In some embodiments, the gene ZNF207 is used for predicting the survival time of a lung adenocarcinoma patient, and the expression amount of mRNA or protein of the gene ZNF207 is inversely related to the survival time and/or survival rate of the lung adenocarcinoma patient.

According to another exemplary embodiment of the present invention, there is provided a diagnostic kit for detecting lung adenocarcinoma, the diagnostic kit comprising: a primer or a probe for detecting mRNA or protein expressed by the gene ZNF 207; the mRNA nucleotide sequence expressed by the gene ZNF207 is shown as SEQID NO. 1; the amino acid sequence of the protein expressed by the gene ZNF207 is shown as SEQID NO. 2.

Specifically, diagnostic kits include, but are not limited to: a diagnostic kit for diagnosing whether the patient to be detected has lung adenocarcinoma or not, or a diagnostic kit for diagnosing the degree of the lung adenocarcinoma or the grade of the lung adenocarcinoma of the patient to be detected; the detection of the nucleotide sequence of the mRNA expressed by the gene ZNF207 or the amino acid sequence of the expressed protein by the primers or probes of the present application provides yet another viable diagnostic means. The mRNA nucleotide sequence expressed by the gene ZNF207 is shown as SEQID NO.1, wherein the coding region sequence (CDS) is from 130 th nucleotide to 1566 th nucleotide.

ZNF207 mechanistic analysis: the protein expressed by ZNF207 is a binding protein of cell cycle check protein BUB 3. The lung adenocarcinoma patients are divided into groups according to ZNF207 expression quantity, and the high expression group is compared with the low expression group to find out genes with differential expression, which are potential downstream genes of ZNF 207. Performing interaction analysis on the obtained downstream genes by using STRING and clustering analysis on the gene functions by using DAVID GO, wherein as shown in FIG. 9, the expression of the gene ZNF207 is closely related to downstream related genes, and in the figure, the abscissa shows significance, and when the quantity of the histogram is more, the functional genes related to the histogram is more compact; the ordinate is RNA binding genes, gene expression genes, nucleotide metabolism modification pathway genes, non-coding RNA metabolism modification pathway genes and tRNA metabolism modification pathway genes, wherein the RNA binding genes, the gene expression genes, the nucleotide metabolism modification pathway genes and the non-coding RNA metabolism modification pathway genes are closely related to the ZNF207 gene, and when the ZNF207 is highly expressed, a large number of kernel-related genes are differentially expressed (as shown in FIG. 10, dark spheres each represent a gene/protein), which suggests that the regulation of kernel-related functions may be a new mechanism for the ZNF207 to regulate the progress of lung adenocarcinoma; functional clustering was performed according to the cellular processes in which the genes are involved, and it was found that the downstream gene of ZNF207 is involved in gene regulation of non-coding RNA metabolic modification pathway (e.g. dark black sphere gene in fig. 10), and by quantifying the expression of the genes in fig. 10, as shown in fig. 11, most of the genes were found to be involved in tRNA synthesis and modification, tRNA is mainly involved in protein translation, and ZNF207 regulates tRNA synthesis, suggesting that ZNF207 regulates lung adenocarcinoma progression by being involved in tRNA synthesis and maturation, in addition to the previously found function involved in spindle assembly.

In the method, the expression level of the gene ZNF207 can be confirmed by detecting the quantity of the mRNA nucleotide sequence shown as SEQID NO.1 or the quantity of the amino acid sequence of the protein shown as SEQID NO.2, and finally the detection is carried out by the lung adenocarcinoma diagnostic reagent.

In some embodiments, the RNA-in situ hybridization probe sequence for the gene ZNF207 is shown as SEQ ID No. 3.

The RNA-in situ hybridization probe sequence can accurately detect the content of the mRNA nucleotide sequence expressed by the gene ZNF 207.

In some embodiments, the base sequences of the fluorescent quantitative PCR primer sequence set for detecting the gene ZNF207 are shown as SEQ ID nos. 4 to 11.

The length of the obtained product is 221, the base sequence of Forward primer 1 is TGGAATGATGCCACCTGGAC, and the sequence of the mRNA nucleotide sequence 744-763 segment is used as a template; the base sequence of Reverse primer 1 is CCTGAGCCTGTCCAGCAC, and the sequence of the mRNA nucleotide sequence 964-947 segment is used as a template; fluorescent quantitation of the second set of PCR primer sequences, resulting in a product length = 180, Forward primer 1: CAGTGCTGGACAGGCTCAG, using the sequence of the mRNA nucleotide sequence 945 and 963 as the template; reverse primer 1: ATTGAAGCCGCTGGTTTAGC, using the sequence of the mRNA nucleotide sequence 1124-1105 as the template; a third set of fluorescent quantitative PCR primer sequences, resulting in a product length = 178, Forward primer 1: CAGTGCTGGACAGGCTCAG, using the sequence of the mRNA nucleotide sequence 945 and 963 as the template; reverse primer 1: TGAAGCCGCTGGTTTAGCTG, using the sequence of mRNA nucleotide sequence 1122-1103 section as the template; fluorescence quantitative PCR primer sequence for the fourth set, resulting in product length = 227, Forward primer 1: TGGAATGATGCCACCTGGAC, using the sequence of the mRNA nucleotide sequence 744-763 segment as the template; reverse primer 1: CAGCTGCCTGAGCCTGTC, using the sequence of the mRNA nucleotide sequence 970-953 segment as the template.

A method for predicting survival after healing using a diagnostic kit of the present application, said method comprising the steps of:

s1, obtaining lung tissues of a plurality of lung adenocarcinoma patients;

s2, detecting and obtaining a first expression quantity of the gene ZNF207 expression in the lung tissue by using the kit, and obtaining an expression quantity library of a plurality of lung adenocarcinoma patients;

s3, obtaining survival time of a plurality of lung adenocarcinoma patients, wherein the survival time is calculated from the detection time;

s4, obtaining a second expression quantity of the gene ZNF207 expression of a patient with lung adenocarcinoma to be prognosed, wherein the second expression quantity and the first expression quantity respectively comprise at least one of the following: mRNA and protein, and the second expression amount and the first expression amount correspond to each other;

and S5, predicting the survival rate and survival time range of the lung adenocarcinoma patient to be prognosed according to the expression amount library, the survival time and the second expression amount.

Specifically, the gene ZNF207 has high expression of mRNA or protein, so that the prognosis of the patient with lung adenocarcinoma is poor, and can be used as an index for judging the prognosis of the patient.

In a whole, after obtaining an expression database through S2, the survival situation of ZNF207 high expression group patients is obviously inferior to that of low expression group, 482 patients with lung adenocarcinoma are detected to obtain a data set A, the first 30% and the later 30% of the expression are selected as A group, the first 40% and the later 40% of the expression are selected as B group, the first 50% and the later 50% of the expression are selected as C group, and the survival time and survival rate are analyzed and quantified; and then obtaining a second expression quantity of the gene ZNF207 expression of the lung adenocarcinoma patient to be prognosed, and proving that the first expression quantity of the gene ZNF207 expression is directly related to survival time and survival rate respectively through the three groups of data.

The survival condition of the lung adenocarcinoma patients in the group A is shown in figure 4, the abscissa is survival time, and the ordinate is survival rate, and the graph shows that the survival condition of 30% after the expression amount is obviously better than that of 30% before the expression amount, the survival time is longer, and the survival rate is higher. P =0.02, this curve is apparent to be significant and can be used for prognosis, i.e. to predict survival time and survival rate.

The survival condition of the lung adenocarcinoma patients in the group B is shown in figure 5, the abscissa represents survival time, and the ordinate represents survival rate, and the figure shows that the survival condition of 40% after the expression amount is obviously better than that of 40% before the expression amount, the survival time is longer, and the survival rate is higher. P =0.024, which is apparent to be significant and can be used for prognosis.

The survival condition of the lung adenocarcinoma patients in the group C is shown in figure 6, the abscissa represents survival time, and the ordinate represents survival rate, and the figure shows that the survival condition of 50% after the expression amount is obviously better than that of the first 50% of the expression amount, the survival time is longer, and the survival rate is higher. P =0.018, which is apparent to be significant and can be used for prognosis.

In addition, if the value of the normalized value TPM of the gene ZNF207 expression mRNA of the lung adenocarcinoma patients to be prognosed is 7.1, and the expression level thereof falls in the first 50% group, the survival time thereof is predicted to belong to the high expression group with the mean survival time of 23 months by FIG. 7, 347 patients suffering from lung adenocarcinoma were tested by the method of the present application among the lung adenocarcinoma patients based on the same treatment conditions, and the survival rate thereof was predicted as shown in FIG. 7. As can be seen from FIG. 7, by dividing the mRNA expression amount of the gene ZNF207 into 2 groups, the group with the higher expression amount of 50% is the high expression group, and the group with the lower expression amount of 50% is the low expression group, the abscissa is survival time, and the ordinate is survival rate, it can be seen from the figure that the survival condition of 50% after the expression amount is obviously better than that of 50% before the expression amount, the survival time is longer, and the survival rate is higher. P =7.3 × 10 ^-5 The curve is shown to be significant and can be used for prognosis, the average survival time of the low expression group is 44.83 months, the average survival time of the high expression group is 23 months, and the specific survival number is shown in table 1.

Table 1 survival numbers for high and low expression sets in figure 7.

Item	Initial state	50 months old	100 months old	150 months old	200 months old
						Number of surviving in high expression group	360	181	13	1	0
Number of surviving in underexpression group	359	166	56	18	1

The process of the present invention will be described in detail below with reference to examples, comparative examples and experimental data.

Example 1

Detecting the amount of mRNA

The experimental process using fluorescence in situ hybridization was as follows:

1. reagent for fluorescence in situ hybridization detection

Preparation of 10-fold PBS stock: 40 g of sodium chloride, 1g of KCl and 4g of Na ₂ HPO ₄ 、1.2g KH ₂ PO ₄ Adding 500mL of distilled water, and adjusting the pH value to 7.2;

1-time preparation of PBS working solution: 50mL of 10-fold PBS to 450mL of deionized water were taken.

Preparation of maleic acid buffer: at 12.5mL H ₂ Adding 2g of maleic acid into the O, and diluting to 20 ml; 6mL of 5M sodium chloride was added, and water was added to make 200 mL.

Preparation of blocking agent (10%): the pH was adjusted to 7 in 100mL of maleic acid buffer, and 10g of blocking agent was added to dissolve the mixture.

Preparation of 10-fold TBS mother liquor: 17.532g of sodium chloride, 200mL of 1M Tris solution, 450mL of deionized water and 0.08% of Tween.

The preparation formula of 4% formaldehyde comprises: 47.2mL of 37% formaldehyde and 352.8mL of PBS (1 fold).

Preparation of formamide washing solution: 0.4g bovine serum albumin was dissolved in 112mL deionized water, then 4mL 1M tris was added and finally 280 mL formamide was added; when in use, the mixture is washed for 15 minutes in a formamide washing solution and washed for 2 times.

Preparing a probe hybridization solution: 67.2uL deionized water, 5uL 1M Tris (pH 7.2), 42.8uL magnesium chloride, 350uL deionized formamide, 25uL sealant and 10uL RNA-in situ hybridization probe (the sequence is shown as SEQ ID NO.3, 10.44nmol and about 10 nmol), the pH value is adjusted to 7.0, and finally, a proper amount of water is added to obtain a probe hybridization solution.

2. Slice pretreatment

Preparing slices, and baking the continuous slices prepared from the lung adenocarcinoma tissues in an oven at 80.5 ℃ for 1-2 hours.

Washing was carried out for 15 minutes in a formamide washing solution, and washing was carried out 2 times.

3. Digestion with digestive enzymes

The sections were washed 3 times for 5 minutes in PBS and digested with pepsin solution for 1-2 minutes in a water bath.

4. Wash in PBS for 5 minutes; fixation in 4% formaldehyde/PBS for 2 min; wash in PBS for 5 min 3 times

5. Gradient alcohol dehydration: dehydrating in 70% -90% -100% ethanol for 5 min, and air drying for 15-20 min.

6. Probe hybridization and incubation

100mL of MgCl-containing solution ₂ 25mL of a magnesium chloride solution, 9mM of a citric acid solution, and 82mM of Na ₂ HPO ₄ Mixing, adjusting pH to 7.0, and adding water; add 10uL per probe hybridization solution on 22x50 coverslips; the sections were removed and placed on cover slips. Denaturation at 85 ℃ for 3 min and incubation in a 37 ℃ wet chamber for 2 h.

Then, the sections were washed in TBS with 0.08% tween for 5 minutes, 3 times; performing gradient dehydration in 70% -90% -100% ethanol for 5 min each time; after air drying, 4 drops of the anti-fluorescence quencher and 1 drop of DAPI were added to a 1.5mL tube, mixed well and then smeared onto each 22x40 cap. The slide is covered with the slide surface facing downwards, and the slide is lightly pressed to observe whether bubbles exist or not; sealed with clear nail polish and incubated overnight at 4 ℃ in the dark.

7. Analysis of results

Detection by fluorescence in situ hybridization: and (5) photographing, and calculating the relative content of RNA according to the fluorescence intensity under the same exposure condition.

Example 2

Detection of proteins by immunohistochemistry

The paraffin-embedded tissue was cut into sections of 4 μm thickness. Antigen retrieval was performed by boiling the sample in 0.01M citric acid solution (pH = 6) for 10 minutes, followed by natural cooling. Slides were blocked with 3% hydrogen peroxide solution and 5% goat serum for 1 hour at 37 ℃. The antibody was diluted 1:1000 and the slides were incubated overnight at 4 ℃. The sections were then incubated with secondary antibodies and peroxidase reaction was performed using diaminobenzidine tetrachloride (DAB). Quantitative analysis was performed based on the brown signal after color development, as shown in FIG. 8.

Example 3

Fluorescent quantitative PCR (Q-PCR) for mRNA detection

Extracting tissue RNA according to a conventional method, carrying out reverse transcription to obtain cDNA, and carrying out Q-PCR, wherein a reaction system and reaction conditions are as follows: taking 20 muL as an example, 10 muL of SYBR Green Q-PCR enzyme working solution, 1-5 muL of template, 1 muL of upstream primer, 1 muL of downstream primer, 0.4 muL of ROX Reference Dye and deionized water are added to 20 muL. Conventional, 1 μ g RNA reverse transcription product was used 10-fold diluted, typically 1 μ L in a 20 μ L QPCR system. The QPCR procedure may be performed at an anneal and extension temperature of 65 deg.C for a period of 15-60 sec. The upstream and downstream primers are fluorescence quantitative PCR primer sequence groups, and the base sequence is shown as SEQ ID NO. 4-11.

It is noted that, in this document, relational terms such as "first" and "second," and the like, may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Also, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising an … …" does not exclude the presence of other identical elements in a process, method, article, or apparatus that comprises the element.

The foregoing are merely exemplary embodiments of the present invention, which enable those skilled in the art to understand or practice the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Shenzhen second people's hospital (Shenzhen conversion medical research institute)

Application of <120> marker ZNF207 in preparation of lung adenocarcinoma diagnostic reagent and diagnostic kit

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 13692

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtcggccatt ttgtgtctgc ttcctgtggg acgtggtggt agccgttggg ttgggaaagt 60

gagggatttt tggcctcgtt tctcctgctt cttttctcct cccttttact ttgccggtag 120

aacacagtta tgggtcgcaa gaagaagaag cagctgaagc cgtggtgctg gtattgtaat 180

agagattttg atgatgagaa gatccttatt cagcaccaaa aagcaaagca ttttaaatgc 240

catatatgtc acaagaaatt gtatacagga cctggcttag ctattcattg catgcaggta 300

cataaagaaa caatagatgc cgtaccaaat gcaatacctg gaagaacaga catagagttg 360

gaaatatatg gtatggaagg tattccagaa aaagacatgg atgaaagacg acgacttctt 420

gaacagaaaa cacaagaaag tcaaaaaaag aagcaacaag atgattctga tgaatatgat 480

gatgacgact ctgcagcctc aacttcattt cagccacagc ctgttcaacc tcagcaaggt 540

tatattcctc caatggcaca gccaggactg ccaccagtac caggagcacc aggaatgcct 600

ccaggcatac ctccattaat gccaggtgtt cctcctctga tgccaggaat gccaccagtt 660

atgccaggca tgccacctgg aatgatgcca atgggtggaa tgatgccacc tggaccagga 720

ataccacctc tgatgcctgg aatgccacca ggtatgcccc cacctgttcc acgtcctgga 780

attcctccaa tgactcaagc acaggctgtt tcagcgccag gtattcttaa tagaccacct 840

gcaccaacag caactgtacc tgccccacag cctccagtta ctaagcctct tttccccagt 900

gctggacaga tggggacacc tgtcacaagc tcaagtacag cttcatccaa ttcagaaagt 960

ctgtctgcat cttctaaagc tctgtttcct agcacagcac aagctcaggc agctgtccaa 1020

ggacctgttg gtacagattt caaaccctta aatagtaccc ctgcaacaac tacagaaccc 1080

ccaaagccta cattccctgc ttatacacag tctacagctt caacaactag tacaacaaat 1140

agtactgcag ctaaaccagc ggcttcaata acaagtaagc ctgctacact tacaacaact 1200

agtgcaacca gtaagttgat ccatccagat gaggatatat ccctggaaga gagaagggca 1260

cagttaccta agtatcaacg taatcttcct cggccaggac aggcccccat cggtaatcca 1320

ccagttggac caattggagg tatgatgcca ccacagccag gcatcccaca gcaacaagga 1380

atgagacccc caatgccacc tcatggtcag tatggtggtc atcatcaagg catgccagga 1440

taccttcctg gtgctatgcc cccgtatggg cagggaccgc caatggtgcc cccttaccag 1500

ggtgggcctc ctcgacctcc gatgggaatg agacctcctg taatgtcgca aggtggccgt 1560

tactgatctt acttcatcca gtctaatagg tttggagatt aaaccttttc tcaacttgtg 1620

ctgtttatat agccaagctt ccgtcaataa ggcttcattg tgactttaac aaacattatc 1680

ttcccacata ccaggaacta ttggacattt attttacatg ggaaaaatta tttggaataa 1740

taaagcagga acttttcctg aagttgcaat ttatactgta tggcttcttt ttcatgtttc 1800

atctaggttt ttagaagtga agtatagtaa atttggttcg ttaaattgtg aaggcgctgg 1860

aattacatga acataccacc ctagtaaagg caagttctgt aagcttacat tgctatttgt 1920

aaagtttgcc ttcacagcat ttcagatgct gttggacttc atgtccccaa cctagcttgg 1980

tgagggctgt aactgtttcc aagtacttgt acattggaag tctgaatgtg taacaatatt 2040

taatgtattt agagttcctc atgttgcagg gtttaagaaa tctgacccac caaggtcatg 2100

tgacttttct gtactgttaa acttcattgt aataaaatga gagaaaaatt tatgcctttt 2160

tattcataac ccagctgtgg accactgcct gaaaggtttg tacagatgca tgccacagta 2220

gatgtccaca taataaaatt catagttacc aatgcagttt tgatatatca ttggattctg 2280

tctttgagtt gtaggttatt tcttagctgc atgttttaaa ctgaatttgc atagagttgt 2340

atgttaatgt ttcagttaag agaaaaactt aagatacatg agtcattaca taatgggtat 2400

gaaatcttta taatcaccct tccaccctct atggtgtcag tacacatcac gtgtcataga 2460

tacttaaaat gtaaatgtta acacttttcc ttcctgctga gatgtttaga gcctagtgcc 2520

agacccattc atttcctttt gattattttt gagactcagt actgcatgga cctcagaagc 2580

ttttcaggtg caaacttcta gaagcttagg tgcatgcagt aatagcttct tgtgctgtta 2640

atgggttatt atatattatt ctaagtgtaa tgctgagaat ctaaatgtgt ctctgttggg 2700

atggttaaca gatgaattgg caatttttat tatgttcctg gaagattaca ttattcattt 2760

gagtaccttc tgttattaag cctaggtagc cttactgtgc aactttttat ttatccttgg 2820

aaattttgaa tgttgtgttc ttacagagag cttttctgta gagatgactg ctattcaata 2880

ttttgtgttg caacctctta aaataatagc tcttgttgac ctttttggga tctgtttttc 2940

tgatcttttg cagggtagtt ttatgatttt ttaggcatca aataacctat gcaaagtatt 3000

aatataatga actcaagttg agtttttctc attataaagt taagacttct aagaaaatgg 3060

taacatttct ttataacttt cctgtgaagg tatagataaa acacatgaag tctgaagttg 3120

tatggaaaaa agggctttaa ctttgaagga aaatatattg aaaagtgatt tagccatcac 3180

aaaagagttc gtatttatgt gacagatgaa agtcatacct ttaagcaaaa cattgcaagt 3240

attataaagc tgaatgctat tttaactcac attggctggg tgcagtggct cacgcctgta 3300

atcccagccc tctggaaggc tgagatggga ggattgcttg agtccaggag tttgagacca 3360

gcctggccaa catggcaaaa ccccatctgt acaaaacatt taaaaattag ccaggcgcgt 3420

tagtgtgtgt ctgtggtccc agctgctcaa gaggctgagg aaggaggttc ttcctccttc 3480

cgaggctgcg gtgagctatg ttcactccag cctgggcaac agagcgagac tctgtcaaaa 3540

aataaattaa aatatctgat tatctggctt caatgatttt ggctcctgtg cttgtggtac 3600

catagtggta caaaaatttt catagtttga aaataaaaca ggtattttgc cagtaatgta 3660

tttctttctg ccagcagcca agtcccaaac cactttcccc tctgaacctc tgcttaccta 3720

aatggtttca aaattaatac atgctgcttt gatttggcag cacacttaat atactgctga 3780

aggaaaactt gtgttgaaag tctttaagat aaaaatggtg tgataggccg ggcgcagtgg 3840

ctcacgcctg taatcccagc actttgggag gcccaggcgg gtggatcatg aggtcaggag 3900

atggagacca tcctggctaa cacggtgaaa ccccgtttct actaaaaata caaaaaatta 3960

gctgggcgta gttgcggatg cctgtagtcc caactactct ggagaccgag gcaggagaat 4020

ggcgtgaacc cgggaggcat agcttgcagt gagcggagat cacaccactg cactctagcc 4080

tggacgacag attgagactc cgtctcaaaa aaaaaaaatg ctgtgattaa atttagaata 4140

attaagtaag gggtgctctc ccaaattctc aggaatttca tgtatacggt tattgacaaa 4200

ctgcaatagg gttagtagac ctgtttcaga aattatgtga agctttattt gcattttatg 4260

caaagaaggt tgatactttg tagcaaggtt ttttgctctc tgtataggtc tgatgggcaa 4320

aaatggaact tttaaatatg ggatagaatt ctaattaaaa attaattgaa agtgttaggc 4380

attggcagat aaaacttaag ctcatgagtt cctgagtttg tagctatagg ctcagaggtg 4440

gtgtacccat ttaatatatt tgaagtgtaa tttttgcatg catccaaacg taattaagct 4500

tctagaaaat accttttttc taaatgcttc tggggtccat agtgtggttg aattatgagt 4560

ggagcaaatt atattcatat aattaactct gactcaacct tccttaagta gtagatgaag 4620

ttgagtcaaa gtggatgcca actgccctca cagaagacaa cttttgggac ttgataattc 4680

aggcaggcat tgtgattgtc ataattaagg aagctgtaag gttagtaggg ctggcaactt 4740

tggctctacc ttacatccac cccttttaga aaaacaagaa aacattttgt ctggcactag 4800

tttctgttgt ataagttttc atactgttta acaagaccac agcaggtaag gattaatttt 4860

tgagtggctg ctggaattac ttgatttgaa tacttagtat tttagtagtg tctcacacat 4920

ttgccattag gtatgaataa aatattccta ctgtactcct attccactaa gttacatttt 4980

gaacttagac tcaccttaat taaacttaat taattgggga gggggattcc ccaacaaaaa 5040

gaagtacggg ctcagagtgg aattgtagtg gacaatagtt aaaaacaaag ctgctccttt 5100

tgcttgcttg atcattggga tttttaaaaa aaaaaatttt aatgcatgtc ttttaaatta 5160

attgggaact gtttttctaa aattaaaatt ttcttcttcc tatagccctg ccataggaca 5220

ggctgaggct gagtctcagt gttgccctgt tcagtctgag gcaagtggga tttattttat 5280

tccttatagg ggctttcaca gctttatggc tgttggatat ttatgtcccc aaacttgcag 5340

caagtttggt gaaggcccct aaatttaatt aaacttagga tttttatact cttttggcag 5400

agaaggctct atattaatat tcacgtttga ctgtggtgtt aataaacata agtatttcat 5460

atgcaatttt atgtaatttg ctgtgtgtta cataattaac agcttcagta aagcttgtgt 5520

tcctatattg aacttcaata aattgacaaa atttgatatt tttgattgga ggcaagaaat 5580

gtttcattca agttttttac tttcacttct aggaaaatct tactggtttt attttctcca 5640

taaactatta aatttaacct caaggataag tttaatcatt ggaaatgcca ctggatactg 5700

aaatgtgcct tctctttttt gagacggagt ttcactctta tcacccagga tggagtgcag 5760

tggtgcgatc tcggttcact gcaacctctg cctcccggat tcaagtgatt ctcctgcctc 5820

agcctcccga gtagctggga ttataggctc ccgccaccac atctggctat tttttcaata 5880

tttttcagta gggatggggt tttgccgtgt tggccaggct ggtctcaaac tcctgacctc 5940

aggtgatcca cccatctcag cctcccagag tgctggagta gcaggtgtga gccaccgcgc 6000

ctggccaaaa tctgcattct tttttttttt tttttttttt ttttgagact gtctcgctgt 6060

gtcacccagg ccagagtgca gtagcacgat ctcagctcac tacaacctcc acctcctgga 6120

ttcaagcgat tctcctgtct cagcctcccg agtagctggg actacaggtg cttgccacca 6180

cacccggcta attttttgta tttttagtag agacggggtt tcaccgtgtt agccaggatg 6240

gtctcgatct cctgactttg cgatccccct gcctcggcct cccaaagtgc tgggattaca 6300

ggcgtgggcc accgcgcttg gccaaaatct gcattcttaa tcacaaactt acgcattgaa 6360

tgttaaggct aaaaggtcat ctggaaatgc ttaattttaa aatattttca agcctcacca 6420

cattagagca aatgttaatg tagagccctg taaaggtggg aaggtggtgt ctatgtgtgt 6480

gcttgtgtat gtgggggtat agaccatata gttgatataa caacagaatt tgggtgttac 6540

agacctttca gcatggatgg attactaatt ttcaggtatc gaaactgaaa tttgatacct 6600

gatcctgtgg taaagtatgt taaactatgg ttttggagtg attattttga ggttcatttt 6660

cagcctcact gaacagtgtt ttacgcacat gtgaaaagta tccacatttg tttccaacta 6720

aaatttgctt ttatttggtg agaaaagttg tgtgcgtgtg tttgttgtag ggaataatta 6780

gggaattgga agagaggcca aaaacaaacc tgaattactt ttgtttcttg tgtttgagcc 6840

acgattctat ccagatagca gtttactctg agcagtaaca atgaacaagc agtatagcat 6900

ttagcaaacc tggaattgtt tgtatatggt tttcattctt ggaagcataa agaaaaaata 6960

tgcattaaat gaattgtaaa ttttgacttg ttaaataaca tgtttttcac tataactaat 7020

aggattttaa tatttaaaga attttgttgc ttccatgaca aaatatccca ttggactatt 7080

ttataacctc agtaatcaac atttaagagt ccttaattgg agatctgttt tctctattac 7140

ctaccatcct gcaatatgct gaaatctttc taagttgctt atcttaattc taatggtgat 7200

aattgaaaaa agtgtgctgg aaatacaggc tcttatctgg ttgagtactg ggggtgggaa 7260

ggatttagta atgtcataat ctgttgaagg taatatctat agataactaa gatagttcct 7320

ttttttttgt agttctgtga ctcagacaaa taagattttg agaattatgt agtttttagg 7380

tgtctgtaac atccactagt aaaacttggc aaatgaaaga aaattgtgaa gtcaccactt 7440

taactgagtc aaaattttgt ttgaataagc tgatgaaaat agacatgtac cctagaagta 7500

gatactctaa aattatacag acatgaatgt cttttttaaa aggttgtcat tattgaccta 7560

atattgagta atctttctgc gttattccaa attgaaattt gtttgctctt cattgtaact 7620

tttatgtaaa agtcctttaa aaggggattc aattataagg ctatttgact atagggcaga 7680

tttttataag taaacattcc cccaattcca cttatgctaa ctgtctcatg acagtaaagt 7740

ttactccttt ttagaaaccc tttctcagta ttttaatttc tgtcattgaa tcatttaaat 7800

aataaccttt tgtttttata gcaaagaaat catctgactt ttctgtgtga tgtttcttgg 7860

caaaataagc acttgatgta tggtcatgta cataatggat attcattaat tttgtgatta 7920

gtgctgagtt ttctaaacta ctatcttaag ctcttaggca ccctattatg gatctaattc 7980

aaaccaatat gtaggaaatg gagaaagtag gacttcagtt tgcgcttccc aataacttta 8040

aatatatcca ccttttccaa gtgtttaagc cctaaaacat ctatctttat ttttttacct 8100

ggcatttttg ttagaaaata gattacgttt taaagtaaca ttaaaaaaat tcttcagtaa 8160

gataattgct tttaataagt atatttttct tgctcttggc tctatacatt tttgcataat 8220

attttagtct tgaaaagctt ttcattttct taactctgga aaataatagt ttggaactaa 8280

attagtttga gaaatctgaa tcatctctct ttaaatctgt tcagttagtc tcatgtattc 8340

tcaggggaaa atgtctttat tttactaagc ggaagtagta gtcatattga ggcagaaatt 8400

tgtagcccaa acaaggtagg tcttcgctga aactaatttg aactattcct atttgaagca 8460

aattgaacac tattataaat ctagactggc taattagatg gaaactttga tggttaggtt 8520

ctttaagagg catacaatcc gttatgagaa tgtttatgtt tatgttttaa tttttatcaa 8580

aataacctca gaggaggtac atgtgagtaa actgtcttaa tggttgatta cttggaaccc 8640

acccattaat tctaaatgat gtaatggtct ataaggtagt aatctggcac agcttcagta 8700

atgtgtgctg tgtttgtaaa aaggtgaagt actttattgg cattttctaa gccctctgac 8760

attgttagtg tctgggttgg ttggtttgca ttttactatt atggtggaat ctgtgttcct 8820

tcaccattgg ttaagtctga ggaactaaca gtgaaattca ttgatggcca acttggataa 8880

aaatgaagaa tgatattttc ccagtttact acacatggac caatagtgat tatttgggag 8940

agaacactgg gtagtattgt ttgacttaag aaccttaaat atattgaaaa gtaatggcat 9000

tcttgctcat gatttgcatt tgttagtgag gtctcaccat agtattttaa tgtagcttct 9060

tattaaaatt ttattcataa atagtttagc agtcacagag gtgaaaaaaa aaagatttgc 9120

accatcatat ccgagtcttt actaataaaa tgaggctgct taagtaccca agtggagcaa 9180

gggaagagtt actacagtta ctgtaagtct gagttagaaa aaatacagag catctagtta 9240

ttgagcaaag ccccctttta cctgttcgct tattcaaaga gaaacaatag aatttgcttc 9300

tcagtacatg tttttaaaat tgagaatctc tgatgtgaca aaatcaattt ttacaaaagt 9360

tgaattaaaa acttttaaaa attgcttgtc tttgggggta tgtctacata ttcgtttaaa 9420

tttagaaatt cccacatgtt taagatatat gcccatcccc tttttagagt aatcaaaatt 9480

tctatcacag ttcacatact ggaatacata gtaaaattga gatgtgtcca agagattttc 9540

aatgttaatt agctcattct aaatagccaa tataaggtaa cttctgttta aaaaaaaaaa 9600

aaactaggga aaagttttaa atgtattagt atcaggctct gaggaaattt aatgcacatt 9660

gactttttaa actatggatt gaactcctca gtttaataca atttgtgttt ttgttaacta 9720

gcagcagaat ttcagcattt gctacttact ggtagagaag aaaaatccca cagccctgcc 9780

agtacaggtt agtttaatct gtaagtacct gatgttccta tttttttcaa acatatccat 9840

ataactcaca caaggaagaa agctgtgcgg ttacttaaat gttagtataa ctaataatag 9900

atccattgga cactttaaac actcagtact tgggccaaag tagatctagg tttgctaacc 9960

ccagttgtaa taaaggtgta atactgctcc tttgttatct ccttgtggtt caacctaagt 10020

agatacattg tacataaaag gaaaagacag tttcagttgg ctatgccctt gttgatagat 10080

gatatggagt ccagggcttt gggtccaggg tcttttactt aagctatttc atggtggttc 10140

tctcattcac cttttaactt tttacattat gaatcaacct aagaaaaaag gcaagtttcc 10200

tcacatctag aaatgataaa tggtgtacag tcataagcta gaatatgttt ttataatgct 10260

tttttgttct tttagcaaca cttgtaaata caagtactcc tctatttttg ttcttttttt 10320

gtaaactata acgtatcccg ttggtgtacc agtgagttca ttttactgta aactaagaat 10380

aacatacctt tttaatactg aaagttgact actcatcaag aaatgtagct agattcttta 10440

tgtaacactt ttgaggggca gtggggacat aatgggttgt ggaaaatgtg ttttaacatt 10500

tttatttttt ttttattcta cccgagttca ttgttgtttg aaccatcctc taaagatttc 10560

ctttaacctc taaatgttgt gcttttaggt tgataacaaa tgtaaagcac tgaggaggga 10620

ggaataaagc atacaagtta atttctaatt ttcgcaagcc tgaaccatcc taatctgata 10680

gtaggatgta tggcttcttc cttttcacct tgtgtgatgt ttaatttgag acgatctagc 10740

cataaaacta gtaatcttga attcctcttg agctggatgg tgattagcca ttgtgaaaac 10800

agattatatg gaaattgtgc atattgctaa attttaaaac atggatttat caactgataa 10860

taaaatatat cttacaagat aaccacttgt tttttaatgt aaaattgcac aagggcttaa 10920

gtttcattgc ctttcacagt ttaatctgta tatgaaatgg tgtagataca gtggaaatgg 10980

ttttccttaa aaccatctct ttaaagctgc ctttctggtg agtactgttt tatactttta 11040

tatattataa ttttatcttc taaaattaac tgaaatagga cactttgatt aaagaggtga 11100

gcactctgaa tttctacatc tttggatatt acttgaatca agaatattag aaaattattt 11160

taccacctgg catttccctt ttaatttgct agttcacttt tttctgacct tcacttaaca 11220

gactataaat acaaaaactt tgaacacata aattatttca ttttggtgag atggaataaa 11280

tgtttaaaat tagtatttaa gaaagttctt aaacattttt tttagttggc agccaaaaga 11340

tttttcttag tgctttggag acattgcata ggtgtaaaat taagatacca gaacttcatt 11400

ctgttcttgt tgaagctgtt gttgtggtga ttcatgagca gtaagctgga gttagagtgg 11460

aagaagggtt taccaaaatt cttcctgcag actagttgct tacagggttt ctttgagagg 11520

cttaaaaatt tcaaaagtat tatttaagcc actctaaccc tgcatgaaaa attggagtta 11580

gaaatactga tttctgagac cacgtatacc agtgaaaatt agcttctgag taaatttcta 11640

atttatgccc tgctttattt agcctcgcta tatgtaacac atggattatt ttttccctct 11700

agtttttaac tatatcctag attaaaacca gcatatgcta agaatgtttt tacattctgt 11760

ttcctcctgt gatctttctg aaccaataat aaacagtcaa ctgtgatgct ttttagtatg 11820

aacaatgata gttttctaaa atctgaaaat caatacctga gtatgtgatg tggcaatgca 11880

ttcttctaga taagcactaa acaaagtatg gaccctcaat ttatgtcttt aagatttaaa 11940

gtgaagtaaa tttctaagga actgtgtcct ttcctagcag gaataaacag tgaaaatttg 12000

gtaagtattt aacttgaagt gcatgtaata gtgatgagag taagtagcca aatttccgta 12060

atataaggta atgtttaaaa gtgagcaata attattgcat ctcttttgcg acttcatgta 12120

gatgtgatta acatttttta caaatttgcc tgcataaaga ttaaattgga acatacctta 12180

ctcctttgtc tggttttttt attttgtatg gtgctttaaa tactaatttt atatttcaag 12240

ctttttgcag ggtagaaata agtggctgtt aaagaaaata tcttcaagaa ggattatttc 12300

agtgtccctt tttaaaactc gatgatggct ttcagtttat ttaagtcttc tgtttttcag 12360

ctccagttaa aactgacaat aggcagctat caaaaatgga aaaaatcttg tgctctttct 12420

ggaatattag aggaatcagt taataatagt aaagtggtat taacccaata cttgatttgc 12480

agtttttaaa gcagttttta aattgagaga aaaggggctg ggcccagctg aggcgggtgg 12540

atctcctgag gtcaggagtt tgagaccagc ctggccaaca tagtgaaacc ccgtctctac 12600

taaaaataca aaaatcagcc gggtgtggtg ggacgtgcct gtaaccccag ctactctgga 12660

ggctgaggca ggaaaatcgc ttgaacccag ggggaggagg ttgcagtgag ccgagatggc 12720

gccgttgcac tccagcttgg gtgacagagc gagactccgt ctcaaaaaaa aaaagaaaaa 12780

aagaaaaagt gataagattt gggagtctat tccctgggat gttctattaa taataaagtg 12840

ataataaatg aaggttaaag tcaagtgttc aattactaca ccaggaaaga ttgattattt 12900

ctgaggaaaa ggtccattta tttccaaact agtctgtagt ggtttagagt aagcattatt 12960

ttatgaagtg gtacaagatt gcaaaggtta gtaaagggac ctgtctgtca ggtcaatctt 13020

cggtcttcac ttttactggc aagggattat gtgaagagta agtcatacaa gggatatgat 13080

tgtaaggagg tcctgaacaa agcatgataa atgttagtcc atgtgtatta ttaaatggtc 13140

taaagaaaaa tcatgactga tcgcataatt tttaatgtaa gtaaatgagc tcactaaggg 13200

taattaaata ctagctttta aaatttaaag ttctcacgaa tattagtgca tcttgtcact 13260

ttgatttgtc acctggttaa atagctggaa gcttgtgcaa atgaaaaatg aaatggaaga 13320

ctacatttgt atatatatct gtataatttt tgtttactag taggttcaga gagagatctg 13380

agatgttcct taacatgtag ccatgtaatt agaactcaca aggggcattg aaatgttttt 13440

ctttttcaga tagtctgggg ctatttactt attttaagta agccaagtct accatttgaa 13500

aaatggtgct ttatttccat atctgaagcc tgaagttatt ttttagtttg ttttcatcta 13560

aaagtggaaa gatttttgct tctgcgttat taagagcctc tttgtttgga ggagatggtt 13620

atctccttca ctcattaacc tttgagtgct tgttatctac aaagatgaat aaaatctttc 13680

atttattatt ta 13692

<210> 2

<211> 463

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Gly Arg Lys Lys Lys Lys Gln Leu Lys Pro Trp Cys Trp Tyr Cys

1 5 10 15

Asn Arg Asp Phe Asp Asp Glu Lys Ile Leu Ile Gln His Gln Lys Ala

20 25 30

Lys His Phe Lys Cys His Ile Cys His Lys Lys Leu Tyr Thr Gly Pro

35 40 45

Gly Leu Ala Ile His Cys Met Gln Val His Lys Glu Thr Ile Asp Ala

50 55 60

Val Pro Asn Ala Ile Pro Gly Arg Thr Asp Ile Glu Leu Glu Ile Tyr

65 70 75 80

Gly Met Glu Gly Ile Pro Glu Lys Asp Met Asp Glu Arg Arg Arg Leu

85 90 95

Leu Glu Gln Lys Thr Gln Glu Ser Gln Lys Lys Lys Gln Gln Asp Asp

100 105 110

Ser Asp Glu Tyr Asp Asp Asp Asp Ser Ala Ala Ser Thr Ser Phe Gln

115 120 125

Pro Gln Pro Val Gln Pro Gln Gln Gly Tyr Ile Pro Pro Met Ala Gln

130 135 140

Pro Gly Leu Pro Pro Val Pro Gly Ala Pro Gly Met Pro Pro Gly Ile

145 150 155 160

Pro Pro Leu Met Pro Gly Val Pro Pro Leu Met Pro Gly Met Pro Pro

165 170 175

Val Met Pro Gly Met Pro Pro Gly Leu His His Gln Arg Lys Tyr Thr

180 185 190

Gln Ser Phe Cys Gly Glu Asn Ile Met Met Pro Met Gly Gly Met Met

195 200 205

Pro Pro Gly Pro Gly Ile Pro Pro Leu Met Pro Gly Met Pro Pro Gly

210 215 220

Met Pro Pro Pro Val Pro Arg Pro Gly Ile Pro Pro Met Thr Gln Ala

225 230 235 240

Gln Ala Val Ser Ala Pro Gly Ile Leu Asn Arg Pro Pro Ala Pro Thr

245 250 255

Ala Thr Val Pro Ala Pro Gln Pro Pro Val Thr Lys Pro Leu Phe Pro

260 265 270

Ser Ala Gly Gln Ala Gln Ala Ala Val Gln Gly Pro Val Gly Thr Asp

275 280 285

Phe Lys Pro Leu Asn Ser Thr Pro Ala Thr Thr Thr Glu Pro Pro Lys

290 295 300

Pro Thr Phe Pro Ala Tyr Thr Gln Ser Thr Ala Ser Thr Thr Ser Thr

305 310 315 320

Thr Asn Ser Thr Ala Ala Lys Pro Ala Ala Ser Ile Thr Ser Lys Pro

325 330 335

Ala Thr Leu Thr Thr Thr Ser Ala Thr Ser Lys Leu Ile His Pro Asp

340 345 350

Glu Asp Ile Ser Leu Glu Glu Arg Arg Ala Gln Leu Pro Lys Tyr Gln

355 360 365

Arg Asn Leu Pro Arg Pro Gly Gln Ala Pro Ile Gly Asn Pro Pro Val

370 375 380

Gly Pro Ile Gly Gly Met Met Pro Pro Gln Pro Gly Ile Pro Gln Gln

385 390 395 400

Gln Gly Met Arg Pro Pro Met Pro Pro His Gly Gln Tyr Gly Gly His

405 410 415

His Gln Gly Met Pro Gly Tyr Leu Pro Gly Ala Met Pro Pro Tyr Gly

420 425 430

Gln Gly Pro Pro Met Val Pro Pro Tyr Gln Gly Gly Pro Pro Arg Pro

435 440 445

Pro Met Gly Met Arg Pro Pro Val Met Ser Gln Gly Gly Arg Tyr

450 455 460

<210> 3

<211> 600

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

catatatgtc acaagaaatt gtatacagga cctggcttag ctattcattg catgcaggta 60

cataaagaaa caatagatgc cgtaccaaat gcaatacctg gaagaacaga catagagttg 120

gaaatatatg gtatggaagg tattccagaa aaagacatgg atgaaagacg acgacttctt 180

gaacagaaaa cacaagaaag tcaaaaaaag aagcaacaag atgattctga tgaatatgat 240

gatgacgact ctgcagcctc aacttcattt cagccacagc ctgttcaacc tcagcaaggt 300

tatattcctc caatggcaca gccaggactg ccaccagtac caggagcacc aggaatgcct 360

ccaggcatac ctccattaat gccaggtgtt cctcctctga tgccaggaat gccaccagtt 420

atgccaggca tgccacctgg attgcatcat cagagaaaat acacccagtc attttgcggt 480

gaaaacataa tgatgccaat gggtggaatg atgccacctg gaccaggaat accacctctg 540

atgcctggaa tgccaccagg tatgccccca cctgttccac gtcctggaat tcctccaatg 600

<210> 4

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tggaatgatg ccacctggac 20

<210> 5

<211> 18

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cctgagcctg tccagcac 18

<210> 6

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cagtgctgga caggctcag 19

<210> 7

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

attgaagccg ctggtttagc 20

<210> 8

<211> 19

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cagtgctgga caggctcag 19

<210> 9

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgaagccgct ggtttagctg 20

<210> 10

<211> 20

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tggaatgatg ccacctggac 20

<210> 11

<211> 18

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cagctgcctg agcctgtc 18

Claims (6)

1. The application of a reagent for detecting the expression quantity of a marker ZNF207 in preparing a lung adenocarcinoma diagnostic kit is characterized in that the marker is mRNA expressed by a gene ZNF207, and the nucleotide sequence of the mRNA expressed by the gene ZNF207 is shown as SEQ ID No. 1.

2. The application of a reagent for detecting the expression quantity of a marker ZNF207 in preparing a lung adenocarcinoma diagnostic kit is characterized in that the marker is a protein expressed by a gene ZNF207, and the amino acid sequence of the protein expressed by the gene ZNF207 is shown as SEQ ID NO. 2.

3. The use of claim 1, wherein the means for detecting mRNA comprises high-throughput RNA sequencing, RNA-in situ hybridization, and fluorescent quantitative PCR.

4. The use of claim 2, wherein the means for detecting the protein comprises immunohistochemistry, western blotting, and enzyme-linked immunosorbent assay.

5. The use as claimed in claim 3 wherein the RNA-in situ hybridisation probe sequence for the gene ZNF207 is as shown in SEQ ID No. 3.

6. The use as claimed in claim 3 wherein the base sequence of the fluorescent quantitative PCR primers for detecting the gene ZNF207 is as shown in SEQ ID No.4 to 11.

Images